Previous Article | Next Article 
J Virol, February 1998, p. 1252-1261, Vol. 72, No. 2
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Use of Differential Display Reverse
Transcription-PCR To Reveal Cellular Changes during Stimuli That Result
in Herpes Simplex Virus Type 1 Reactivation from Latency: Upregulation
of Immediate-Early Cellular Response Genes TIS7, Interferon, and
Interferon Regulatory Factor-1
Ruth
Tal-Singer,1,2
Wawrzyniec
Podrzucki,1
Todd M.
Lasner,1,3
Aikaterini
Skokotas,1
Jeffry J.
Leary,2,*
Nigel W.
Fraser,1 and
Shelley
L.
Berger1,*
The Wistar Institute1
and
Division of Neurosurgery, Hospital of the University of
Pennsylvania,3 Philadelphia, and
Department of Molecular Virology and Host Defense, SmithKline
Beecham Pharmaceuticals, Collegeville,2
Pennsylvania
Received 8 August 1997/Accepted 15 October 1997
 |
ABSTRACT |
The detailed mechanism which governs the choice between herpes
simplex virus (HSV) latency and reactivation remains to be elucidated.
It is probable that altered expression of cellular factors in sensory
neurons leads to induction of HSV gene expression resulting in
reactivation. As an approach to identify novel cellular genes which are
activated or repressed by stimuli that reactivate HSV from latency and
hence may play a role in viral reactivation, RNA from explanted
trigeminal ganglia (TG) was analyzed by differential display reverse
transcription-PCR (DDRT-PCR). Nearly 50 cDNAs whose mRNA level was
modified by the stress of explantation were isolated and sequenced. We
present a listing of a spectrum of altered RNAs, including both known
and unknown sequences. Five of those differentially displayed
transcripts were identified as interferon-related murine TIS7 mRNA.
These results were confirmed in both infected and uninfected ganglia by
quantitative RNase protection assay and immunostaining. Alpha and beta
interferons and interferon regulatory factor-1 (IRF-1) were also
induced by explantation. In addition, we have identified sequences that
correspond to IRF-1 consensus binding sites in both HSV type 1 origins
of replication. Our findings suggest that physiological pathways that
include these cellular factors may be involved in modulating HSV
reactivation.
 |
INTRODUCTION |
Following primary infection, latent
herpes simplex virus (HSV) persists in sensory ganglia of the
peripheral nervous system. The virus can undergo sporadic reactivation
to produce recurrent mucocutaneous lesions at peripheral sites
innervated by the infected ganglia (reviewed in references 15,
46, and 53). Reactivation stimuli range
from direct mechanical or pharmacological insults to the neuron and
surrounding tissue to systemic changes in immune modulators and
neurotransmitters (15, 16, 24). The earliest molecular
events in neuronal cells that trigger reactivation of HSV remain
unclear. It is thought that these events include altered expression of
cellular factors such as induction of transcriptional activators and
down-regulation of repressors. Identification of cellular factors which
are induced during the reactivation process may lead to better
understanding of the cellular environment during viral induction and
may facilitate development of an effective treatment to prevent
reactivation.
The present knowledge of the molecular pathogenesis of HSV latency and
reactivation was generated from studies in laboratory animals including
mice, guinea pigs, and rabbits (reviewed in reference
47). We and others have found current murine in vivo models to be inefficient in reactivation of the viral genome (13, 14, 21, 41, 48, 67). In contrast, the murine explant reactivation
model is exceptionally useful for studying the molecular mechanisms of
HSV reactivation, because infectious virus can be efficiently recovered
upon explantation and culture of latently infected sensory ganglia
(reviewed in reference 16). Using this model, we
detect expression of viral early genes coincident with expression of
immediate-early (IE) genes. Moreover, cellular IE factors Oct-1, Fos,
Jun, and Myc are induced within the first 2 h following
explantation of trigeminal ganglia (TG), prior to first detection of
viral gene expression (54, 60).
Our goal in this study was to seek novel cellular factors which may
have a role in the reactivation process. Moreover, we sought to
identify factors whose expression is altered even in the absence of
latent HSV type 1 (HSV-1) infection and induction, since such cellular
factors would also be candidates for causative agents in viral
reactivation. To identify such factors, we used differential display
reverse transcription-PCR (DDRT-PCR), which allows the visualization
and subsequent isolation of cDNAs corresponding to mRNAs displaying
altered expression in different cell populations (34, 35).
We compared the levels of gene expression in TG populations derived
from various time points postexplantation (p.e.). Thus, any factors
modulated during the first 4 h, the period in which induction of
viral gene expression was previously detected (12, 54), may
be important in the initial stimulation of latent viral genomes.
Recent studies have used DDRT-PCR to identify genes that are involved
in neural stress and injury (26, 30, 42). For example, Kiryu
et al. (30) demonstrated differential expression of the rat
neuronal glutamate transporter in axotomized hypoglossal motor neurons.
Since glutamate transporter expression was induced in response to
neuronal injury, it may be involved in the regeneration process. Others
used DDRT-PCR to isolate a novel neuropeptide, called
melanin-concentrating hormone, in the hypothalamic response to
starvation (42). DDRT-PCR has also been used to identify cellular genes modulated by simian virus 40 and Epstein-Barr virus (EBV) transformation (51, 68). However, it is a novel
approach to study viral reactivation.
In this study, we isolated approximately 50 differentially displayed
cDNAs representing transcripts whose levels were altered within the
first 4 h following explantation of TG. Five cDNAs were identical
to murine TIS7, whose sequence has been shown to be related to those of
interferons (IFNs) (50, 58, 61). We also detected rapid
induction of IFN-
and -
in neuronal cells of TG explants. In
addition, other factors, such as the transcriptional activator IRF-1
(IFN regulatory factor-1) and the mitogen TNF-
(tumor necrosis
factor alpha), were induced by explantation. Interestingly, we have
identified sequences corresponding to IRF-1 consensus binding sites in
both HSV origins of replication. We discuss the possibility that HSV
reactivation involves the induction of a regulatory pathway shared with
IFN-related genes and that specific inductive events of the viral
genome occur in response to these regulatory factors.
 |
MATERIALS AND METHODS |
Infection of mice and explant reactivation.
Four- to
six-week-old female BALB/c BYJ mice were obtained from Jackson
Laboratory. Mice were anesthetized with intraperitoneal injection of
ketamine (87 mg/kg)-xylazine (13 mg/kg) and then, after corneal
scarification, inoculated in the eye with 104 PFU of HSV-1
17+ (7). At a minimum of 28 days postinfection, mice were
sacrificed by cervical dislocation and TG were isolated. Groups of 6 to
10 explanted TG were incubated in Dulbecco's modified Eagle medium
supplemented with 5% fetal bovine serum at 37°C for 0, 1, 2, 4, or
24 h p.e. In a single experiment, TG were explanted in the absence
of serum.
Extraction of RNA.
Ganglia used for RNA preparation were
snap frozen in liquid nitrogen. RNA was isolated from TG and brain
stems by using the TRIzol reagent, as described by manufacturer (Gibco
BRL), followed by extensive digestion with RNase-free DNase I
(Boehringer Mannheim Biochemicals) and ethanol precipitation. RNA
concentrations were determined by spectrophotometer and agarose gel
electrophoresis (37).
DDRT-PCR.
cDNA was prepared from 300 ng of RNA from latently
infected TG at 0, 1, 2, and 4 h p.e., using a Differential Display
kit (Display Systems Biotech, Inc., Los Angeles, Calif.) as described by the manufacturer. Primers used in this study are listed in Table
1. Briefly, RNA from each sample was
incubated with one of nine downstream primers containing 11 T residues
and two-nucleotide anchors (AA, AC, AG, CA, CC, CG, GA, GC, and GG) for
1 h at 40°C, followed by 5 min at 95°C to inactivate the
Moloney murine leukemia virus enzyme. cDNA was stored at
70°C. Each
cDNA was subjected to PCR amplification with DisplayTaq (Display
Systems Biotech), using the original downstream primer, 1 of 24 10-mer
5' primers, and [
-33P]dATP (65). PCR
conditions were 35 cycles of 30-s denaturation at 94°C, 60-s primer
annealing at 40°C, and 60-s extension at 72°C in a Perkin-Elmer
Cetus Gene Amp PCR System thermocycler. A final extension reaction was
then performed for 5 min at 72°C. Radiolabeled reaction products were
subjected to high-resolution polyacrylamide-urea gel electrophoresis as
described previously (35). Gels were dried on Whatman
filters and analyzed by autoradiography. Differentially displayed PCR
bands were cut out from the filter paper and dissolved in diethyl
pyrocarbonate-treated water (Ambion, Austin, Tex.) for 30 min at room
temperature followed by 10 min at 100°C.
Reamplification PCR.
To ensure that each band analyzed
contained a single cDNA species, each differentially displayed band was
reamplified in four individual PCRs. Four T7-T11VVN 3' primers were
used, where VV was the original DDRT nucleotide anchor (Table 1), T7
was a 23-nucleotide portion of the T7 promoter
(TAATACGACTCACTATAGGGCCC), and N was A, G, T, or C. The
reamplification reactions included the original upstream primers, 2 µM deoxynucleoside triphosphate, and the Stoffel fragment of
Taq polymerase (Perkin-Elmer Cetus). Reactions were performed under the original DDRT-PCR conditions. PCR products were
separated by agarose electrophoresis, and the most prominent product
among the four parallel reactions was isolated for automated sequencing
and further confirmation.
Confirmation of differentially regulated expression.
Isolated reamplification bands were used as templates for synthesis of
32P-labeled riboprobes with a MAXIscript kit (Ambion) as
described by manufacturer. RNase protection assays (RPA) were performed with a Hybspeed RPA kit (Ambion) and 0.5 to 1 µg of total RNA from a
second, new set of latently infected and uninfected TG explants. Mouse
-actin riboprobes provided with the MAXIscript kit were used as
controls. Probes and protected fragments were analyzed by denaturing
polyacrylamide gel electrophoresis (PAGE) and phosphorimaging.
PCR amplification of cDNA.
The second confirmatory PCR using
specific primer sets was performed as follows. cDNA was generated from
2 µg of total RNA by using Superscript preamplification kit priming
with oligo(dT) and random hexamers (Gibco BRL). Reactions were
performed in 25-µl volumes containing 4% cDNA, 200 µM each
deoxynucleoside triphosphate (Pharmacia), 1 µM each primer, and 1.25 U of AmpliTaq Gold (Perkin-Elmer) in PCR buffer A (Fisher). Primer
pairs used are described in Table 3. Primers specific for TIS7 were
designed based on the published sequence (63). Cycling
reactions were performed with a Perkin-Elmer Cetus Gene Amp PCR System
thermocycler. After one cycle of 9-min denaturation at 94°C, cycles
were as follows: (i) 1 min of denaturation at 94°C, (ii) annealing at
60°C for 1 min, and (iii) extension for 2 min at 72°C. The final
cycle was terminated with a 7-min extension at 72°C. Amplification
was carried out for 25 to 35 cycles. RT
reactions were
included in each set of experiments as negative controls, and 10 ng of
mouse DNA was used as a positive control. In every case, the size of
PCR product bands corresponded to the predicted size.
Detection of PCR products.
Aliquots of 40% of the
amplification products were fractionated on 2.5% NuSieve agarose
(FMC). Gels were stained with ethidium bromide (Sigma), and the amounts
of products were quantitated by fluorimetry. The relative amount of PCR
product was determined in arbitrary numbers as the ratio between the
PCR product band intensity to that of cellular housekeeping gene
encoding cyclophilin or
-actin (12, 54). Statistical
analysis was performed with Excel (Microsoft, Redmond, Wash.).
Immunohistochemical procedures.
Ganglia used for
immunohistochemistry were immersed in 70% ethanol-150 mM NaCl for
24 h and then embedded in paraffin wax, and 6-µm serial sections
were cut and processed as described elsewhere (45). Rabbit
polyclonal antiserum to HSV-1 (Dako Corp., Carpinteria, Calif.) was
used for detection of replicating virus as described elsewhere (1,
28). Rabbit polyclonal anti-mouse IFN-
/
(Lee Biomolecular
Research, San Diego, Calif.) and rabbit polyclonal anti-mouse TNF-
(Genzyme Diagnostics, Cambridge, Mass.) were used to probe for
cytokines. Rabbit polyclonal anti-TIS7 was a generous gift from B. Varnum, Amgen, Thousand Oaks, Calif. Antigen-expressing cells were
detected by an indirect avidin-biotin immunoperoxidase method
(Vectastain ABC kit; Vector Laboratories, Burlingham, Calif.), with
3,3'-diaminobenzidine as the chromagen (59).
 |
RESULTS |
We recently have shown that cellular IE factors, such as c-Jun,
c-Myc, and Oct-1, are induced in neuronal cells at early times following explantation of murine TG, within the time frame of HSV-1
gene activation (54, 60). DDRT-PCR was used in this study as
an approach to identify previously unknown cellular genes which are
induced or repressed by explantation of TG.
Explantation of TG induces differential expression of multiple
mRNAs.
RNA was prepared from latently infected TG at different
time points (0, 1, 2, and 4 h) following explantation into culture media. Complementary DNA was amplified by using a set of arbitrary PCR
primers. The PCR products were resolved by PAGE and visualized by
autoradiography. Every pair of primers (216 primer combinations) identified a limited number of target sequences within the pool of
cDNAs. Thus, a typical reaction generated 50 to 200 distinct radiolabeled PCR products between 50 and 600 bp in length. As expected
from previous studies (34), the majority of PCR products were present at identical levels in samples derived from different time
points (Fig. 1). However, over 50 differentially displayed PCR products were detected and isolated for
further characterization.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 1.
PCR differential display of cDNA derived from latently
infected mouse TG following explantation. In the autoradiograph of
radiolabeled DDRT-PCR products, arrows denote PCR products representing
band 64 amplified with 3' primer 2 and 5' primer 7, band 56 amplified
with 3' primer 2 and 5' primer 3.
|
|
Reamplified PCR products were subjected to sequencing followed by BLAST
sequence analysis (
2) and MasPar searches of the
NCBI
nonredundant nucleotide database. Of 48 bands sequenced,
26 were novel
sequences without significant sequence homology
in the database
(results not shown), whereas others had multiple
significant hits
(
P value was less than 1 e

10). The analysis
of
results, including GenBank accession numbers for the most significant
hits, are summarized in Table
2. Five
bands corresponded to structural
genes encoding proteins such as
laminin and tubulin, and two (bands
54 and 53) encoded repeating
sequence elements. Fifteen database
hits were similar to cellular
enzymes or regulatory proteins of
interest such as NADH ubiquinone
oxyreductase (bands 218 and 20),
the growth arrest gene GAS5 product
(band 123), and mouse semaphorin
(band 229). Bands 56, 64, 116, 125, and 201 were identical in
sequence to the coding region of mouse TIS7
mRNA (
61) (Table
2; Fig.
2)
and were conserved with rat PC4 mRNA sequence (
58).
TIS7 and
rat PC4 previously were shown to be highly related in
protein sequence
and are thought to be functional homologs involved
in stress response
(
58,
61). These five overlapping products
(Fig.
2B) were
chosen for further characterization.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 2.
Sequences of DDRT-PCR products. cDNAs isolated from
differential display gels were reamplified by using primers that
included the T7 promoter sequence, and PCR products were sequenced.
Sequences were analyzed by BLAST searches. (A) BLAST output using band
56 as query sequence (P value = 7.7 × 10 49) demonstrates sequence identity with murine TIS7.
(B) Alignment of each DDRT band with TIS7 mRNA. Four cDNA bands
corresponded to mouse IFN-related gene TIS7 mRNA; band 56 (primers 2 and 7), band 64 (primers 2 and 3), band 116 (primers 6 and 2), and band
125 (primers 6 and 7).
|
|
Confirmation of differential display.
The intensity of each of
the five PCR products (56 [Fig. 1], 64 [Fig. 1], 116, 125, and 201)
was clearly increased in samples prepared 1 and 2 h p.e. We next
determined whether RNA corresponding to the isolated bands was
differentially expressed in either uninfected or latently infected TG
explants. Reamplified PCR products were used as probes in quantitative
RPA. RNA corresponding to band 56 was induced by 2 h following
explantation of uninfected (Fig. 3A) and
infected (results not shown) explants. Phosphorimager quantitation
(Fig. 3B) indicated that the levels of RNA were induced nearly
sevenfold by 4 h. Similar results were obtained with probes generated from band 64 (results not shown). Thus, RNA transcripts corresponding to differentially displayed bands 56 and 64 were significantly induced in uninfected TG by explantation.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
Confirmation of differential display. RNA was prepared
from uninfected TG explants at 0, 1, 2, and 4 h p.e. Complementary
DNA from differentially displayed band 56 was reamplified by PCR using
3' primers that included the T7 promoter. PCR products were used as
templates to prepare riboprobes labeled with [32P]UTP and
added to each RNA sample. Following hybridization at 37°C and RNase
digestion, samples were separated by PAGE. (A) The input probe (P) and
protected fragments were visualized using phosphorimager screens. (B)
The intensity of each protected fragment was quantitated with
ImageQuant software. Fold induction was expressed as the ratio between
each band to the zero time point. (C) Complementary DNA from latently
infected TG explants at 0 to 24 h p.e. was subjected to PCR using
primers specific for TIS7 (TIS7A set). Products were separated on 2.5%
agarose gels stained with ethidium bromide and visualized by
fluorimager analysis.
|
|
To further confirm the DDRT results, cDNA prepared from a different set
of latently infected TG explants was subjected to
PCR using primers
specific for TIS7 (Table
3). Each PCR
yielded
a single product band whose size corresponded to that of TIS7
cDNA. Importantly, TIS7 detected with these primers was induced
rapidly
following explantation in both infected (Fig.
3C) and
uninfected (not
shown) explants, confirming the RPA results (Fig.
3A). Furthermore, by
24 h p.e., TIS7 expression returned to basal
levels (Fig.
3C).
TIS7 expression is induced in neuronal cells.
HSV latency
occurs primarily in neuronal cells which innervate the cornea (9,
43, 44). Infected neurons represent approximately 2% of the
neuronal population in the TG (4, 38). To determine whether
TIS7 expression colocalizes with reactivating virus in neuronal cells,
TG sections from uninfected and latently infected explants were
analyzed by immunostaining using affinity-purified polyclonal antisera.
TIS7 protein expression was not detected at 0 h p.e. and was
induced at 1, 2, and 4 h p.e. in both infected (data not shown)
and uninfected (Fig. 4) explants.
Furthermore, as judged by this technique, all neuronal cells expressed
TIS7, demonstrated by brown staining of the cells. Since virus
reactivates in approximately 1% of neuronal cells (60), we
conclude that viral gene expression occurs in cells expressing TIS7.
Thus, induced expression of TIS7 following explantation of ganglia was
detected by four independent methods: DDRT-PCR, sequence-specific
RT-PCR, RPA, and immunostaining.

View larger version (162K):
[in this window]
[in a new window]
|
FIG. 4.
Immunostaining of TIS7 in TG following explantation.
Latently infected BALB/c mice were sacrificed, and TG were excised and
incubated in culture medium for 0 to 24 h. Paraffin-embedded
sections of uninfected TG at 0 (A), 1 (B), 2 (C), and 4 (D) h p.e. were
processed as described in Materials and Methods and reacted with rabbit
polyclonal antiserum against TIS7. The experiment was repeated twice,
and duplicate slides were screened.
|
|
IFN-
is induced by explantation of TG.
Several reports have
indicated that TIS7 and PC4 are related in sequence to IFN-
(50, 58). To determine whether IFNs are also induced by
explantation, we again used qualitative RT-PCR. cDNA derived from
infected and uninfected TG explants was analyzed by PCR using primers
specific for IFN-
or IFN-
(Table 3). Again, single specific PCR
products were obtained from each reaction. IFN-
was induced 2- to
3.5-fold during the 4 h p.e. compared to the amount of the
cellular housekeeping gene encoding cyclophilin (Fig.
5A). Similarly, IFN-
levels were 1.2- to 1.4-fold higher (data not shown). Both IFN-
and IFN-
were
induced in uninfected samples as well (data not shown).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 5.
Detection of IFN- , IRF-1, IFN / R, and IRF-2
transcripts in murine TG following explantation. RT-PCR was used to
detect IFN- (A), IRF-1 (B), IFN / R (C), and IRF-2 (D), and each
was compared to the level of cyclophilin mRNA. Duplicate samples of TG
explant RNA from 0, 1, 2, and 4 h p.e. were analyzed. Products
were separated by agarose gel electrophoresis, followed by fluorimager
scanning and analysis using ImageQuant software. The relative amount of
cDNA is expressed in arbitrary units representing the ratio between the
intensity of the PCR product band to the intensity of cyclophilin. The
ratio at the zero time point is designated 1. L indicates latent.
|
|
IFN expression is induced in neuronal cells.
To determine
whether IFN expression colocalizes with reactivating virus in neuronal
cells, TG sections from latently infected and uninfected explants were
analyzed by immunohistochemistry. IFN-
/
protein expression was
not detected at 0 h p.e. and was induced at 4, 8, and 24 h
p.e. in both infected and uninfected explants (Fig.
6). Furthermore, as observed for TIS7,
all of the neuronal cells expressed IFN. Thus, we conclude that viral
gene expression occurs in cells expressing IFN.

View larger version (194K):
[in this window]
[in a new window]
|
FIG. 6.
Immunostaining of IFN protein in TG following
explantation. Latently infected or uninfected BALB/c mice were
sacrificed, and TG were excised and incubated in culture medium for 0 to 24 h. Paraffin-embedded sections of latently infected TG at 0 (A), 4 (B), 8 (C), and 24 (D) h p.e. and of uninfected TG 0 (E) and 4 (F) h p.e. were processed as described in Materials and Methods and
reacted with rabbit polyclonal antisera against IFN- and - . The
experiment was repeated twice, and duplicate slides were screened.
|
|
Induction of IRF-1.
The IRFs bind to IFN consensus sequences
found in many promoters of IFN gene family members (22, 56,
57). IRF-1 is an activator of IFN-
, whereas IRF-2 functions as
a repressor (66). As shown in Fig. 5B, IRF-1 transcription
was induced within the first hour p.e., and its profile of induction
was strikingly similar to IFN-
(Fig. 5A). In contrast, no
significant change was observed in the levels of the IFN-
/
receptor (IRF
/
R) or IRF-2 (Fig. 4D and 5C). Induction of IFN and
IRF-1 also occurred in the absence of serum in the explantation media
(not shown), indicating that serum factors are not the cause for
increased gene expression. Induction of IFN and IRF-1 was detected
reproducibly in both infected and uninfected preparations (not shown),
as was also found for TIS7 (Fig. 3). Our results suggest that IFN
induction after explantation of TG involves an IRF-1-dependent pathway.
We used computational analysis to probe the HSV-1 genome for IRF-1
consensus binding sites (AAGTGA) (56). As shown
in Fig. 7, 10 matches were identified in
HSV-1 17+. Interestingly, two of the matches were in the
ICP0/latency-associated transcript (LAT) region, and four mapped to
palindromes in viral origins of replication OriL and OriS. These
observations are discussed below.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 7.
Putative IRF-1 binding sites in the HSV-1 17+ genome,
identified by sequence analysis using the Findpatterns function of the
Genetics Computer Group (Madison, Wis.) software. The HSV-1 complete
genome sequence (GenBank locus HE1CG accession no. X14112) was searched
for the consensus IRF-1 binding site in IFN promoters the hexamer
AAGTGA (56). Sequence matches are listed by
sequence location, and gene name.
|
|
TNF-
is induced by TG explantation.
Soluble TNF-
enhances the reactivation frequency and replication of HSV-1 during
explant reactivation (63). To determine whether endogenous
TNF-
is induced during explantation, RT-PCR was performed with
primers specific for TNF-
. TNF-
transcripts were induced rapidly
following explantation (Fig. 8). However, we were unable to detect TNF-
, a secreted factor, in TG sections by
immunostaining.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 8.
RT-PCR detection of TNF- , cyclophilin, and -actin
transcripts in murine TG cultured for various times p.e. RNA from
latently infected TG explants was prepared and analyzed by RT-PCR for
TNF- (A), and -actin (B), and cyclophilin as described in
Materials and Methods. Products were visualized by ethidium bromide
staining as shown in the inserts. The graphs represent the ratio
between the PCR product band and the cyclophilin band. The ratio at the
time of explant (time zero) was determined as 1. Experiments were done
in duplicate in four separate experiments. L indicates latent.
|
|
 |
DISCUSSION |
Cellular genes induced by the stress of explantation.
We have
used DDRT-PCR to identify genes that are differentially expressed
following the stress caused by explantation of murine TG. We previously
established that these are conditions that induce viral gene activation
and that certain HSV-1 genes are detected by 4 h p.e.
(54). Mice were infected with HSV-1 by the corneal route; at
4 weeks postinfection, mice were sacrificed and the TG were explanted.
RNA was prepared from TG at various times following explantation and
then subjected to DDRT-PCR. The genes that we identified can be
classified into three groups (Table 2): (i) 26 previously unknown
sequences; (ii) known structural genes; and (iii) sequences
corresponding to previously known genes associated with regulation of
cellular processes (Table 2). While we recognize the possibility that
none of these gene products directly influence the HSV reactivation
process, the possibility that one or more are directly essential to
viral activation is just as likely. Furthermore, the identification of
these induced genes may reveal major stress-altered intracellular
pathways, any component of which could be key to reactivation,
including any of the previously unknown genes. Of the regulatory genes
identified in the third group, the murine IFN-related TIS7 gene was
represented multiple times. Because of this observation, our initial
studies focused on TIS7, the related IFN genes, and known
transcriptional regulators of these genes. Interestingly, these studies
revealed a potential link between the IFN regulatory pathway and
regulation of viral gene expression during reactivation.
TIS7 is induced by the stress of explantation.
Five
differentially displayed bands were identified as overlapping regions
of murine TIS7 (36, 61) (Fig. 2), and the results were
confirmed by quantitative RPA, RT-PCR (Fig. 3), and immunostaining (Fig. 4). The TIS (TPA [tetradecanoyl phorbol acetate]-inducible sequences) family members are early-response genes (64)
which are induced rapidly and transiently in Swiss 3T3 cells by the tumor promoter and mitogen TPA (36) or by serum
(22). Most of the TIS genes also have been identified in rat
PC12 cells following induction with nerve growth factor, TPA, epidermal
growth factor, and depolarization (32). In addition, TIS
induction has been detected in primary astrocyte cultures following
mitogen induction (3). Thus, a family of TIS genes appear to
constitute a common pathway or response to many cell stimulatory agents
or physical stimuli.
The pattern of induction previously observed for TIS7 and PC4 genes in
these systems revealed an increase in the levels of
RNA or protein
between 2 and 4 h poststimulation (
62), similar
to our
observation in the mouse explant model (Fig.
2 to
5). Moreover,
we have
shown that another TIS transcript, TIS28 or c-
fos, was
induced rapidly following explantation (
54,
60), and again,
the kinetics matched those previously observed for c-
fos
following
mitogen induction (
3). These observations suggest
that explantation
and mitogen stimulation activate similar cellular
early-response
pathways which activate or induce TIS genes. One
interesting possibility
suggested by our results, although we have not
yet obtained confirming
evidence, is that these pathways also may be
among the earliest
events involved in the induction of latent
herpesvirus.
IFN-
is induced by the stress of explantation.
TIS7 was
originally identified as a gene induced in murine 3T3 cells following
infection with Newcastle disease virus (50). Nucleotide
sequence analysis revealed some similarity with human IFN-
and rat
IFN-
(58). We have shown that, like TIS7, both IFN-
and IFN-
are induced in neuronal cells within the first hour
following explantation. These observations suggest that these IFN-related genes, although different in function, may share a common
cellular pathway that may be involved in the early events of HSV
reactivation.
IFN-

expression is modulated at the transcriptional level by
multiple regulatory factors that bind upstream of the initiation
site,
such as the activators IRF-1 and NF-

B and the repressor
IRF-2
(reviewed in reference
56). We have shown that IRF-1
was
induced by the stress of explantation. In contrast, neither IRF-2
nor the IFN receptor was induced (Fig.
5). Since the induction
of IRF-1
followed the same temporal pattern as that of IFN, IFN-
and -

are
likely to be induced via an IRF-1-dependent pathway
(
27) in
explanted TG cells. Induction of IFN expression has
been previously
observed following HSV infection (
17,
18,
52). However, we
detected induction of IFN at 1 to 2 h p.e.,
prior to viral gene
induction, which we detected at 2 to 4 h p.e.
(
54).
Furthermore, IFN induction was detected in neurons of
both latently
infected and uninfected TG. We also found that IFN-
and IRF-1 were
induced in the TG in the absence of serum in the
explantation medium.
Taken together, these data indicate that
IFN induction is a consequence
of the stress of explantation and
did not result from viral gene
expression or from incubation in
the presence of serum factors.
Possible relationship between reactivating HSV and IFNs.
IFN
possesses antiviral properties and indeed is induced by HSV infection
(17, 18, 52). Several mechanisms have been elucidated for
specific effects of IFN on HSV. For example, IFN is an inhibitor of HSV
IE gene activation by VP16 in vitro (33). We recently
determined that both early and IE HSV genes are induced during the
first hours of viral reactivation (54). Thus, the absence of
viral IE gene expression prior to early gene expression during the
first hours following explantation of TG may be a result of an
inhibitory effect of IFN on a neuron-specific VP16 functional homolog.
Furthermore, IFN blocks both HSV morphogenesis and release of viral
particles from infected cells (
8). The presence of
antiviral
activity during the earliest times following tissue
stimulation
suggests an interesting relationship between IFN and
reactivating HSV.
Viral gene activation may induce one round of
viral replication,
allowing the virus to travel from TG neurons
to the site of
recrudescence in corneal epithelium. Immediate
induction of IFN may
prevent the spread of reactivating virus
within the nervous system by
inhibiting release of viral particles
and activating host defense
mechanisms such as natural killer
cells (
22). Moreover, in
another virus system, neuroblastoma
cells expressing high levels of
IFN-

support persistent rabies
virus infections (
25).
This finding suggests that the IFN response
may be involved in ensuring
the viability of infected host cells.
IRF-1 has been implicated in the
antiviral effects of IFNs on
encephalomyocarditis virus by inhibiting
viral replication. However,
in IRF-1
/
fibroblasts
derived from knockout mice, there was minimal reduction
of
IFN-

-mediated inhibition of HSV-1 replication (
29). This
finding suggests that IRF-1 is not essential for IFN inhibition
of
HSV-1 replication in fibroblasts. Further latency studies in
IRF-1
/
mice or ganglia may clarify the role of IRF-1 in
HSV pathogenesis.
In a different scenario, IFN may inhibit viral reactivation in neurons,
and in a few cells, other cellular factors override
its effects by
inducing high levels of viral gene expression.
For example, Walev et
al. (
63) have shown that treatment of
TG explants with
soluble IFN inhibits reactivation, detected by
reduction of infectious
virus in the presence of IFN. In contrast,
in the same study, TNF-

treatment increased the efficiency of
reactivation. These data support
the hypothesis that induction
of IFN inhibits multiple rounds of viral
replication in neuronal
cells of the TG. Consistent with this scenario,
we detected induction
of TNF-

transcription in TG explants (Fig.
8)
under conditions
leading to viral reactivation. Thus, it is possible
that the levels
of TNF-

in few neurons (perhaps 1% of latent
neurons) are higher
than the levels of IFN, allowing the latent viral
genome to reactivate
in those neurons.
Are TIS7, IFN, and viral responses related?
TIS7 and IFNs are
induced by viral infection (50, 56) and, as shown in this
study, by the stress of explantation. While the precise function of
TIS7 in the cell is not yet elucidated, it is clear that it plays a
role in cellular growth and differentiation (19, 23).
Furthermore, it is known that TIS7 has no antiviral activity
(58), which is a property of IFNs (56). One
unifying hypothesis is that these cellular components may share a
common induction pathway with HSV. In particular, as suggested above, TIS7, IFN family members, and HSV share a common regulatory element. Thus, our initial detection of TIS7 and IFN increasing in explanted TG
led us to test whether IRF-1 was also increasing. The observation that
IRF-1 expression was increasing in explants in a similar time frame to
IFN and TIS7, and prior to HSV gene activation, leads to our
speculation that IRF-1 may play a direct role in reactivation of the
HSV genome. As yet, we do not have direct experimental evidence to
demonstrate that HSV-1 responds to IRF-1.
However, in support of this hypothesis, we have identified multiple
sequences corresponding to potential IRF-1 binding sites
in HSV-1 DNA
(Fig.
7). As shown in Fig.
7, there are 10 perfect
matches in HSV-1 17+
to the core IRF-1 consensus sequence (AAGTGA)
(
56). Of particular interest are several binding sites
in the
origins of replication OriS and OriL. Two are an inverted repeat
within the palindrome in OriL, and the other two are in OriS;
strikingly, all are conserved in HSV-1 and HSV-2 strains (not
shown).
These consensus sites are within regions previously identified
as
origin binding protein or UL9 binding site III. Also, of great
interest
are previous observations that, in addition to binding
origin binding
protein, binding site III interacts with yet unknown
cellular proteins
(
10,
11). Taken together, these observations
suggest that
IRF-1 may bind to regulatory elements in the viral
genome such as the
origins of replication and ICP0/LAT and thereby
upregulate viral
replication or gene expression. Interestingly,
functional IRF binding
sites recently were identified in the herpesvirus
EBV (
40,
49). IRF-1 and IRF-2 bind directly to consensus sequence
sites in
the EBV type I latency promoter of EBNA-1 (Qp), and IRFs
may play a
primary role in transcriptional regulation of EBNA-1
in cell culture
(
40,
49). Experiments are in progress to determine
whether
IRF-1 or IRF-2 binds to IRF consensus sites in HSV-1 that
we have
identified.
The stress of hyperthermia treatment induces in vivo reactivation in
mice (
48). We recently determined that both TIS7 and
IRF-1
are induced in murine TG by hyperthermia during the time
frame of
detection of viral gene activation (
55). These results
confirm our observations in the explantation model. Thus, it is
possible that HSV has evolved reactivation mechanisms which take
advantage of cellular activation pathways which are induced by
stress.
Further experiments are under way to test these hypotheses.
In summary, using DDRT-PCR as a starting point, we identified several
genes involved in the cellular response to the stress
of explantation.
Although we have not established a causal link,
the temporal
correspondence of HSV-1 reactivation and induction
of TIS7, IFN, and
IRF-1 gene expression suggests the existence
of common regulatory
pathways. Also, our results yield insights
into the cellular
environment which is present during HSV reactivation.
Therefore, PCR
differential display represents an excellent method
to screen for
species of RNA which are transcriptionally regulated
in TG following
explantation. Genes identified using this method
can be studied in
other HSV reactivation systems, resulting in
a database of specific
genes which may be involved in the reactivation
process.
 |
ACKNOWLEDGMENTS |
R.T.-S. and W.P. contributed equally to this work.
We thank S. Albelda (University of Pennsylvania) for providing PCR
primers specific for mouse
-actin and John Y. Chan (SmithKline Beecham Pharmaceuticals) for bioinformatics support.
This research was supported by Public Health grant NS33768 to N.W.F.
and S.L.B. and by funds from SmithKline Beecham Pharmaceuticals. R.T.-S. was supported in part by training grant CA09171 from the Public
Health Service. T.M.L. was supported by the division of neurosurgery,
Hospital of the University of Pennsylvania, and a clinical fellowship
from the Measey Foundation.
 |
FOOTNOTES |
*
Corresponding author. Mailing address for Jeffry J. Leary: Department of Molecular Virology & Host Defense, SmithKline
Beecham Pharmaceuticals, 1250 S. Collegeville Rd., P.O. Box 5089, Collegeville, PA 19426-0989. Phone: (610) 917-6558. Fax: (610)
917-4170. E-mail: leary{at}sbphrd.com. Mailing address for Shelley L. Berger: The Wistar Institute, 3601 Spruce St., Philadelphia, PA
19104-4268. Phone: (215) 898-3922. Fax: (215) 898-0663. E-mail:
berger{at}wista.wistar.upenn.edu.
 |
REFERENCES |
| 1.
|
Adams, R. L.,
D. R. Springall,
M. M. Levene, and T. E. Bushell.
1984.
The immunocytochemical detection of herpes simplex virus in cervical smears a valuable technique for routine use.
J. Pathol.
143:241-247[Medline].
|
| 2.
|
Altschul, S. F.,
W. Gisg,
W. Miller,
E. W. Meyers, and D. J. Lipman.
1990.
BLAST: a local alignment search tool.
J. Mol. Biol.
215:403-410[Medline].
|
| 3.
|
Arenalder, A. T.,
R. W. Lim,
B. C. Varnum,
R. Cole,
J. D. Vellis, and H. R. Herschman.
1989.
TIS gene expression in cultured rat astrocytes: induction by mitogens and stellation agents.
J. Neurosci. Res.
23:247-256[Medline].
|
| 4.
|
Arvidson, B.
1977.
Retrograde axonal transport of horseradish peroxidase from cornea to trigeminal ganglion.
Acta Neuropathol.
38:49-52[Medline].
|
| 5.
|
Barber, S. A.,
M. J. Fultz,
C. A. Salkowski, and S. N. Vogel.
1995.
Differential expression of interferon regulatory factor 1 (IRF-1), IRF-2, and interferon consensus sequence binding protein genes in lipopolysaccharide (LPS)-responsive and LPS-hyporesponsive macrophages.
Infect. Immun.
63:601-608[Abstract].
|
| 6.
|
Bergsma, D. J.,
C. Eder,
M. Gross,
H. Kersten,
D. Sylvester,
E. Appelbaum,
D. Cusiamano,
G. P. Levi,
M. M. McLaughlin,
K. Kasyan,
W. P. Prichett,
M. J. Bossard,
M. Brandt, and M. A. Levy.
1991.
The cyclophilin multigene family of peptidyl-prolyl isomerases: characterization of three separate human isoforms.
J. Biol. Chem.
266:23204-23214[Abstract/Free Full Text].
|
| 7.
|
Brown, S. M.,
D. A. Ritchie, and J. Subak-Sharpe.
1973.
Genetic studies with herpes simplex virus type 1. The isolation of temperature-sensitive mutants, their arrangement into complementation groups and recombination analysis leading to lineage groups.
J. Gen. Virol.
18:329-346[Abstract/Free Full Text].
|
| 8.
|
Chatterjee, S.,
E. Hunter, and R. Whitley.
1985.
Effect of cloned human interferons on protein synthesis and morphogenesis of herpes simplex virus.
J. Virol.
56:419-425[Abstract/Free Full Text].
|
| 9.
|
Cook, M. L.,
V. B. Bastone, and J. B. Stevens.
1974.
Evidence that neurons harbor latent herpes simplex virus.
Infect. Immun.
9:946-951[Abstract/Free Full Text].
|
| 10.
|
Dabrowski, C. E.,
P. J. Carmillo, and P. A. Schaffer.
1994.
Cellular protein interactions with herpes simplex virus type 1 oriS.
Mol. Cell. Biol.
14:2545-2555[Abstract/Free Full Text].
|
| 11.
|
Dabrowski, C. E., and P. A. Schaffer.
1991.
Herpes simplex virus type 1 origin-specific binding protein: oriS-binding properties and effects of cellular proteins.
J. Virol.
65:3140-3150[Abstract/Free Full Text].
|
| 12.
|
Devi-Rao, G. B.,
D. C. Bloom,
J. G. Stevens, and E. K. Wagner.
1994.
Herpes simplex virus type 1 DNA replication and gene expression during explant-induced reactivation of latently infected murine sensory ganglia.
J. Virol.
68:1271-1282[Abstract/Free Full Text].
|
| 13.
|
Fawl, R. L.,
R. M. Gesser,
T. Valyi-Nagi, and N. W. Fraser.
1996.
Reactivation of herpes simplex virus from latently infected mice after administration of cadmium is mouse-strain-dependent.
J. Gen. Virol.
77:2781-2786[Abstract/Free Full Text].
|
| 14.
|
Fawl, R. L., and B. Roizman.
1993.
Induction of reactivation of herpes simplex virus in murine sensory ganglia in vivo by cadmium.
J. Virol.
67:7025-7031[Abstract/Free Full Text].
|
| 15.
| Fraser, N. W., J. G. Spivack, Z. Wroblewska,
T. Block, S. L. Deshmane, T. Valyi-Nagy, R. Natarajan, and R. Gesser. 1991. A review of the molecular mechanism of HSV-1
latency. Curr. Eye Res. 10(Suppl.):1-14.
|
| 16.
|
Fraser, N. W., and T. Valyi-Nagy.
1993.
Viral, neuronal and immune factors which may influence herpes simplex virus (HSV) latency and reactivation.
Microb. Pathog.
15:83-91[Medline].
|
| 17.
|
Gobl, A. E.,
K. Funa, and G. V. Alm.
1988.
Different induction patterns of mRNA for IFN-alpha and -beta in human mononuclear leukocytes after in vitro stimulation with herpes simplex virus-infected fibroblasts and Sendai virus.
J. Immunol.
140:3605-3609[Abstract].
|
| 18.
|
Green, J. A.,
T. J. Yeh, and J. C. Overall, Jr.
1981.
Sequential production of IFN-alpha and immune-specific IFN-gamma by human mononuclear leukocytes exposed to herpes simplex virus.
J. Immunol.
127:1192-1196[Medline].
|
| 19.
|
Guardavaccaro, D.,
M. T. Ciotti,
B. W. Schafer,
A. Montagnoli, and F. Tirone.
1995.
Inhibition of differentiation in myoblasts deprived of the interferon-related protein PC4.
Cell Growth Differ.
6:159-169[Abstract].
|
| 20.
|
Habu, S.,
K. Akamatsu,
N. Tamaoki, and K. Okumura.
1984.
In vivo significance of NK cells on resistance against virus (HSV-1) infections in mice.
J. Immunol.
133:2743-2747[Abstract].
|
| 21.
|
Harwick, J.,
E. Romanowski,
T. Araullo-Cruz, and Y. J. Gordon.
1987.
Timolol promotes reactivation of latent HSV-1 in the mouse iontophoresis model.
Invest. Ophthalmol. Visual Sci.
28:580-584.
[Abstract/Free Full Text] |
| 22.
|
Herschman, H. R.
1991.
Primary response genes induced by growth factors and tumor promoters.
Annu. Rev. Biochem.
60:281-319[Medline].
|
| 23.
|
Herschman, H. R.,
D. A. Kujubu,
B. S. Fletcher,
Q. Ma,
B. C. Varnum,
R. S. Gilbert, and S. T. Reddy.
1994.
The tis genes, primary response genes induced by growth factors and tumor promoters in 3T3 cells.
Prog. Nucleic Acid Res. Mol. Biol.
47:113-148[Medline].
|
| 24.
|
Hill, T. J.
1985.
Herpes simplex virus latency, p. 175-240. In
B. Roizman (ed.), The Herpesviruses, vol. 4.
Plenum Publishing Corp., New York, N.Y.
|
| 25.
|
Honda, Y.,
A. Kawai, and S. Matsumoto.
1985.
Persistent infection of rabies virus (HEP-Flury strain) in human neuroblastoma cells capable of producing interferon.
J. Gen. Virol.
66:957-967[Abstract/Free Full Text].
|
| 26.
|
Inokuchi, K.,
A. Murayama, and F. Ozawa.
1996.
mRNA differential display reveals Krox-20 as a neural plasticity-regulated gene in the rat hippocampus.
Biochem. Biophys. Res. Commun.
221:430-436[Medline].
|
| 27.
|
Kawakami, T.,
M. Matsumoto,
M. Sato,
H. Harada,
T. Taniguchi, and M. Kitagawa.
1995.
Possible involvement of the transcription factor ISGF3 gamma in virus-induced expression of the IFN-beta gene.
FEBS Lett.
358:225-229[Medline].
|
| 28.
|
Kesari, S.,
B. P. Randazzo,
T. Valyi-Nagy,
Q. S. Huang,
S. M. Brown,
A. R. MacLean,
V. M.-Y. Lee,
J. Q. Trojanowski, and N. W. Fraser.
1995.
Therapy of experimental human brain tumors using a neuroattenuated herpes simplex virus mutant.
Lab. Invest.
73:636-648[Medline].
|
| 29.
|
Kimura, T.,
K. Nakayama,
J. Penninger,
M. Kitagawa,
H. Harada,
T. Matsuyama,
N. Tanaka,
R. Kamijo,
J. Vilcek,
T. W. Mak, and T. Taniguchi.
1994.
Involvement of the IRF-1 transcription factor in antiviral responses to interferons.
Science
264:1921-1924[Abstract/Free Full Text].
|
| 30.
|
Kiryu, S.,
G. L. Yao,
N. Morita,
H. Kato, and H. Kiyama.
1995.
Nerve injury enhances rat neuronal glutamate transporter expression: identification by differential display PCR.
J. Neurosci.
15:7872-7878[Abstract].
|
| 31.
|
Kita, M.,
K. Tanaka,
K. Shinmura,
Y. Tanaka,
Y. Liu, and J. Imanishi.
1994.
Expression des genes des cytokines et des genes associes a l'interferon chez l'embryon de la souris.
C. R. Soc. Biol.
188:593-600.
|
| 32.
|
Kujubu, D. A.,
R. W. Lim,
B. C. Varnum, and H. R. Herschman.
1987.
Induction of transiently expressed genes in PC-12 pheochromocytoma cells.
Oncogene
1:257-262[Medline].
|
| 33.
|
LaMarco, K., and S. McKnight.
1989.
Purification of a set of cellular polypeptides that bind to the purine-rich cis-regulatory element of herpes simplex virus immediate early genes.
Genes Dev.
3:1372-1383[Abstract/Free Full Text].
|
| 34.
|
Liang, P.,
D. Bauer,
L. Averboukh,
P. Warthoe,
M. Rohrwild,
H. Muller,
M. Strauss, and A. B. Pardee.
1995.
Analysis of altered gene expression by differential display.
Methods Enzymol.
254:304-321[Medline].
|
| 35.
|
Liang, P., and A. B. Pardee.
1992.
Differential Display of eukaryotic messenger RNA by means of the polymerase chain reaction.
Science
257:967-971[Abstract/Free Full Text].
|
| 36.
|
Lim, R. W.,
B. C. Varnum, and H. R. Herschman.
1987.
Cloning of tetradecanoyl phorbol ester-induced `primary response' sequences and their expression in density-arrested Swiss 3T3 cells and a TPA non-proliferative variant.
Oncogene
1:263-270[Medline].
|
| 37.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 38.
|
Marfurt, C. F.,
R. E. Kingsley, and S. E. Echtenkamp.
1989.
Sensory and sympathetic innervation of the mammalian cornea.
Investigative Ophthalmol. Visual Sci.
30:461-472[Abstract/Free Full Text].
|
| 39.
|
Nickolaus, P., and R. Zawatzky.
1994.
Inhibition by interleukin-4 of constitutive beta interferon synthesis in mouse macrophages.
J. Virol.
68:6763-6766[Abstract/Free Full Text].
|
| 40.
|
Nonkwelo, C.,
I. K. Ruf, and J. Sample.
1997.
Interferon-independent and -induced regulation of Epstein-Barr virus EBNA-1 gene transcription in Burkitt lymphoma.
J. Virol.
71:6887-6897[Abstract].
|
| 41.
|
Openshaw, H.,
S. Asher,
C. Wohlenberg,
T. Sekizawa, and A. L. Notkins.
1979.
Acute and latent infection in sensory ganglia with herpes simplex virus: immune control and virus reactivation.
J. Gen. Virol.
44:205-215[Abstract/Free Full Text].
|
| 42.
|
Qu, D.,
D. S. Ludwig,
S. Gammeltoft,
M. Piper,
M. A. Pelleymounter,
M. J. Cullen,
W. F. Mathes,
R. Przypek,
R. Kanarek, and E. Maratos-Flier.
1996.
A role for melanin-concentrating hormone in the central regulation of feeding behaviour.
Nature
380:243-247[Medline].
|
| 43.
|
Ramakrishnan, R.,
M. Levine, and D. J. Fink.
1994.
PCR-based analysis of herpes simplex virus type 1 latency in the rat trigeminal ganglion established with a ribonucleotide reductase-deficient mutant.
J. Virol.
68:7083-7091[Abstract/Free Full Text].
|
| 44.
|
Ramakrishnan, R.,
P. L. Poliani,
M. Levine,
J. C. Glorioso, and D. J. Fink.
1996.
Detection of herpes simplex virus type 1 latency-associated transcript expression in trigeminal ganglia by in situ reverse transcriptase PCR.
J. Virol.
70:6519-6523[Abstract].
|
| 45.
|
Randazzo, B. P.,
S. Kesari,
R. M. Gesser,
S. M. Brown, and N. W. Fraser.
1995.
Treatment of experimental intracranial murine melanoma with a neuro-attenuated herpes simplex virus-1 mutant.
Virology
211:94-101[Medline].
|
| 46.
|
Roizman, B.
1991.
Herpesviridae: a brief introduction, p. 841-847. In
B. N. Fields, and D. M. Knipe (ed.), Fundamental virology.
Raven Press, Ltd., New York, N.Y.
|
| 47.
|
Roizman, B., and A. E. Sears.
1987.
An inquiry into the mechanisms of herpes simplex virus latency.
Annu. Rev. Microbiol.
41:543-571[Medline].
|
| 48.
|
Sawtell, N. M., and R. L. Thompson.
1992.
Rapid in vivo reactivation of herpes simplex virus in latently infected murine ganglionic neurons after transient hyperthermia.
J. Virol.
66:2150-2156[Abstract/Free Full Text].
|
| 49.
|
Schaffer, B. C.,
E. Paulson,
J. L. Strominger, and S. H. Speck.
1997.
Constitutive activation of Epstein-Barr virus (EBV) nuclear antigen 1 gene transcription by IRF1 and IRF2 during restricted EBV latency.
Mol. Cell. Biol.
17:873-886[Abstract].
|
| 50.
|
Skup, D.,
J. D. Windass,
F. Sor,
H. George,
B. R. Williams,
H. Fukuhara,
J. D. Maeyer-Guignard, and E. D. Maeyer.
1982.
Molecular cloning of partial cDNA copies of two distinct mouse IFN-beta mRNAs.
Nucleic Acids Res.
10:3069-3084[Abstract/Free Full Text].
|
| 51.
|
Sompayrac, L.,
S. Jane, and K. J. Danna.
1996.
Reduced levels of alpha1(XI) procollagen mRNA in SV40-transformed cells.
Virology
218:412-416[Medline].
|
| 52.
|
Stanwick, T. L.,
D. E. Campbell, and A. J. Nahmias.
1982.
Cytotoxic properties of human monocyte-macrophages for human fibroblasts infected in herpes simplex virus: interferon production and augmentation.
Cell. Immunol.
70:132-147[Medline].
|
| 53.
|
Stevens, J. G.
1989.
Human herpesviruses: a consideration of the latent state.
Microbiol. Rev.
53:318-332[Free Full Text].
|
| 54.
|
Tal-Singer, R.,
T. M. Lasner,
W. Podrzucki,
A. Skokotas,
J. J. Leary,
S. L. Berger, and N. W. Fraser.
1997.
Gene expression during reactivation of herpes simplex virus type 1 from latency in the peripheral nervous system is different from that during lytic infection of tissue culture.
J. Virol.
71:5268-5276[Abstract].
|
| 55.
| Tal-Singer, R., D. Sutton, and J. Leary.
Unpublished data.
|
| 56.
|
Tanaka, N., and T. Taniguchi.
1992.
Cytokine gene regulation: regulatory cis-elements and DNA binding factors involved in the interferon system.
Adv. Immunol.
52:263-281[Medline].
|
| 57.
|
Taniguchi, T.,
H. Harada, and M. Lamphier.
1995.
Regulation of the interferon system and cell growth by the IRF transcription factors.
J. Cancer Res. Clin. Oncol.
121:516-520[Medline].
|
| 58.
|
Tirone, F., and E. Shooter.
1989.
Early gene regulation by nerve growth factor in PC12 cells: induction of an interferon-related gene.
Proc. Natl. Acad. Sci. USA
86:2088-2092[Abstract/Free Full Text].
|
| 59.
|
Trojanowski, J.,
R. Mantione,
J. Lee,
D. Seid,
T. You,
L. Inge, and V. Lee.
1993.
Neurons derived from a human teratocarcinoma cell line establishes molecular and structural polarity following transplantation into the rodent brain.
Exp. Neurol.
122:283-294[Medline].
|
| 60.
|
Valyi-Nagy, T.,
S. L. Deshmane,
A. J. Dillner, and N. W. Fraser.
1991.
Induction of cellular transcription factors in trigeminal ganglia of mice by corneal scarification, herpes simplex virus 1 type infection, and explantation of trigeminal ganglia.
J. Virol.
65:4142-4152[Abstract/Free Full Text].
|
| 61.
|
Varnum, B. C.,
R. W. Lim, and H. R. Herschman.
1989.
Characterization of TIS7, a gene induced in Swiss 3T3 cells by the tumor promoter tetradecanoyl phorbol acetate.
Oncogene
4:1263-1265[Medline].
|
| 62.
|
Varnum, B. C.,
S. T. Reddy,
R. A. Koski, and H. R. Herschman.
1994.
Synthesis, degradation, and subcellular localization of proteins encoded by the primary response genes TIS7/PC4 and TIS21/PC3.
J. Cell. Physiol.
158:205-213[Medline].
|
| 63.
|
Walev, I.,
J. Podlech, and D. Falke.
1995.
Enhancement by TNF- of reactivation and replication of latent herpes simplex virus from trigeminal ganglia.
Arch. Virol.
140:987-992[Medline].
|
| 64.
|
Walz, M. A.,
H. Yamamoto, and A. L. Notkins.
1976.
Immunological response restricts number of cells in sensory ganglia infected with herpes simplex virus.
Nature
264:554-559[Medline].
|
| 65.
|
Warthoe, P.
1995.
Detection and identification of expressed genes by differential display, p. 421-438. In
C. W. Dieffenbach, and G. S. Dveksler (ed.), PCR primers: a laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 66.
|
Watanabe, N.,
J. Sakakibara,
A. G. Hovanessian,
T. Taniguchi, and T. Fujita.
1991.
Activation of IFN-beta element by IRF-1 requires a posttranslational event in addition to IRF-1 synthesis.
Nucleic Acids Res.
19:4421-4428[Abstract/Free Full Text].
|
| 67.
|
Willey, D. E.,
M. D. Trousdale, and A. B. Nesburn.
1984.
Reactivation of murine latent HSV infection by epinephrine iontophoresis.
Invest. Ophthalmol. Visual Sci.
25:945-950.
[Abstract/Free Full Text] |
| 68.
|
Yan, J.,
K. K. Khanna, and M. F. Lavin.
1996.
Induction of inositol 1,4,5 triphosphate receptor genes by ionizing radiation.
Int. J. Radiat. Biol.
69:539-540[Medline].
|
J Virol, February 1998, p. 1252-1261, Vol. 72, No. 2
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Li, J.-F., Liu, L.-D., Ma, S.-H., Che, Y.-C., Wang, L.-C., Dong, C.-H., Zhao, H.-L., Liao, Y., Li, Q.-H.
(2004). HTRP--An Immediate-Early Gene Product Induced by HSV1 Infection in Human Embryo Fibroblasts, Is Involved in Cellular Co-Repressors. J Biochem
136: 169-176
[Abstract]
[Full Text]
-
Higaki, S., Gebhardt, B. M., Lukiw, W. J., Thompson, H. W., Hill, J. M.
(2002). Effect of Immunosuppression on Gene Expression in the HSV-1 Latently Infected Mouse Trigeminal Ganglion. IOVS
43: 1862-1869
[Abstract]
[Full Text]
-
Tsavachidou, D., Podrzucki, W., Seykora, J., Berger, S. L.
(2001). Gene Array Analysis Reveals Changes in Peripheral Nervous System Gene Expression following Stimuli That Result in Reactivation of Latent Herpes Simplex Virus Type 1: Induction of Transcription Factor Bcl-3. J. Virol.
75: 9909-9917
[Abstract]
[Full Text]
-
Cohrs, R. J., Randall, J., Smith, J., Gilden, D. H., Dabrowski, C., van der Keyl, H., Tal-Singer, R.
(2000). Analysis of Individual Human Trigeminal Ganglia for Latent Herpes Simplex Virus Type 1 and Varicella-Zoster Virus Nucleic Acids Using Real-Time PCR. J. Virol.
74: 11464-11471
[Abstract]
[Full Text]
-
Boudinot, P., Riffault, S., Salhi, S., Carrat, C., Sedlik, C., Mahmoudi, N., Charley, B., Benmansour, A.
(2000). Vesicular stomatitis virus and pseudorabies virus induce a vig1/cig5 homologue in mouse dendritic cells via different pathways. J. Gen. Virol.
81: 2675-2682
[Abstract]
[Full Text]
-
Xu, B., Lin, L., Rote, N. S.
(1999). Identification of a Stress-Induced Protein During Human Trophoblast Differentiation by Differential Display Analysis. Biol. Reprod.
61: 681-686
[Abstract]
[Full Text]
-
Feigenblum, D., Walker, R., Schneider, R. J.
(1998). Adenovirus Induction of an Interferon-Regulatory Factor during Entry into the Late Phase of Infection. J. Virol.
72: 9257-9266
[Abstract]
[Full Text]