This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rager, K. J.
Right arrow Articles by Imani, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rager, K. J.
Right arrow Articles by Imani, F.

 Previous Article  |  Next Article 

J Virol, February 1998, p. 1171-1176, Vol. 72, No. 2
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Activation of Antiviral Protein Kinase Leads to Immunoglobulin E Class Switching in Human B Cells

Kelly J. Rager,1 Jeffrey O. Langland,2 Bertram L. Jacobs,2 David Proud,1 David G. Marsh,1 and Farhad Imani1,*

Asthma and Allergy Center, Division of Clinical Immunology, Department of Medicine, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21224,1 and Department of Microbiology, Arizona State University, Tempe, Arizona 852872

Received 25 July 1997/Accepted 20 October 1997

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

An epidemiologic association between viral infections and the onset of asthma and allergy has been documented. Also, evidence from animal and human studies has suggested an increase in antigen-specific immunoglobulin E (IgE) production during viral infections, and elevated levels of IgE are characteristic of human asthma and allergy. Here, we provide molecular evidence for the roles of viral infection and of activation of the antiviral protein kinase (PKR) (double-stranded-RNA [dsRNA]-activated protein kinase) in the induction of IgE class switching. The presence of dsRNA, a known component of viral infection and an activator of PKR, induced IgE class switching as detected by the expression of germ line varepsilon  in the human Ramos B-cell line. Furthermore, dsRNA treatment of Ramos cells resulted in the activation of PKR and in vivo activation of the NF-kappa B complex. Interestingly, infection of Ramos cells with rhinovirus (common cold virus) serotypes 14 and 16 resulted in the induction of germ line varepsilon  expression. To further evaluate the role of PKR in the viral induction of IgE class switching, we infected Ramos cells with two different vaccinia virus (cowpox virus) strains. Infection with wild-type vaccinia virus failed to induce germ line varepsilon  expression; however, a deletion mutant of vaccinia virus (VP1080) lacking the PKR-inhibitory polypeptide E3L induced the expression of germ line varepsilon . Collectively, the results of our study define a common molecular mechanism underlying the role of viral infections in IgE class switching and subsequent induction of IgE-mediated disorders such as allergy and asthma.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Asthma and allergy are common diseases associated with elevated levels of immunoglobulin E (IgE) antibodies (3, 13, 23). Mature B cells express IgM and IgD on the cell surface, and as they differentiate, B cells can secrete various immunoglobulin isotypes. Although the class switching to various isotypes is under the control of different cytokines (reviewed in reference 38), accumulated data suggest that viral infections can also stimulate IgE production and subsequently modulate the onset of asthma and allergy. A study examining childhood upper respiratory tract infections revealed that they are associated with increased allergic sensitization. The study concluded that 11 of 13 children who had evidence of allergic sensitization also had upper respiratory tract viral infections 1 to 2 months prior to serological tests (7). Furthermore, in studies measuring levels of antipollen IgE, data showed that vaccination of dogs with parainfluenza virus or canine distemper-hepatitis virus resulted in an increase in the production of antipollen IgE, compared to IgE levels in nonvaccinated littermates (6). In addition, infections with influenza virus, measles virus, and respiratory syncytial virus have been associated with the production of higher levels of antigen-specific IgE (10, 20, 21).

Upon viral infection, cellular machinery is mobilized to inhibit viral replication. One mechanism of inhibition of viral replication is the induction of double-stranded-RNA (dsRNA)-activated antiviral protein kinase (PKR). This 68-kDa serine/threonine kinase is induced in an inactive form by interferon (IFN) treatment and viral infections (29, 41). The activation of this kinase is dependent on the presence of dsRNA with a minimum length of approximately 30 to 100 bp (28). This dsRNA is not detectable during the normal life cycle of eukaryotic cells; however, it is present during the life cycle of many viral strains. After activation (detected by autophosphorylation), PKR can phosphorylate, and thus inactivate, the alpha  subunit of the eukaryotic initiation factor 2 (eIF-2alpha ) (19). The inactivation of eIF-2alpha results in the shutdown of translation in the cellular compartment in which the viral infection is occurring (17). Data from in vitro studies have shown that dsRNA-activated PKR can also inactivate the inhibitor of NF-kappa B, Ikappa B, by phosphorylation (18). The inactivation of Ikappa B leads to its dissociation and to activation of the NF-kappa B complex, which can then translocate to the nucleus and bind to specific response elements (11, 22, 30, 36, 39). Targeted-disruption studies of mice have shown that deletion of the gene encoding the p50 subunit of the NF-kappa B complex resulted in a 40-fold reduction in the level of serum IgE, suggesting a critical role for NF-kappa B in IgE class switching (37). In addition, the promoter region of the IgE constant-region gene (encoding germ line varepsilon ) contains a p50 (kappa B-1) homodimer-binding site, which also suggests a role for NF-kappa B in IgE class switching (5).

In this report we provide evidence for the role of PKR in the induction of IgE class switching in human B cells. Our data provide a molecular mechanism for the reported association of viral infections and the induction of allergy and asthma.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Cell line, culture conditions, and reagents. The human Burkitt's lymphoma B cell line Ramos 2G6.4C10 was purchased from the American Type Culture Collection (Rockville, Md.). Cells (105 to 106/ml) were grown in RPMI 1640 supplemented with 10% fetal calf serum, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, and gentamicin sulfate at 5 µg/ml at 37°C in a 5% CO2 humidified chamber. The synthetic dsRNA poly(I)·poly(C) (Sigma, St. Louis, Mo.) was used, and all reagents were of the highest quality available.

IFN treatment and in vitro kinase reactions. Ramos cells were treated with 100 U of human IFN-alpha , IFN-beta (Lee Biomolecular, San Diego, Calif.), IFN-gamma , or human interleukin-4 (IL-4) (Sigma) per ml. After 24 h, cells were washed twice with isotonic buffer containing 20 mM HEPES (pH 7.5), 120 mM KCl, 5 mM magnesium acetate [Mg(OAc)2], and 1 mM dithiothreitol (DTT). Cells were then lysed in buffer containing 20 mM HEPES, 120 mM KCl, 5 mM Mg(OAc)2, 1 mM benzamidine, 1 mM DTT, and 1% Nonidet P-40.

Reactions were performed as described previously (12); briefly, mixtures for in vitro phosphorylation of cellular extracts contained 20 mM HEPES (pH 7.5), 90 mM KCl, 5 mM Mg(OAc)2, 1 mM DTT, 100 µM [gamma -32P]ATP (specific activity, 1 Ci/mM; Amersham), 100 µM ATP (Sigma), and equal amounts of detergent extract prepared from 106 cells in a final volume of 25 µl. dsRNA was added to the reaction mixtures at the concentrations indicated in the figure legends; this was followed by incubation at 30°C. After 10 min, the reactions were quenched by adding sodium dodecyl sulfate (SDS) sample buffer containing 2.5% beta -mercaptoethanol (final concentration) and boiling for 2 min. The reduced, denatured proteins were then subjected to SDS-10% polyacrylamide gel electrophoresis (PAGE) and visualized by autoradiography.

EMSA. Cell extracts for electrophoretic mobility shift assays (EMSAs) were prepared according to the method of Schreiber et al. (35). EMSAs were performed with gamma -32P-end-labeled NF-kappa B (from the kappa light chain) consensus oligonucleotide (Promega, Madison, Wis.). The reaction mixtures (20 µl) consisted of 2 µl of nuclear extract in buffer containing 20 mM HEPES (pH 7.5), 50 mM KCl, 0.2 mM EDTA, 10% glycerol, 40 µg of poly(dI-dC)·poly(dI-dC) per ml, 0.05% Nonidet P-40, and 0.5 µl of labeled probe. After 15 min at 37°C, the protein-DNA complexes were resolved on 4.5% nondenaturing polyacrylamide gels and visualized by autoradiography of the dried gels.

RNA extraction and detection of germ line varepsilon . RNA was isolated with a TRIzol total RNA isolation system (Bethesda Research Laboratories [BRL], Gaithersburg, Md.). After reverse transcription, the cDNA was amplified in the presence of 2 µg of primers per ml, 100 µM deoxynucleoside triphosphates, 0.25 U of Taq polymerase (Perkin-Elmer), 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 1.5 mM MgCl2, and 0.001% gelatin in a final volume of 25 µl. Primers for the constant-region varepsilon  exon-derived sequence (5' AGAGGTCGGGCATTGGAGGGAATGT 3') and the germ line varepsilon  exon-derived sequence (5' AGGCTCCACTGCCCGGCACAGAAAT 3'), as described by Gauchat et al. (8), and the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) forward primer (5' CACAGTCCATGCCATCACTG 3') and reverse primer (5' TACTCCTTGGAGGCCATGTG 3') were used in PCRs. PCR was performed in a DNA thermal cycler (Perkin-Elmer) for 42 (vaccinia virus infections) or 25 (rhinovirus infections) cycles for germ line varepsilon  and 25 cycles for GAPDH. For restriction endonuclease mapping, the 210-bp PCR product corresponding to germ line varepsilon  cDNA was purified with the QIAquick gel extraction kit (Qiagen, Chatsworth, Calif.). The purified fragment was digested with BglI enzyme (BRL) for 2 h at 37°C, and the products were resolved on a 2% agarose gel. A 100-bp ladder (BRL) was used to provide molecular weight markers. For rhinovirus-infected cells, after 25 cycles of PCR, the amplified products were visualized by Southern blot hybridization with an internal primer specific to germ line varepsilon  (5' AGCTGTCCAGGAACCCGACAGGGAG 3') end labeled with gamma -32P to detect any differences in the induction of germ line varepsilon  transcript by the two viral strains.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Treatment of human B cells with dsRNA results in the induction of IgE class switching. Since dsRNA treatment can mimic the effects of viral infections in the activation of PKR, we first examined the effects of dsRNA on IgE class switching. It has been shown that the first step in IgE class switching is the expression of an immature IgE transcript (germ line varepsilon ) (34). Therefore, to determine whether IgE class switching had occurred, we performed reverse transcription (RT)-PCR for the expression of germ line varepsilon  transcript. Ramos cells were either left untreated or treated with various concentrations of dsRNA. After 72 h, total cellular RNA was extracted and equal amounts were subjected to RT-PCR with primers specific to germ line varepsilon . Data revealed that treatment of Ramos cells with dsRNA resulted in concentration-dependent expression of germ line varepsilon transcript (Fig. 1A). The resulting 210-bp unique PCR product was purified and subjected to restriction enzyme mapping with BglI. The resulting fragments were 95 and 115 bp in length, corresponding to the expected sizes for the BglI digest of germ line varepsilon  cDNA sequence (8) (data not shown).


View larger version (50K):
[in this window]
[in a new window]
  		FIG. 1.   dsRNA treatment of Ramos cells induces the expression of germ line varepsilon  transcript. Ramos cells were either left untreated or treated with various concentrations of dsRNA (A), 100 U of recombinant human IFN-alpha , IFN-beta , or IFN-gamma per ml, or 5 ng of recombinant human IL-4 per ml (B). After 72 h of dsRNA treatment, total cellular RNA was extracted and equal amounts were subjected to RT-PCR (42 cycles) with primers specific to germ line varepsilon  and GAPDH (n = 3). The products were separated on a 2% agarose gel, and a 100-bp DNA ladder (BRL) was used as the molecular weight marker (MW). (C) Ramos cells were treated with 100 U of recombinant human IFN-alpha , IFN-beta , or IFN-gamma . After 24 h of incubation, detergent cell extracts were prepared, and equal amounts of cell extracts were subjected to in vitro kinase reactions with 1 µg of dsRNA per ml. The phosphorylated proteins were separated and visualized as described above (n = 1).

It is known that dsRNA treatment of eukaryotic cells results in the elaboration of IFNs (26). To test whether dsRNA-induced IgE class switching may be due to the autocrine effects of IFNs on Ramos cells, we treated the cells with 100 U of recombinant human IFN-alpha , IFN-beta , or IFN-gamma per ml. After RNA extraction and RT-PCR with germ line varepsilon -specific primers, the data revealed that IFN treatment alone did not induce class switching in Ramos cells (Fig. 1B). However, RT-PCR on the RNA extracted from cells treated with IL-4, a cytokine known to be a potent inducer of IgE class switching, amplified the 210-bp product corresponding to germ line varepsilon .

To determine whether IFN treatment was effective in the induction of PKR expression, detergent cell extracts from the mock-treated or IFN-treated cells were prepared. The results of in vitro kinase reactions, performed in the presence or absence of dsRNA, showed that both IFN-alpha and IFN-beta could increase the expression of PKR in an inactive state; PKR was activated only in the presence of dsRNA. Therefore, the induction of PKR without activation is not sufficient to induce class switching (Fig. 1C). Treatment of Ramos cells with IFN-gamma , however, did not result in such an increase (Fig. 1C).

In vivo activation of NF-kappa B by dsRNA treatment. dsRNA, as well as viral infections, is known to activate NF-kappa B (18, 22, 39) through the activation of PKR and the subsequent phosphorylation and inactivation of Ikappa B (18). Also, the involvement of NF-kappa B in IgE class switching has been shown by knockout studies as well as by constant-region varepsilon  promoter studies (22, 30). To examine the effects of dsRNA treatment on NF-kappa B activation in Ramos cells, we performed EMSAs. Ramos cells were treated with 10 µg of dsRNA per ml, and whole-cell extracts were prepared at various times posttreatment. Data from EMSAs showed that expression of the NF-kappa B complex was induced upon dsRNA treatment (Fig. 2A). The maximal level of NF-kappa B activation was observed at 4 h posttreatment.


View larger version (44K):
[in this window]
[in a new window]
  		FIG. 2.   NF-kappa B is activated in vivo by dsRNA treatment. (A) Since PKR is present in Ramos cells and could be activated by dsRNA, we tested whether dsRNA could activate the NF-kappa B complex present in Ramos cells. Ramos cells were either mock treated (lane A) or treated with 10 µg of dsRNA per ml for 15 min (lane B), 30 min (lane C), 1 h (lane D), 2 h (lane E), 4 h (lane F), or 24 h (lane G). Total cell extracts were prepared, and equal amounts were subjected to EMSA with an NF-kappa B-specific consensus oligonucleotide probe (Promega). The DNA-protein complexes were resolved on a 4.5% nondenaturing PAGE gel and were visualized by autoradiography of the dried gels. N.S., nonspecific complex (n = 2). (B) To identify the NF-kappa B subunits that participate in dsRNA-induced complexes and the specificities of the complexes, we performed EMSAs and supershifts with the indicated Abs. As indicated, the specific complex was competable with cold NF-kappa B consensus element; however, oligomers specific to the transcription factor AP-1 did not affect the complex. Supershifts were performed with control normal rabbit IgG or Abs to p65 (RelA), p50 (kappa B-1), and Ikappa B subunits (Santa Cruz Biotechnology Inc., Santa Cruz, Calif.) at final concentrations of 50 µg/ml (n = 4).

Next, to determine the NF-kappa B subunits that are involved in the dsRNA-induced complex, we performed supershift assays with monoclonal antibodies (Abs) to several known subunits of the NF-kappa B complex. Ab-mediated supershifts revealed that expression of both the p50 (kappa B-1) and the p65 (RelA) subunits was induced upon dsRNA treatment (Fig. 2B); however, there was no supershift with Ab to c-Rel (data not shown). Also, the addition of combined anti-p50 and anti-p65 induced the retardation of p65-containing-complex formation without any further change in the retardation of p50-containing-complex formation, suggesting the presence of homodimers of p50 as well as heterodimers of p50 and p65 in the dsRNA-treated Ramos cells (data not shown).

Viral infection of human B cells can induce IgE class switching. Although activation of PKR and induction of the antiviral state can block viral replication, viruses can escape this putative host defense mechanism. An inhibitor of PKR is present in cells infected with several viruses, such as reovirus, influenza virus, adenovirus, vaccinia virus, and the human immunodeficiency virus (HIV) (2, 12, 15, 26, 40). The vaccinia virus-associated protein kinase-inhibitory activity is due to the presence of E3L protein, which interacts in a stoichiometric manner with dsRNA, thus sequestering the dsRNA from PKR (4). Deletion of E3L results in a mutant virus (VP1080) that upon infection in HeLa cells can activate PKR (1). To examine the role of PKR activation in virus-induced IgE class switching, we infected Ramos cells with the wild-type as well as the E3L deletion strain of vaccinia virus at a multiplicity of infection of 5. After 48 h, total cellular RNA was extracted and subjected to RT-PCR. The results revealed that in contrast to the wild-type vaccinia virus, which did not induce the expression of germ line varepsilon , the E3L deletion mutant induced the expression of this transcript (Fig. 3A). This result suggests that in vivo modulation of PKR activation by viral infections can regulate IgE class switching.


View larger version (37K):
[in this window]
[in a new window]
  		FIG. 3.   Viral infections of Ramos cells induce germ line varepsilon  expression. (A) To determine the role of viral activation of PKR in the expression of IgE germ line transcript, we infected Ramos cells with vaccinia virus (n = 3). The wild-type vaccinia virus (Copenhagen strain) is known to inhibit the activation of PKR by the virally encoded polypeptide E3L. Ramos cells were either mock infected or infected with the wild-type vaccinia virus or the E3L-deleted mutant at a multiplicity of infection of 5 PFU/cell. After 48 h, cells were harvested and total RNA was prepared. Equal amounts of RNA were subjected to RT-PCR (42 cycles) with germ line varepsilon -specific primers and GAPDH. The amplified products were separated by 2% agarose gel electrophoresis. (B) To determine the phosphorylation state of PKR after vaccinia virus infections, Ramos cells were infected as described for panel A. After 24 h, detergent cell extracts were prepared and equal amounts were subjected to in vitro kinase reactions in the absence or presence of 1 µg of dsRNA per ml (n = 2). The proteins were resolved on an SDS-10% PAGE gel and visualized by autoradiography of the dried gel. Mw, molecular weight. (C) Ramos cells were infected with equal amounts of rhinovirus serotypes 14 and 16 (tissue culture infective dose of 1). After 48 h, total cellular RNA was prepared and equal amounts were subjected to reverse transcription and only 25 cycles of PCR. The PCR products were resolved on a 2% agarose gel and then transferred to a nylon membrane (Millipore, Bedford, Mass.). The PCR products were probed with a gamma -32P-labeled oligonucleotide specific to the internal sequence of germ line varepsilon . After hybridization, the products were visualized by autoradiography. The efficiencies of infection were assessed by RT-PCR with primers specific for rhinovirus RNA (data not shown).

Previous reports have shown that infection with E3L-deleted vaccinia virus resulted in activation of PKR in fibroblasts (1, 4); therefore, we tested whether vaccinia virus infection could result in the activation of PKR in Ramos cells. Extracts prepared from mock-infected cells and cells infected with wild-type vaccinia virus and E3L-deleted vaccinia virus were subjected to in vitro kinase reactions. The data revealed that autophosphorylation of PKR took place without any addition of exogenous dsRNA in extracts prepared from the E3L deletion mutant (Fig. 3B).

To investigate whether infections with a respiratory virus could also result in IgE class switching, Ramos cells were infected with equal infectious doses of rhinovirus serotypes 14 and 16. After infection, the expression of germ line varepsilon  was tested by RT-PCR followed by Southern blot hybridization with a primer specific to the internal sequence of germ line varepsilon  transcript. Although infections with both rhinovirus serotype 14 and rhinovirus serotype 16 resulted in IgE class switching, infection with rhinovirus serotype 16 led to a lower level of germ line varepsilon  expression (Fig. 3C). Thus far, we do not know the molecular mechanism responsible for this difference, but it is conceivable that these strains differ in their ability to activate PKR.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

In this report, we provide evidence to suggest a role for PKR in the modulation of IgE class switching. Treatment of the human B-cell line Ramos with dsRNA, a specific activator of PKR, was sufficient to induce IgE class switching, as is evident from the expression of germ line varepsilon  transcript. The role of dsRNA activation of PKR in IgE class switching is further supported by the inability of IFN-alpha and IFN-beta to induce germ line varepsilon  expression, suggesting that induction of PKR expression in the absence of dsRNA-induced activation is not sufficient for class switching. Treatment of B cells with IL-4, a potent inducer of IgE class switching (Fig. 1B), did not result in the induction or activation of PKR (data not shown). Taken together, the data suggest that the common signaling pathway leading to germ line varepsilon  expression may be located downstream of PKR activation, perhaps through activation of the NF-kappa B complex.

In addition, our data from EMSAs revealed that NF-kappa B could be activated in vivo by dsRNA treatment, suggesting that PKR acts as a specific in vivo activator of the NF-kappa B complex. Antibody-mediated supershifts showed that homodimers of kappa B-1 (p50) and heterodimers of kappa B-1 (p50) and RelA (p65) were induced upon dsRNA treatment. It is important to note that the dsRNA-induced germ line varepsilon  expression and NF-kappa B activation have been also detected in another Burkitt's lymphoma B-cell line, CA46 (data not shown).

The kappa B-1 (p50) homodimer has been reported to play a role in IgE class switching by interacting with the IgE germ line (germ line varepsilon ) promoter and thereby inducing germ line varepsilon  transcription. Genetic knockout studies of mice also showed that inactivation of kappa B-1 (p50) was sufficient to cause a 40-fold decrease in the serum IgE levels (37). A report by Lin et al. has provided evidence to suggest that multiple homo- and heterodimers of the NF-kappa B complex may differentially activate specific genes (24).

Viral infections are also known to activate NF-kappa B, and this activation is thought to be mediated by dsRNA-activated PKR and subsequent phosphorylation of Ikappa B (18, 22, 29, 39). The antiviral role of PKR is well documented. The dsRNA structures that are present during the life cycles of many viral strains activate the PKR pathway, which leads to phosphorylation of eIF-2alpha (19, 28). The phosphorylation of eIF-2alpha results in the inactivation of this essential translational factor, so that translation is shut down in the cellular compartments where viral infection is occurring (19). To efficiently replicate, many viruses, such as HIV, influenza virus, reovirus, adenovirus, and vaccinia virus, have developed strategies to overcome the cellular antiviral pathways. Since PKR requires interaction with dsRNA to be activated, a common viral strategy to block this activation is to encode polypeptides that interact with dsRNA. This effectively blocks the recognition of dsRNA by PKR so that viral protein synthesis continues unabated. Reovirus-encoded sigma 3, vaccinia virus-encoded E3L, influenza virus-encoded NS1, and HIV-encoded TAT polypeptides are such inhibitors (2, 12, 15, 26, 40).

Our data from viral infection of Ramos cells revealed that, in contrast to the wild-type vaccinia virus, which did not induce IgE class switching, an E3L deletion mutant induced germ line varepsilon  expression. Since the only known function of the E3L polypeptide is to inhibit the dsRNA-induced activation of PKR, these data suggest a regulatory role for the in vivo activation of PKR in IgE class switching. Our results from rhinovirus infections showed that serotypes 14 and 16 were both able to induce expression of germ line varepsilon . Cells infected with members of the Picornaviridae, including rhinovirus, are known to contain dsRNA, and PKR has been shown to be activated in cells infected with members of this family (9, 16, 31, 32).

Our data are consistent with previous findings showing that experimental viral infections of animals induced increased synthesis of antigen-specific IgE. It is noteworthy that during HIV infection, the level of total IgE antibodies also increased, suggesting Th2-type responses during HIV infection (25). Since the transactivation-responsive element (TAR) is a known activator of PKR (27), it is tempting to speculate that TAR-induced activation of PKR may lead to the observed increase in IgE. Our data suggest a molecular mechanism for the epidemiologic association of childhood viral infections with IgE-mediated disorders.

At present we do not know the exact molecular pathways that are involved in the PKR-mediated signaling leading to IgE class switching. Based on our data, we favor the possibility that direct intracellular modulation of PKR and NF-kappa B activity by dsRNA and viral infections leads to IgE class switching. Alternatively, it is conceivable that viral infections or the presence of dsRNA could induce the B cells to secrete IL-4 through PKR and NF-kappa B activation, which in turn can induce IgE class switching. This possibility is currently under investigation.

During viral infections, it is also possible that the presence of dsRNA in the microenvironment of T-cell-B-cell interaction may provide a signal, by PKR and NF-kappa B activation, in the T cells to secrete IL-4. Therefore, this mechanism may also participate in Th2-type responses leading to Th2-mediated immune responsiveness. Since other transcription factors such as STAT-6 and C/EBP are necessary for IgE class switching (14, 33), we are in the process of determining whether these factors are activated by dsRNA treatment and viral infections in human B cells. Experiments are also under way to examine the roles of viral infection and PKR activation in Th1-Th2 differentiation in T cells.

    ACKNOWLEDGMENTS

We gratefully acknowledge Steven Kelsen (Temple University) and Barney Graham (Vanderbilt University) for critical review of the manuscript and Stephen Desiderio and Vincenzo Casolaro (Johns Hopkins University) for helpful suggestions.

This work was supported by a grant from the American Lung Association and by divisional support to F.I.

    FOOTNOTES

* Corresponding author. Mailing address: Division of Clinical Immunology, Department of Medicine, The Johns Hopkins University School of Medicine, Asthma and Allergy Center, 5501 Hopkins Bayview Circle, Baltimore, MD 21224-6821. Phone: (410) 550-2153. Fax: (410) 550-2090. E-mail: fimani{at}welchlink.welch.jhu.edu.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Beattie, E., K. L. Denzler, J. Tartaglia, M. E. Perkus, E. Paoletti, and B. L. Jacobs. 1995. Reversal of the interferon-sensitive phenotype of a vaccinia virus lacking E3L by expression of the reovirus S4 gene. J. Virol. 69:499-505[Abstract].
2. Brand, S. R., R. Kobayashi, and M. B. Mathews. 1997. The Tat protein of human immunodeficiency virus type 1 is a substrate and an inhibitor of the interferon-induced, virally activated protein kinase, PKR. J. Biol. Chem. 272:8388-8395[Abstract/Free Full Text].
3. Burrows, B., M. R. Sears, E. M. Flannery, G. P. Herbison, and M. D. Holdaway. 1992. Relationships of bronchial responsiveness assessed by methacholine to serum IgE, lung function, symptoms, and diagnoses in 11-year-old New Zealand children. J. Allergy Clin. Immunol. 90:376-385[Medline].
4. Chang, H.-W., J. C. Watson, and B. L. Jacobs. 1992. The E3L gene of vaccinia virus encodes an inhibitor of the interferon-induced, double-stranded RNA-dependent protein kinase. Proc. Natl. Acad. Sci. USA 89:4825-4829[Abstract/Free Full Text].
5. Delphin, S., and J. Stavnezer. 1995. Characterization of an interleukin 4 (IL-4) responsive region in the immunoglobulin heavy chain germline varepsilon  promotor: regulation by NF-IL4, a C/EBP family member and NF-kappa B/p50. J. Exp. Med. 181:181-192[Abstract/Free Full Text].
6. Frick, O. L., and D. L. Brooks. 1984. Immunoglobulin E antibodies to pollens augmented in dogs by virus vaccines. Am. J. Vet. Res. 44:440-445.
7. Frick, O. L., D. F. German, and J. Mills. 1979. Development of allergy in children: association with virus infections. J. Allergy Clin. Immunol. 63:228-241[Medline].
8. Gauchat, J.-F., D. A. Lebman, R. L. Coffman, H. Gascan, and J. E. de Vries. 1990. Structure and expression of germline epsilon transcripts in human B cells induced by interleukin-4 to switch to IgE production. J. Exp. Med. 172:463[Abstract/Free Full Text].
9. Gribaudo, G., D. Lembo, G. Cavallo, S. Landolfo, and P. Lengyel. 1991. Interferon action: binding of viral RNA to the 40-kilodalton 2'-5'-oligoadenylate synthetase in interferon-treated HeLa cells infected with encephalomyocarditis virus. J. Virol. 65:1748-1757[Abstract/Free Full Text].
10. Griffin, D. E., S. J. Cooper, R. L. Hirsch, R. T. Johnson, I. L. de Seriano, S. Roedenbeck, and A. Vaisberg. 1985. Changes in plasma IgE levels during complicated and uncomplicated measles virus infection. J. Allergy Clin. Immunol. 76:206-213[Medline].
11. Grilli, M., J. J.-S. Chiu, and M. J. Lenardo. 1993. NF-kappa B and Rel: participants in a multiform transcriptional regulatory system. Int. Rev. Cytol. 143:1-62[Medline].
12. Imani, F., and B. L. Jacobs. 1988. Inhibitory activity for the interferon-induced protein kinase is associated with the reovirus serotype 1 sigma 3 protein. Proc. Natl. Acad. Sci. USA 85:7887-7891[Abstract/Free Full Text].
13. Ishizaka, T., H. Tomioka, and K. Ishizaka. 1971. Degranulation of human basophil leukocytes by anti-gamma E antibody. J. Immunol. 106:705-710[Abstract/Free Full Text].
14. Kaplan, M. H., U. Schindler, S. T. Smiley, and M. J. Grusby. 1996. Stat-6 is required for mediating responses to IL-4 and for development of Th2 cells. Immunity 4:313-319[Medline].
15. Katze, M. G., D. DeCorato, B. Safer, and A. G. Hovanessian. 1987. Adenovirus VAI RNA complexes with the 68,000 Mr protein kinase to regulate its autophosphorylation and activity. EMBO J. 6:689-697[Medline].
16. Koliais, S. I. 1981. Presence of double-stranded regions of viral RNA in infected cells. Experientia 37:971-972[Medline].
17. Konieczny, A., and B. Safer. 1983. Purification of the eukaryotic initiation factor 2-eukaryotic initiation factor 2B complex and characterization of its guanine nucleotide exchange activity during protein synthesis initiation. J. Biol. Chem. 258:3402-3408[Free Full Text].
18. Kumar, A., J. Haque, J. Lacoste, J. Hiscott, and B. G. Williams. 1994. Double-stranded RNA-dependent protein kinase activates transcription factor NF-kappa B by phosphorylating Ikappa B. Proc. Natl. Acad. Sci. USA 91:6288-6292[Abstract/Free Full Text].
19. Lebleu, B., G. C. Sen, S. Shaila, B. Cabrer, and P. Lengyel. 1976. Interferon, double-stranded RNA, and protein phosphorylation. Proc. Natl. Acad. Sci. USA 73:3107-3111[Abstract/Free Full Text].
20. Lebrec, H., K. Sarlo, and G. R. Burleson. 1996. Effect of influenza virus infection on ovalbumin-specific IgE responses to inhaled antigen in the rat. J. Toxicol. Environ. Health 49:619-630[Medline].
21. Leibovitz, E., J. Freihorst, P. A. Piedra, and P. L. Ogra. 1988. Modulation of systemic and mucosal immune responses to inhaled ragweed antigen in experimentally induced infection with respiratory syncytial virus: implication in virally induced allergy. Int. Arch. Allergy Appl. Immunol. 86:112-116[Medline].
22. Lenardo, M. J., C.-M. Fan, T. Maniatis, and D. Baltimore. 1989. The involvement of NF-kappa B in beta-interferon gene regulation reveals its role as widely inducible mediator of signal transduction. Cell 57:287-294[Medline].
23. Levy, D. A., and A. G. Osler. 1966. Studies on the mechanisms of hypersensitivity phenomena. XIV. Passive sensitization in vitro of human leukocytes to ragweed pollen antigen. J. Immunol. 97:203-212[Abstract/Free Full Text].
24. Lin, R., D. Gewert, and J. Hiscott. 1995. Differential transcription activation in vitro by NFkappa B/Rel proteins. J. Biol. Chem. 270:3123-3131[Abstract/Free Full Text].
25. Lin, R. Y., and J. K. Smith, Jr. 1988. Hyper-IgE and human immunodeficiency virus infection. Ann. Allergy 61:269-272[Medline].
26. Lu, Y., R. M. Wambach, and R. M. Krug. 1995. Binding of the influenza virus NS1 protein to double-stranded RNA inhibits the activation of the protein kinase that phosphorylates the eIF-2 translation initiation factor. Virology 214:222-228[Medline].
27. Maitra, R. K., N. A. McMillan, S. Desai, J. McSwiggen, A. G. Hovanessian, G. Sen, B. R. Williams, and R. H. Silverman. 1994. HIV-1 TAR RNA has an intrinsic ability to activate interferon-inducible enzymes. Virology 204:823-827[Medline].
28. Minks, M. A., D. K. West, S. Benvin, and C. Baglioni. 1979. Structural requirements of double-stranded RNA for the activation of 2'-5' oligo(A) polymerase and protein kinase of interferon-treated HeLa cells. J. Biol. Chem. 254:10180-10183[Free Full Text].
29. Miyamoto, N. G., B. L. Jacobs, and C. E. Samuel. 1983. Mechanism of interferon action. Effect of double-stranded RNA and the 5'-O-monophosphate form of 2',5'-oligoadenylate on the inhibition of reovirus mRNA translation in vitro. J. Biol. Chem. 258:15232-15237[Abstract/Free Full Text].
30. Nielsch, U., S. G. Zimmer, and L. E. Babiss. 1991. Changes in NF-kappa B and ISGF3 DNA binding activities are responsible for differences in MHC and beta-IFN gene expression in Ad5- versus Ad12-transformed cells. EMBO J. 10:4169-4175[Medline].
31. O'Neill, R. E., and V. R. Racaniello. 1989. Inhibition of translation in cells infected with a poliovirus 2Apro mutant correlates with phosphorylation of the alpha subunit of eucaryotic initiation factor 2. J. Virol. 63:5069-5075[Abstract/Free Full Text].
32. Rice, A. P., R. Duncan, J. W. B. Hershey, and I. M. Kerr. 1985. Double-stranded RNA-dependent protein kinase and 2-5A system are both activated in interferon-treated, encephalomyocarditis virus-infected HeLa cells. J. Virol. 54:894-898[Abstract/Free Full Text].
33. Rothman, P., S. C. Li, B. Gorham, L. Glimcher, F. Alt, and M. Boothby. 1991. Identification of a conserved lipopolysaccharide-plus-interleukin-4-responsive element located at the promoter of germ line varepsilon  transcripts. Mol. Cell. Biol. 11:5551-5561[Abstract/Free Full Text].
34. Rothman, P., S. Lutzker, W. Cook, R. Coffman, and F. W. Alt. 1988. Mitogen plus interleukin 4 induction of C epsilon transcripts in B lymphoid cells. J. Exp. Med. 168:2385-2389[Abstract/Free Full Text].
35. Schreiber, E., P. Matthias, M. M. Muller, and W. Schaffner. 1989. Rapid detection of octamer binding proteins with `mini-extracts', prepared from a small number of cells. Nucleic Acids Res. 17:6419[Free Full Text].
36. Sen, R., and D. Baltimore. 1986. Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell 46:705-716[Medline].
37. Sha, W. C., H.-C. Liou, E. I. Tuomanen, and D. Baltimore. 1995. Targeted disruption of the p50 subunit of NF-kappa B leads to multifocal defects in immune responses. Cell 80:321-330[Medline].
38. Stavnezer, J. 1996. Antibody class switching. Adv. Immunol. 61:79-146[Medline].
39. Visvanathan, K. V., and S. Goodbourn. 1989. Double-stranded RNA activates binding of NF-kappa B to an inducible element in the human beta-interferon promoter. EMBO J. 8:1129-1138[Medline].
40. Whitaker-Dowling, P., and J. S. Youngner. 1983. Vaccinia rescue of VSV from interferon-induced resistance: reversal of translation block and inhibition of protein kinase activity. Virology 131:128-136[Medline].
41. Zilberstein, A., P. Federman, L. Shulman, and M. Revel. 1976. Specific phosphorylation in vitro of a protein associated with ribosomes of interferon-treated mouse L cells. FEBS Lett. 68:119-124[Medline].

J Virol, February 1998, p. 1171-1176, Vol. 72, No. 2
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Grayson, M. H., Cheung, D., Rohlfing, M. M., Kitchens, R., Spiegel, D. E., Tucker, J., Battaile, J. T., Alevy, Y., Yan, L., Agapov, E., Kim, E. Y., Holtzman, M. J. (2007). Induction of high-affinity IgE receptor on lung dendritic cells during viral infection leads to mucous cell metaplasia. JEM 204: 2759-2769 [Abstract] [Full Text]  
  • Proud, D., Sanders, S. P., Wiehler, S. (2004). Human Rhinovirus Infection Induces Airway Epithelial Cell Production of Human {beta}-Defensin 2 Both In Vitro and In Vivo. J. Immunol. 172: 4637-4645 [Abstract] [Full Text]  
  • He, B., Raab-Traub, N., Casali, P., Cerutti, A. (2003). EBV-Encoded Latent Membrane Protein 1 Cooperates with BAFF/BLyS and APRIL to Induce T Cell-Independent Ig Heavy Chain Class Switching. J. Immunol. 171: 5215-5224 [Abstract] [Full Text]  
  • Meusel, T. R., Imani, F. (2003). Viral Induction of Inflammatory Cytokines in Human Epithelial Cells Follows a p38 Mitogen-Activated Protein Kinase-Dependent but NF-{kappa}B-Independent Pathway. J. Immunol. 171: 3768-3774 [Abstract] [Full Text]  
  • Meusel, T. R., Kehoe, K. E., Imani, F. (2002). Protein Kinase R Regulates Double-Stranded RNA Induction of TNF-{alpha} But Not IL-1{beta} mRNA in Human Epithelial Cells. J. Immunol. 168: 6429-6435 [Abstract] [Full Text]  
  • Konno, S., Grindle, K. A., Lee, W.-M., Schroth, M. K., Mosser, A. G., Brockman-Schneider, R. A., Busse, W. W., Gern, J. E. (2002). Interferon-gamma Enhances Rhinovirus-Induced RANTES Secretion by Airway Epithelial Cells. Am. J. Respir. Cell Mol. Bio. 26: 594-601 [Abstract] [Full Text]  
  • Kehoe, K. E., Brown, M. A., Imani, F. (2001). Double-Stranded RNA Regulates IL-4 Expression. J. Immunol. 167: 2496-2501 [Abstract] [Full Text]  
  • (1999). Provocative factors in asthma. CMAJ 161: s8-14 [Full Text]  
  • Imani, F., Proud, D., Griffin, D. E. (1999). Measles Virus Infection Synergizes with IL-4 in IgE Class Switching. J. Immunol. 162: 1597-1602 [Abstract] [Full Text]  
  • Gern, J. E., Busse, W. W. (1999). Association of Rhinovirus Infections with Asthma. Clin. Microbiol. Rev. 12: 9-18 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rager, K. J.
Right arrow Articles by Imani, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rager, K. J.
Right arrow Articles by Imani, F.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»