Previous Article | Next Article 
J Virol, February 1998, p. 1036-1042, Vol. 72, No. 2
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The Pokeweed Antiviral Protein Specifically Inhibits
Ty1-Directed +1 Ribosomal Frameshifting and
Retrotransposition in Saccharomyces cerevisiae
Nilgun E.
Tumer,1,2
Bijal A.
Parikh,1,2
Ping
Li,3 and
Jonathan D.
Dinman3,4,*
Center for Agricultural Molecular
Biology1 and
Department of Plant
Pathology,2 Cook College, Rutgers
University, New Brunswick, New Jersey 08903-0231, and
Department of Molecular Genetics and
Microbiology3 and
Graduate Program in
Molecular Biosciences at Rutgers/University of Medicine and
Dentistry of New Jersey,4 University of
Medicine and Dentistry of New Jersey, Piscataway, New Jersey 08854
Received 21 August 1997/Accepted 25 October 1997
 |
ABSTRACT |
Programmed ribosomal frameshifting is a molecular mechanism that is
used by many RNA viruses to produce Gag-Pol fusion proteins. The
efficiency of these frameshift events determines the ratio of viral Gag
to Gag-Pol proteins available for viral particle morphogenesis, and
changes in ribosomal frameshift efficiencies can severely inhibit virus
propagation. Since ribosomal frameshifting occurs during the elongation
phase of protein translation, it is reasonable to hypothesize that
agents that affect the different steps in this process may also have an
impact on programmed ribosomal frameshifting. We examined the molecular
mechanisms governing programmed ribosomal frameshifting by using two
viruses of the yeast Saccharomyces cerevisiae. Here, we
present evidence that pokeweed antiviral protein (PAP), a single-chain
ribosomal inhibitory protein that depurinates an adenine residue in the
-sarcin loop of 25S rRNA and inhibits translocation, specifically
inhibits Ty1-directed +1 ribosomal frameshifting in intact
yeast cells and in an in vitro assay system. Using an in vivo assay for
Ty1 retrotransposition, we show that PAP specifically
inhibits Ty1 retrotransposition, suggesting that
Ty1 viral particle morphogenesis is inhibited in infected
cells. PAP does not affect programmed
1 ribosomal frameshift
efficiencies, nor does it have a noticeable impact on the ability of
cells to maintain the M1-dependent killer virus phenotype,
suggesting that
1 ribosomal frameshifting does not occur after the
peptidyltransferase reaction. These results provide the first evidence
that PAP has viral RNA-specific effects in vivo which may be
responsible for the mechanism of its antiviral activity.
 |
INTRODUCTION |
The maintenance of a correct reading
frame is fundamental to the integrity of the translation process
and, ultimately, to cell growth and viability. Although ribosomes
translate mRNAs with great accuracy, a number of cases in
which ribosomes are directed to shift a reading frame have been
identified and characterized. These most often have occurred in
double-stranded RNA (dsRNA) and plus-strand RNA viruses, as well as
in a few bacterial cellular genes and the ornithine decarboxylase
antizyme gene in mammals (for reviews, see references 4,
11, and 24). The study of these ribosomal
frameshifts is important both because of their critical role in animal
and plant pathogens and because of the information that they
provide about the mechanisms by which a reading frame is normally
maintained.
We have used two different viral systems (the L-A-M1
killer system and the Ty1 retrotransposable element) of
Saccharomyces cerevisiae as models to study programmed
ribosomal frameshifting. The 4.6-kb dsRNA genome of the yeast L-A virus
contains two open reading frames. The 5' gag gene encodes
the major viral coat protein (Gag), and the 3' pol gene
encodes a multifunctional protein domain which includes the
RNA-dependent RNA polymerase and a domain required for viral RNA
packaging (12, 29). A
1 ribosomal frameshift event is
responsible for the production of the Gag-Pol fusion protein (18,
21, 29). The M1 virus is a satellite of L-A, and its
1.6- to 1.8-kb dsRNA genome encodes a secreted killer toxin (reviewed
in reference 8). The M1 plus strand is
encapsidated and replicated in L-A-encoded viral particles.
Ty1 is the yeast equivalent of a retrovirus which uses a
ribosomal frameshift in the +1 direction for the production of its Gag
and Gag-Pol proteins (reviewed in references 11 and
20). With their different frameshift mechanisms,
these two viral systems constitute a powerful set of tools with which
ribosomal frameshifting can be dissected. The efficiency of ribosomal
frameshifting determines the ratio between viral Gag (structural) and
Gag-Pol fusion (enzymatic) proteins, and the proper ratio is required
for proper viral particle assembly. Changing the efficiency of
ribosomal frameshifting upsets this stoichiometry, inhibiting virus
maintenance (2, 15, 16, 32, 46). The efficiency, not the
direction of the frameshift, is important (15).
Programmed ribosomal frameshifting in the
1 direction in viruses that
infect eukaryotes requires a special sequence, X XXY YYZ (the 0 frame
is indicated by spaces), called the slippery site (31). The
simultaneous slippage of ribosome-bound A- and P-site tRNAs by 1 base
in the 5' direction still leaves their nonwobble bases correctly paired
in the new reading frame. A second frameshift-promoting element
(30), usually an RNA pseudoknot, is located immediately 3'
to the slippery site (5, 12, 40). The mRNA pseudoknot
structure makes the ribosome pause over the slippery site and is
thought to increase the probability of frameshifting (37,
42). The efficiency of
1 ribosomal frameshifting can be
affected by the ability of the ribosome-bound tRNAs to unpair from the
0 frame, the ability of these tRNAs to repair to the
1 frame, the
position of the RNA pseudoknot relative to the slippery site, and the
pseudoknot's thermodynamic stability (5-7, 12, 15, 30,
35). The Ty1 +1 ribosomal frameshift also requires a
ribosomal pause, but this occurs when an elongating ribosome encounters
a rare AGG codon in a special context (a "hungry codon"). The
elongating ribosome, having its P site occupied by a
peptidyl-tRNA, is forced to pause with its A site unoccupied as
a consequence of the low abundance of the cognate
tRNACUUArg (22). If, during the course
of the pause, the ribosome slips 1 base in the 3' direction, this
peptidyl-tRNA is capable of base pairing to the new P-site codon in the
+1 reading frame. The new A-site codon corresponds to an abundant
tRNAGCCGly. If this tRNA can be inserted into the
+1 frame codon, then the ribosomal frameshift can become
established.
The 29-kDa pokeweed antiviral protein (PAP) isolated from
Phytolacca americana is a ribosome-inactivating protein
(RIP). PAP catalytically removes a specific adenine base from a highly
conserved, surface-exposed stem-loop structure in the large rRNA of
eukaryotic and prokaryotic ribosomes (19, 26). PAP displays
broad-spectrum antiviral activity against plant and animal viruses,
including influenza virus (41), poliovirus (44),
herpes simplex virus (1), and human immunodeficiency virus
(47). PAP removes an adenine base by specific cleavage of
the N-glycosidic bond at A4324 in rat 28S rRNA and at homologous sites
on ribosomes from other organisms. Ribosomes depurinated in this manner
are unable to bind the elongation factor 2 (EF-2)-GTP complex, and
protein synthesis is blocked at the translocation step (34,
36). We previously expressed a PAP cDNA in S. cerevisiae under the control of the galactose-inducible
GAL1 promoter and showed that the expression of PAP inhibits
the growth of yeast cells (28). Mutants of PAP that lose
this growth-inhibiting ability have been isolated. One of the PAP
mutants, pNT123-2, had a point mutation at the active site (E176V).
This mutation abolished enzymatic activity in vitro in rabbit
reticulocyte lysates (28) and in vivo in yeasts
(28) and in transgenic plants (43).
In this report, we demonstrate that the expression of PAP in S. cerevisiae leads to specific inhibition of ribosomal frameshifting in the +1 direction and interferes with the ability of Ty1
to retrotranspose. In contrast, PAP expression in yeast does not affect
ribosomal frameshifting in the
1 direction, nor does it interfere
with maintenance of the M1-dependent killer virus
phenotype. Our results are explained in light of a "kinetic pause"
model of programmed ribosomal frameshifting. This is the first
demonstration of specific inhibition of ribosomal frameshifting and
retrotransposition by PAP and suggests that this inhibition may be a
general mechanism for inhibition of other viral or cellular mRNAs that
use programmed +1 ribosomal frameshifting.
 |
MATERIALS AND METHODS |
Strains and media.
S. cerevisiae PSY1
(MATa ade2-1 trp1-1 ura3-1 leu2-3,112 his3-11,15
can1-100) was used for all of the assays. Strain JD759
{MAT
kar1-1 arg1 thr(1,X) [L-AHN
M1]} was used as the cytoduction donor strain in order
to introduce the L-A and M1 dsRNA viruses into PSY1. Strain
5X47 (a/
his1/+ trp1/+ ura3/+
K
R
) was the killer indicator strain used to
score the killer phenotype as described previously (12).
YPAD, YPG, SD, synthetic complete medium, and 4.7MB plates for testing
the killer phenotype were prepared as previously reported
(16). Synthetic complete medium (H
leu, H
ura, and
H
ura,
leu) (e.g., synthetic complete medium H lacking leucine
[H
leu]) with 2% dextrose, galactose, or raffinose was used for
controlling the induction of the PAP gene from the pNT188 and pNT123
plasmid vectors.
Plasmids.
Plasmids pNT188 and pNT123 were constructed as
described previously (28) by cloning the cDNAs encoding PAP
3' of the GAL1 promoter in the yeast expression vector
YEp351 containing the selectable marker LEU2 and the yeast
expression vector pAC55 containing the selectable marker
URA3, respectively. The expression of PAP in both pNT188 and
pNT123 is under the control of the galactose-inducible GAL1
promoter. The PAP catalytic site mutant pNT123-2 was generated by ethyl
methanesulfonate mutagenesis and characterized previously (28,
43). Plasmids pT125 (0 frame control), pF8 (L-A-derived
1
ribosomal frameshift test vector), and pJD104 (Ty1-derived +1 ribosomal frameshift test vector), used in the in vivo ribosomal frameshifting assay, were described previously (2, 12) (Fig. 1A). pTY1HIS3AI was used to measure
Ty1 retrotransposition frequencies (10).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 1.
Vectors used to measure programmed ribosomal
frameshifting efficiencies in vivo (A) and in vitro (B). The in vivo 0 frame control reporter plasmid pT125 and the 1 ribosomal frameshift
test plasmid pF8 are described elsewhere (12). The +1
ribosomal frameshift test plasmid pJD104 is described elsewhere
(2). In these constructs, transcription is driven from the
constitutive phosphoglycerol kinase 1 (PGK1) promoter. The
in vitro 0 frame control plasmid pLUC0 and the 1 ribosomal frameshift
test plasmid pJD120 are described elsewhere (14).
Construction of the in vitro +1 ribosomal frameshift plasmid pJD120.104
is described in Materials and Methods. The efficiencies of programmed
ribosomal frameshifting were determined by dividing the enzymatic
activities produced from the frameshift reporters ( 1 or +1) by the
enzymatic activities produced from the 0 frame controls and multiplying
the resulting ratios by 100. The approximate locations of 1, +1, and
0 frame termination codons are indicated by numbers.
|
|
Plasmids pT7-LUC minus 3'UTR-A50 (
23) (referred to as
pLUC0) and pJD120 were used to produce synthetic 0 frame
luciferase
and synthetic L-A-derived

1 ribosomal frameshift test
mRNAs,
respectively, as described previously (
14). The
synthetic oligonucleotides
5' CCCCCCATGGTAACCCCGGGCTG
3' and 5' CCCCAAGCTTATGACTTCTAGGATC
3' were
used to amplify the Ty
1-derived +1 ribosomal frameshift
signal from pJD104 by use of the PCR. The approximately 200-bp
DNA
fragment was digested with
HindIII and
NcoI and ligated into
similarly digested pLUC0 to make
pJD120.104. In this plasmid,
the luciferase gene is 3' of the
Ty
1 +1 ribosomal frameshift signal
and in the +1 frame with
respect to the AUG translational start
site. These plasmids are shown
in Fig.
1B.
Genetic methods. (i) Ty1 retrotransposition
frequency.
PSY1 cells harboring either pNT188 or YEp351 were
transformed with pTy1HIS3AI (10) and selected for on
H
ura,
leu with 2% dextrose. Transformants were then grown on
H
ura,
leu with 2% galactose at room temperature for 4 days. Patches
of cells were subsequently replica plated back onto H
ura,
leu with
2% dextrose and incubated at 30°C for 2 days. After incubation, the
cells were replica plated onto H
his or grown in H
ura,
leu liquid
medium. The optical density at 550 nm was determined for cells grown in liquid medium, and 10-fold dilutions of cells from 104 to
108 CFU were seeded onto H
his medium. Retrotransposition
frequencies were calculated by dividing the number of His+
colonies by the total number of CFU seeded onto the plate.
(ii) Killer assay.
PSY1 cells harboring pNT188 or YEp351
were cured of mitochondrial DNA ([rho0]) by
growth on selective medium containing 33 µg of ethidium bromide per
ml. L-A and M1 were introduced into
[rho0] cells by cytoduction for 7 h at
30°C as described previously with JD759 as the donor cells
(15). Cells were streaked for single colonies onto H
arg
medium to select against the donor strain and subsequently replica
plated to SD, YPG, and 4.7MB plates seeded with 5X47 killer indicator
cells. Cytoductants were identified by growth on H
arg and YPG, no
growth on SD, and killer phenotypes. To test for the effects of PAP on
the maintenance of L-A and M1, cells were grown on H
leu
containing 2% galactose for 4 days at 24°C. Cells were then
incubated in H
leu liquid medium containing 2% dextrose overnight at
30°C, seeded onto H
leu containing 2% dextrose at densities of
approximately 100 CFU/plate, grown for single colonies, and replica
plated to killer indicator plates.
(iii) Measurement of ribosomal frameshifting in vivo.
Cells
harboring pNT123, pNT123-2, or vector alone were transformed with
either pT125, pF8, or pJD104, and transformants were selected on
H
ura,
trp medium. A minimum of three independent transformants from
each group were grown overnight in H
ura,
trp containing 2%
raffinose at 30°C. The cultures were then split, centrifuged,
resuspended in 2 ml of H
ura,
trp containing either 2% raffinose or
2% galactose, and grown for 5 h. This procedure will induce PAP
expression, as shown earlier (28).
-Galactosidase activities were determined as described previously (12). All assays were performed in triplicate, and each assay was repeated at
least three times. Percent inhibition by PAP of general translation (0 frame) was calculated by determining the ratio of
-galactosidase activities produced by induced and uninduced cells. Percent inhibition by PAP of ribosomal frameshifting was calculated by determining the
ratio of ribosomal frameshifting efficiencies in induced and uninduced
cells.
(iv) Luciferase assay.
Synthetic 7methyl-Gppp
poly(A)-tailed mRNAs were prepared as T7 RNA polymerase runoff
transcripts from DraI-digested pLUC0, pJD120, and pJD120.104
with a mMessagemMachine kit (Ambion). Translation-competent rabbit
reticulocyte lysates were commercially obtained, and in vitro
translation reactions were carried out as described by the manufacturer
(Ambion). Lysates (20 µl) were preincubated at 28°C for 15 min with
1 to 4 pg of PAP, and then 20 ng of each of the mRNAs (Luc0, Luc
1,
and Luc+1) was added to the PAP-lysate mixture and allowed to incubate
at 28°C for 45 min. Each data point was assayed in triplicate. After
incubation, the mixture was placed on dry ice to stop the reaction and
subsequently was allowed to thaw on ice. Luciferase activities were
determined with a Turner 20/20 luminometer. Ribosomal frameshift
efficiencies were calculated by determining the ratio of luciferase
activities produced by the test mRNAs (Luc
1 and Luc+1) and the 0 frame control mRNA (Luc0).
(v) Nuclease protection assays.
Total cellular RNA was
isolated from induced and uninduced cells harboring PAP and frameshift
test vectors by previously described methods (9) to measure
the effects of PAP on mRNA abundances in vivo. To measure the effects
of PAP on mRNA abundances in vitro, the synthetic luciferase test mRNAs
were extracted from rabbit reticulocyte extracts by organic extraction
after the incubation described above. RNase protection assays followed
procedures described elsewhere (33). Briefly, RNA (10 µg)
from each sample was resuspended to a total volume of 21 µl in
hybridization buffer [40 mM
piperazine-N,N'-bis(2-ethanesulfonic acid) (pH
6.4), 1 mM EDTA, 0.4 M NaCl, 80% formamide]. The buffer contained
excess probe. A 200-nucleotide (nt) [
-32P]CTP-labelled
minus-strand lacZ probe generated from a T7 RNA polymerase
runoff transcript of HincII-digested pJD86 (16)
and a 241-nt [
-32P]CTP-labelled minus-strand
CYH2 probe generated from an SP6 RNA polymerase runoff
transcript of HincII-digested pGEM-42-CYH2 (25) were used as probes to measure the effects of PAP on mRNA abundances in
vivo. The CYH2 gene encodes the constitutively expressed
ribosomal protein L29 (39) and was used as a loading
control. A 300-nt [
-32P]CTP-labelled minus-strand
luciferase probe generated from a T7 RNA polymerase runoff transcript
of pLUC0 digested with ClaI was used to measure the effects
of PAP on mRNA abundances in vitro. Hybridization was carried out
initially at 70°C for 15 min and then at 50°C for 5 h. RNase
T1 and RNase A (200 µl of a 300 mM NaCl-10 mM Tris [pH
7.5]-5 mM EDTA buffer containing 286 U of RNase T1 and
0.72 µg of RNase A) were added to the annealed RNAs, and the mixture
was incubated at room temperature for 15 min. Seventeen microliters of
a proteinase K-sodium dodecyl sulfate solution (1:4 ratio of proteinase
K at 10 mg/ml to 10% sodium dodecyl sulfate) was added, and the
reaction mixtures were incubated for 15 min at 37°C. The reaction
mixtures were extracted with an equal volume of phenol-chloroform
equilibrated to pH 7.5 and were centrifuged for 5 min, the aqueous
layers were removed, carrier tRNA (20 µg) was added, and nucleic
acids were precipitated with 2.5 volumes of ethanol at
20°C for 15 min. Dried pellets were resuspended in 20 µl of loading dye and
denatured at 100°C for 3 min, and RNA samples were
electrophoretically separated through 6% polyacrylamide denaturing
gels, which were dried and exposed for autoradiography. The protected
RNA fragments were quantitated with a Bio-Rad model G-670 imaging
densitometer. The relative lacZ mRNA abundances were
calculated by determining the ratio of lacZ- to
CYH2-protected RNA fragment band intensities.
 |
RESULTS |
In vivo frameshifting.
RIP-mediated depurination of the large
ribosomal subunit RNA results in increased susceptibility of the RNA
sugar-phosphate backbone to hydrolysis at the depurination site. Hence,
when depurinated rRNA is treated with aniline, a small fragment which
corresponds to the 3'-terminal end of the large rRNA is released
(3, 26, 38). Previous results demonstrated that when
ribosomes from wild-type yeast were incubated with PAP and the rRNA
extracted from these ribosomes was treated with aniline, a 367-nt RNA
fragment was released (43). When ribosomes were isolated
from yeast expressing PAP (pNT123) or the active-site mutant PAP
(pNT123-2) and subjected to the RNA depurination assay, the diagnostic
367-nt RNA fragment was generated from cells expressing PAP but not
from cells expressing the active-site mutant PAP (43). These
results indicated that yeast ribosomes are depurinated in vivo by
expression of wild-type PAP but not by expression of the active-site
mutant PAP (43).
The effects of PAP on programmed

1 and +1 ribosomal frameshifting
were assayed with PSY1 cells cotransformed with a series
of
TRP1- and
URA3-based vectors (Fig.
1A). The
TRP1-based vectors
were used to assay programmed ribosomal
frameshifting. pF8 (
12)
and pJD104 (
2) were used
to measure

-galactosidase activities
produced as a consequence of
L-A sequence-directed

1 and of Ty
1 sequence-directed +1
ribosomal frameshift events, respectively.
pT125 (
12) was
used as the 0 frame

-galactosidase standard.
The efficiency of
programmed ribosomal frameshifting was determined
by calculating the
ratio of

1 frame or +1 frame to 0 frame

-galactosidase
activities
and multiplying by 100 (
12). The
URA3-based
vectors
harbored PAP (pNT123), the active-site mutant PAP (pNT123-2),
or a control. In pNT123 and pNT123-2, transcription of the genes
encoding PAP was under the control of the
GAL1 promoter. To
induce
the production of PAP, overnight cultures were split into
selective
media containing 2% galactose as the carbon source. Cells
grown
in 2% raffinose were used as uninduced controls. After 5 h
of
growth,

-galactosidase activities were determined, and the
efficiencies
of ribosomal frameshifting were calculated.
The results of these experiments are summarized in Table
1. Neither the presence of galactose
alone nor the induction of
PAP (pNT123) by galactose affected the
overall translation of
the 0 frame control reporter mRNA. Similarly,
neither of these
factors had any influence on translation of the

1
ribosomal frameshift
reporter mRNA or on

1 ribosomal frameshifting
efficiency. Interestingly,
both growth in galactose and the
induction of PAP affected the
translation of the +1 ribosomal
frameshift reporter mRNA (pJD104).
Galactose alone increased the
translation of this reporter 2.26-fold
above the raffinose
control. Consequently, the efficiency of +1
ribosomal frameshifting was
stimulated 2.28-fold under these conditions.
This trend was observed in
both the absence of PAP (PSY1) and
the presence of the active-site
mutant PAP (pNT123-2). Induction
of PAP reversed this trend, resulting
in decreased +1 frame reporter

-galactosidase activity (Gal/Raf
ratio, 0.46) and a corresponding
decrease in +1 ribosomal frameshifting
efficiency (Gal/Raf ratio,
0.47). As a true monitor of the overall
effects of PAP on programmed
ribosomal frameshifting, the ratios of
frameshifting in PAP-induced
and uninduced cells (Gal/Raf in pNT123 and
pNT123-2) were normalized
to those in control cells (Gal/Raf in
PSY1). As indicated in Table
1 and as shown in Fig.
2, active PAP inhibited Ty
1
sequence-directed
+1 ribosomal frameshifting to approximately
21% of wild-type levels
([0.47/2.28] × 100). The expression of
inactive PAP (pNT123-2)
had no such effect ([2.13/2.28] × 100, or
93%). With respect to
programmed

1 ribosomal frameshifting, there
were no significant
differences in the ratios between cells expressing
the active
and cells expressing the inactive forms of PAP.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Effects of PAP on programmed ribosomal frameshifting in
vivo. Cultures of yeast cells harboring frameshift indicator vectors (0 frame control and 1 or +1 ribosomal frameshift test vectors) and
either pNT123 (galactose-inducible wild-type PAP), pNT123-2
(galactose-inducible active-site mutant PAP), or no other vector were
split into selective media containing either 2% galactose (induced) or
2% raffinose (uninduced) and incubated for 5 h. -Galactosidase
activities were then determined. The efficiencies of programmed
ribosomal frameshifting are taken from Table 1. To obtain the percent
of control, the ratios of frameshifting in PAP-induced and uninduced
cells (Gal/Raf in pNT123 and pNT123-2; Table 1) were normalized to
those in control cells (Gal/Raf in PSY1; Table 1). RFS, ribosomal
frameshift.
|
|
In vitro frameshifting.
The efficiencies of
1 and +1
ribosomal frameshifting were examined in vitro with synthetic
luciferase-based reporters (Fig. 1B) in translationally competent
rabbit reticulocyte extracts. The efficiencies of ribosomal
frameshifting were determined by measuring the ratios of
light units produced by the frameshift reporter mRNAs (Luc
1 and
Luc+1) and dividing them by those produced by the 0 frame control mRNA
(Luc0). The effects of PAP on
1 and +1 ribosomal frameshifting were
examined by the addition of purified PAP to the translation extracts.
The results of these experiments are summarized in Table
2. Although the addition of purified PAP
inhibited overall translation up to approximately 40% (compare 0 frame
with no PAP to 0 frame with 4 pg of PAP), the luciferase activity of
the
1 frame construct decreased in parallel with that of the 0 frame
construct such that there were no changes in
1 ribosomal
frameshifting efficiencies. However, the luciferase activity generated
from the +1 frame construct decreased much more rapidly than that
generated from the 0 frame construct such that there was an overall
decrease in +1 ribosomal frameshifting efficiency, from 15.6% (no PAP)
to only 1.1% (4 pg of PAP), an approximate 94% inhibition of +1
ribosomal frameshifting. Figure 3 shows a
plot of the ratios of programmed ribosomal frameshifting as a
percentage of the 0 frame control value. The addition of PAP
specifically inhibited +1 ribosomal frameshifting. These data indicate
that PAP has a specific and direct effect on the mechanisms that govern
+1 ribosomal frameshifting.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
Effects of PAP in vitro on 1 and +1 ribosomal
frameshifting (RFS) efficiencies. Translation-competent rabbit
reticulocyte lysates were preincubated at 28°C for 15 min with the
indicated amounts of purified PAP. Then, 20 ng of each of the synthetic
luciferase reporter mRNAs (0 frame control and 1 or +1 ribosomal
frameshift test mRNAs) was added to the PAP-lysate mixture and
incubated at 28°C for 45 min. Luciferase activities were then
determined by luminometry. Ribosomal frameshifting efficiencies were
calculated by determining the ratios of luciferase activities produced
by the test mRNAs to the 0 frame control value. Percent of control
represents the efficiency of ribosomal frameshifting plotted as a
percentage of that in the no-PAP control.
|
|
Nuclease protection assays.
The
1 and +1 lacZ
reporter mRNAs both contain in-frame nonsense codons approximately 200 nt from their 5' ends, followed by over 3.1 kb of lacZ
message, and these mRNAs are intrinsically unstable (9). In
contrast, the 0 frame control mRNA produced from pT125 is very stable.
Thus, changes in the stabilities of either of the reporter mRNAs might
alter the amount of
-galactosidase present in the cell, which in
turn might affect the apparent efficiency of programmed ribosomal
frameshifting. In order to examine these possibilities, nuclease
protection assays were performed. A 200-nt 32P-labelled
minus-strand RNA corresponding to the 3' end of the lacZ
mRNA was transcribed and ybridized, in the presence of excess probe,
with total RNA extracted from induced and uninduced cells harboring the frameshift vectors (pT125, pF8, or pJD104) and pNT123, pNT123-2, or vector alone. A 260-nt 32P-labelled
minus-strand CYH2 mRNA, which encodes the constitutively expressed ribosomal protein L29 (39), served as the internal loading control for each sample. Samples were electrophoretically separated, and the intensities of the protected bands were determined by scanning densitometry. The ratios of the intensities of the 200-nt
lacZ band to the 241-nt CYH2 band were
determined, and these ratios were used as relative measures of
steady-state lacZ mRNA abundance. No differences were noted
in the ratios of CYH2 mRNA to 0 frame,
1 frame, or +1
frame lacZ mRNAs for cells grown with galactose versus
raffinose (data not shown). The effects of PAP on the 0 frame,
1
frame, and +1 frame luciferase reporter mRNAs were also assayed in
vitro. Increasing concentrations of PAP had no effect on luciferase
mRNA stabilities (data not shown). Thus, the observed decreases in +1
ribosomal frameshifting efficiency in PAP-induced cells in vivo and
upon the addition of PAP to translationally competent reticulocyte
lysates in vitro are not due to the preferential destabilization of the
+1 lacZ reporter mRNA in either of these systems. These data
support the conclusion that PAP specifically inhibits +1 ribosomal
frameshifting.
Retrotransposition and maintenance of the killer phenotype.
The effects of PAP on the ability of cells to propagate two different
sets of ribosomal frameshift-dependent viruses were examined. To
examine the effects of PAP on Ty1 retrotransposition, galactose was used to coinduce the transcription of PAP and of a
HIS3-tagged Ty1 mRNA from
LEU2-selectable pNT188 and URA3-selectable pTy1HIS3AI plasmids, respectively. Control cells harboring
pTy1HIS3AI contained the LEU2-selectable YEp351
plasmid. In pTy1HIS3AI, transcription of a Ty1 cDNA is
induced by galactose (10). This cDNA also contains the yeast
HIS3 gene in the reverse orientation and into which an
artificial intron has been introduced. The intron is spliced out of the
galactose-induced transcript, and the spliced transcript is packaged
and copied into Ty1 cDNA in Ty1 viruslike
particles. These enter the nucleus, and the cDNA is integrated into a
chromosomal locus. The endogenous HIS3 promoter can then
transcribe this gene. Conversion of his3 cells from
His
to His+ is used as an indicator of
Ty1 retrotransposition from the plasmid to a host cell
chromosome. The entire process is dependent on viral particle
morphogenesis, which in turn is extremely sensitive to alterations in
programmed +1 ribosomal frameshifting efficiencies (reviewed in
reference 11). Thus, changes in Ty1
retrotransposition frequencies are indicative of the effect of PAP on
programmed +1 ribosomal frameshifting efficiencies. Figure
4 shows, on a qualitative level, that
Ty1 retrotransposition frequencies are substantially reduced
in the presence of PAP. To quantitate the inhibitory effect of PAP on
Ty1 retrotransposition frequencies, cells that had undergone
galactose induction were grown in liquid medium and spread onto H
his
medium at densities ranging from 104 to 108
CFU. Ty1 retrotransposition frequencies were directly
calculated by determining the ratio of His+ CFU to the
total number of CFU per plate. Retrotransposition frequencies in
control cells (YEp351) were 1.31 × 10
2, whereas
those in cells expressing PAP (pNT188) were 8.6 × 10
5. Thus, the inhibition of Ty1
retrotransposition by PAP is greater than 99%.

View larger version (84K):
[in this window]
[in a new window]
|
FIG. 4.
PAP inhibits Ty1 retrotransposition. PSY1
cells were transformed with galactose-inducible PAP (pNT188) or vector
(YEp351) and pTy1HIS3AI. Cells were grown at 24°C on medium
containing 2% galactose but lacking uracil and leucine for 4 days,
replica plated at 30°C to medium containing 2% dextrose but lacking
uracil and leucine, and subsequently replica plated to medium
containing 2% dextrose but lacking histidine. Growth of the colonies
was indicative of Ty1 retrotransposition.
|
|
L-A and M
1 were introduced into PSY1 cells harboring either
pNT188 or YEp351 as described in Materials and Methods. PAP was
induced
in these cells as described above for 4 days. Cells were
subsequently
grown in liquid cultures, and approximately 100 CFU
of cells was spread
onto H

leu medium (four plates each). Individual
colonies were allowed
to grow at 30°C and then were replica plated
to 4.7MB killer
indicator plates. No qualitative or quantitive
differences were
observed between the PAP-induced and vector control
cells with regard
to their killer phenotypes (data not shown).
These results suggest that
PAP may not have an effect on killer
phenotype maintenance or, if there
is an effect, that it is too
subtle to be detected by these assays.
 |
DISCUSSION |
The translocation step of protein synthesis divides the population
of ribosomes between those having both P and A sites occupied by a
peptidyl-tRNA and an aminoacyl-tRNA, respectively (the substrate for
L-A-promoted
1 ribosomal frameshifting), and those having only the P
site occupied by a peptidyl-tRNA (the substrate for Ty1-promoted +1 ribosomal frameshifting). We interfered with
translocation by using the 29-kDa PAP isolated from P. americana. PAP inhibits EF-2-mediated translocation by
catalytically depurinating a specific adenine residue in the
-sarcin
loop of eukaryotic 28S rRNA (19, 28). We previously
demonstrated that yeast cells lack endogenous RIP activity but that
recombinant PAP is enzymatically active when expressed in intact yeast
cells and purified PAP is active in yeast cell extracts
(43). Here, we observed that the in vivo induction of
PAP had a cytostatic rather than a cytotoxic effect. Cell
growth was strongly inhibited when pNT123- or pNT188-harboring cells were grown in the presence of galactose. However, these cells
resumed normal growth phenotypes upon transfer to glucose. Thus, PAP
did not kill the cells per se but rather arrested cell growth and
protein synthesis.
We investigated the effects of plasmid-borne, galactose-inducible PAP
and an active-site mutant PAP (43) on programmed ribosomal frameshifting efficiencies and virus propagation by using both intact
cells and translationally competent rabbit reticulocyte extracts. PAP
specifically decreased +1 ribosomal frameshifting efficiencies to
approximately 20% of wild-type levels in vivo (Table 1 and Fig. 2).
PAP also strongly and specifically inhibited +1 ribosomal frameshifting
in an in vitro translation system (Table 2 and Fig. 3). There were no
corresponding changes in
1 ribosomal frameshifting efficiencies or in
the relative steady-state abundances of +1 ribosomal frameshift
reporter mRNAs in the presence of PAP in either the in vivo or the in
vitro system. These data demonstrated that PAP acts directly to
specifically inhibit Ty1-directed programmed +1 ribosomal
frameshifting.
Our research has focused on characterizing the molecular mechanisms
underlying programmed ribosomal frameshifting. We previously used
genetic analyses to identify nine complementation groups of yeast
mof (maintenance of frame) mutants having increased
efficiencies of
1 ribosomal frameshifting (9, 15-17).
Programmed ribosomal frameshifting is a kinetic phenomenon in which
ribosomal pauses at the Ty1 and L-A slippery sites drive the
+1 and
1 frameshifts, respectively. A kinetic pause model of
programmed ribosomal frameshifting predicts that changes in the length
of time that ribosomes are paused at these frameshift signals should
result in changes in the probability of ribosomal slippage. Since the
ribosomal pauses occur during the course of translational elongation,
the kinetic parameters that might influence these processes must be
defined in the context of the three limiting steps of the translational elongation cycle (reviewed in reference 27). These
are (i) recognition and insertion into the ribosomal A site of cognate
aminoacyl-tRNA by EF-1; (ii) peptide transfer (mediated by the
ribosomal peptidyl transferase center); and (iii) translocation
mediated by EF-2. We previously targeted the first step by using
mutants of TEF2 (encoding elongation factor 1
),
demonstrating that specific TEF2 mutants affect either
1
or +1 ribosomal frameshifting efficiencies (13). The
peptidyl transferase inhibitors anisomycin and sparsomycin were used to
target the second step; these inhibitors specifically altered
1
ribosomal frameshifting efficiencies and promoted the loss of both L-A
and M1 (14). In this report, we used PAP to target the translocation step. The model predicts that translocation defects should decrease the ratio of ribosomes with an unoccupied A
site (substrate for Ty1-directed +1 ribosomal frameshifting) to an EF-1-aminoacyl-tRNA-GTP ternary complex. Thus, the A sites of
ribosomes that have passed through the translocation step should be
rapidly occupied by the ternary complex, effectively decreasing the
length of time that these ribosomes are paused at the Ty1 +1
frameshift signal. This process should lead to a decrease in the
overall probability of ribosomal slippage. As predicted by the model,
PAP decreased the efficiencies of programmed +1 ribosomal frameshifting
in both intact cells and an in vitro assay system. Further, a mutant
PAP with an inactivated active site (pNT123-2), which does not inhibit
translocation, had no such effect. Notably, PAP had no effect on
1
ribosomal frameshifting efficiencies. PAP-inhibited ribosomes should
have both their A and P sites occupied by tRNAs and, as such, could
theoretically be substrates for programmed
1 ribosomal frameshifting.
The inability of PAP to affect this process suggests that ribosomes
that have passed through the peptidyl transfer step but that have not
translocated are no longer capable of shifting in the
1 direction.
Thus, the results presented here provide the first evidence that
programmed
1 ribosomal frameshifting does not occur after the
peptidyl transferase reaction and narrow the window during which
1
ribosomal frameshifting can occur.
It has been demonstrated that increasing the efficiency of +1 ribosomal
frameshifting by starving cells for polyamines (2) or by
disrupting the gene encoding tRNACUUArg
(HSX1) (32) strongly inhibits
Ty1 retrotransposition. Similarly, decreasing the efficiency
of +1 ribosomal frameshifting by overexpressing tRNACUUArg also inhibits Ty1
retrotransposition (46). Here we demonstrate that
PAP-promoted inhibition of +1 ribosomal frameshifting also has a strong
inhibitory effect on this process (Table 2 and Fig. 3). Although it has
been reported that PAP can inhibit the replication of human
immunodeficiency virus, a virus that requires a
1 ribosomal frameshift, we did not observe any effect on either L-A
sequence-directed
1 ribosomal frameshifting or the ability of cells
to maintain the M1-dependent killer virus phenotype. A
critical difference between assays for Ty1
retrotransposition and those for killer phenotype maintenance is that
in the former, the cells start out with no Ty1 viral
particles, whereas in the latter, the cells contain approximately
104 L-A and M1 viral particles. Thus, with
regard to the killer assay, the cells are already superinfected,
whereas the Ty1 retrotransposition assay requires a de novo
infection by inducing transcription and translation of the
Ty1 virus. It is possible that PAP exerts a general effect
on translation that interferes with the establishment of an infection
and that the killer assay is not sensitive enough to observe this
effect. Alternatively, PAP may specifically recognize and promote the
destabilization of 7-methyl-Gppp-capped or polyadenylated viral RNAs.
The Ty1 mRNA used in our study was capped. In contrast, L-A
and M1 mRNAs may not be suitable substrates for PAP because they are not capped or polyadenylated (reviewed in reference
45). Recently, we reported that a nontoxic
C-terminal deletion mutant of PAP which does not depurinate host
ribosomes inhibits viral infection, suggesting that the antiviral
activity of PAP is not solely due to the depurination of host ribosomes
(43). The results reported here indicate that PAP
specifically inhibits Ty1 but not L-A and M1,
providing further evidence that the antiviral activity of PAP is
not due solely to a general inhibition of host protein synthesis.
 |
ACKNOWLEDGMENTS |
We thank Peter Day and Terri Goss Kinzy for critical reading of
the manuscript and Annette Chiang for constructing pNT188.
This work was supported in part by grants to J.D.D. from the Foundation
of the University of Medicine and Dentistry of New Jersey (grant 8-97)
and the State of New Jersey Commission on Cancer Research (grant
96-62-CC2-00) and by National Science Foundation (NSF) grant
NSFMCB96-31308 to N.E.T. B.P. was supported by the NSF Research
Experience for the Undergraduates (REU) Program.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Genetics and Microbiology, Robert Wood Johnson Medical
School, University of Medicine and Dentistry of New Jersey, 675 Hoes
Ln., Piscataway, NJ 08854-5635. Phone: (732) 235-5856. Fax: (732)
235-5223. E-mail: dinmanjd{at}umdnj.edu.
 |
REFERENCES |
| 1.
|
Aron, G. M., and J. D. Irvin.
1980.
Inhibition of herpes simplex virus multiplication by the pokeweed antiviral protein.
Antimicrob. Agents Chemother.
17:1032-1033[Abstract/Free Full Text].
|
| 2.
|
Balasundaram, D.,
J. D. Dinman,
R. B. Wickner,
C. W. Tabor, and H. Tabor.
1994.
Spermidine deficiency increases +1 ribosomal frameshifting efficiency and inhibits Ty1 retrotransposition in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
91:172-176[Abstract/Free Full Text].
|
| 3.
|
Bass, H. W.,
C. Webster,
G. R. O'Brian,
J. K. Roberts, and R. S. Boston.
1992.
A maize ribosome-inactivating protein is controlled by the transcriptional activator Opaque-2.
Plant Cell
4:225-234[Abstract/Free Full Text].
|
| 4.
|
Brierley, I.
1995.
Ribosomal frameshifting on viral RNAs.
J. Gen. Virol.
76:1885-1892[Abstract/Free Full Text].
|
| 5.
|
Brierley, I. A.,
P. Dingard, and S. C. Inglis.
1989.
Characterization of an efficient coronavirus ribosomal frameshifting signal: requirement for an RNA pseudoknot.
Cell
57:537-547[Medline].
|
| 6.
|
Brierley, I. A.,
A. J. Jenner, and S. C. Inglis.
1992.
Mutational analysis of the "slippery sequence" component of a coronavirus ribosomal frameshifting signal.
J. Mol. Biol.
227:463-479[Medline].
|
| 7.
|
Brierley, I. A.,
N. J. Rolley,
A. J. Jenner, and S. C. Inglis.
1991.
Mutational analysis of the RNA pseudoknot component of a coronavirus ribosomal frameshifting signal.
J. Mol. Biol.
220:889-902[Medline].
|
| 8.
|
Bussey, H.
1991.
K1 killer toxin, a pore-forming protein from yeast.
Mol. Microbiol.
5:2339-2343[Medline].
|
| 9.
|
Cui, Y.,
J. D. Dinman, and S. W. Peltz.
1996.
mof4-1 is an allele of the UPF1/IFS2 gene which affects both mRNA turnover and 1 ribosomal frameshifting efficiency.
EMBO J.
15:5726-5736[Medline].
|
| 10.
|
Curcio, M. J., and D. J. Garfinkel.
1991.
Single-step selection for Ty1 element retrotransposition.
Proc. Natl. Acad. Sci. USA
88:936-940[Abstract/Free Full Text].
|
| 11.
|
Dinman, J. D.
1995.
Ribosomal frameshifting in yeast viruses.
Yeast
11:1115-1127[Medline].
|
| 12.
|
Dinman, J. D.,
T. Icho, and R. B. Wickner.
1991.
A 1 ribosomal frameshift in a double-stranded RNA virus forms a Gag-Pol fusion protein.
Proc. Natl. Acad. Sci. USA
88:174-178[Abstract/Free Full Text].
|
| 13.
|
Dinman, J. D., and T. G. Kinzy.
1997.
Translational misreading: mutations in translation elongation factor 1 differentially affect programmed ribosomal frameshifting and drug sensitivity.
RNA
3:870-881[Abstract].
|
| 14.
|
Dinman, J. D.,
M. J. Ruiz-Echevarria,
K. Czaplinski, and S. W. Peltz.
1997.
Peptidyl transferase inhibitors have antiviral properties by altering programmed 1 ribosomal frameshifting efficiencies: development of model systems.
Proc. Natl. Acad. Sci. USA
94:6606-6611[Abstract/Free Full Text].
|
| 15.
|
Dinman, J. D., and R. B. Wickner.
1992.
Ribosomal frameshifting efficiency and Gag/Gag-Pol ratio are critical for yeast M1 double-stranded RNA virus propagation.
J. Virol.
66:3669-3676[Abstract/Free Full Text].
|
| 16.
|
Dinman, J. D., and R. B. Wickner.
1994.
Translational maintenance of frame: mutants of Saccharomyces cerevisiae with altered 1 ribosomal frameshifting efficiencies.
Genetics
136:75-86[Abstract].
|
| 17.
|
Dinman, J. D., and R. B. Wickner.
1995.
5S rRNA is involved in fidelity of translational reading frame.
Genetics
141:95-105[Abstract].
|
| 18.
|
Donahue, T. F., and A. M. Cigan.
1988.
Genetic selection for mutations that reduce or abolish ribosomal recognition of the HIS4 translational initiator region.
Mol. Cell. Biol.
8:2955-2963[Abstract/Free Full Text].
|
| 19.
|
Endo, Y.,
K. Tsurugi, and J. M. Lambert.
1988.
The site of action of six different ribosome-inactivating proteins from plants on eukaryotic ribosomes: the RNA N-glycosidase activity of the proteins.
Biochem. Biophys. Res. Commun.
150:1032-1036[Medline].
|
| 20.
|
Farabaugh, P. J.
1995.
Post-transcriptional regulation of transposition by Ty retrotransposons of Saccharomyces cerevisiae.
J. Biol. Chem.
270:10361-10364[Free Full Text].
|
| 21.
|
Fujimura, T., and R. B. Wickner.
1988.
Gene overlap results in a viral protein having an RNA binding domain and a major coat protein domain.
Cell
55:663-671[Medline].
|
| 22.
|
Gafner, J.,
E. M. De Robertis, and P. Phillippsen.
1983.
Delta sequences in the 5' non-coding region of yeast tRNA genes.
EMBO J.
2:583-591[Medline].
|
| 23.
|
Gallie, D. R.,
J. N. Feder,
R. T. Schimke, and V. Walbot.
1991.
Post-transcriptional regulation in higher eukaryotes: the role of the reporter gene in controlling expression.
Mol. Gen. Genet.
288:258-265.
|
| 24.
|
Gesteland, R. F., and J. F. Atkins.
1996.
Recoding: dynamic reprogramming of translation.
Annu. Rev. Biochem.
65:741-768[Medline].
|
| 25.
|
Hagan, K. W.,
M. J. Ruiz-Echevarria,
Y. Quan, and S. W. Peltz.
1995.
Characterization of cis-acting sequences and decay intermediates involved in nonsense-mediated mRNA turnover.
Mol. Cell. Biol.
15:809-823[Abstract].
|
| 26.
|
Hartley, M. R.,
G. Legname,
R. Osborn,
Z. Chen, and J. M. Lord.
1991.
Single-chain ribosome inactivating proteins from plants depurinate Escherichia coli 23S ribosomal RNA.
FEBS Lett.
290:65-68[Medline].
|
| 27.
|
Hershey, J. W. B.
1991.
Translational control in mammalian cells.
Annu. Rev. Biochem.
60:717-755[Medline].
|
| 28.
|
Hur, Y.,
D.-J. Hwang,
O. Zoubenko,
C. Coetzer,
R. M. Uckun, and N. E. Tumer.
1995.
Isolation and characterization of pokeweed antiviral protein mutations in Saccharomyces cerevisiae: identification of residues important for toxicity.
Proc. Natl. Acad. Sci. USA
92:8448-8452[Abstract/Free Full Text].
|
| 29.
|
Icho, T., and R. B. Wickner.
1989.
The double-stranded RNA genome of yeast virus L-A encodes its own putative RNA polymerase by fusing two open reading frames.
J. Biol. Chem.
264:6716-6723[Abstract/Free Full Text].
|
| 30.
|
Jacks, T.,
H. D. Madhani,
F. R. Masiraz, and H. E. Varmus.
1988.
Signals for ribosomal frameshifting in the Rous sarcoma virus gag-pol region.
Cell
55:447-458[Medline].
|
| 31.
|
Jacks, T., and H. E. Varmus.
1985.
Expression of the Rous sarcoma virus pol gene by ribosomal frameshifting.
Science
230:1237-1242[Abstract/Free Full Text].
|
| 32.
|
Kawakami, K.,
S. Paned,
B. Faioa,
D. P. Moore,
J. D. Boeke,
P. J. Farabaugh,
J. N. Strathern,
Y. Nakamura, and D. J. Garfinkel.
1993.
A rare tRNA-Arg(CCU) that regulates Ty1 element ribosomal frameshifting is essential for Ty1 retrotransposition in Saccharomyces cerevisiae.
Genetics
135:309-320[Abstract].
|
| 33.
|
Kiledjian, M., and T. Kadesch.
1991.
Post-transcriptional regulation of the human liver/bone/kidney alkaline phosphatase gene.
J. Biol. Chem.
266:4207-4213[Abstract/Free Full Text].
|
| 34.
|
Montanaro, L.,
S. Sperti,
A. Mattioli,
G. Testoni, and F. Stirpe.
1975.
Inhibition by ricin of protein synthesis in vitro. Inhibition of the binding of elongation factor 2 and of adenosine diphosphate-ribosylated elongation factor 2 to ribosomes.
Biochem. J.
146:127-131[Medline].
|
| 35.
|
Morikawa, S., and D. H. L. Bishop.
1992.
Identification and analysis of the gag-pol ribosomal frameshift site of feline immunodeficiency virus.
Virology
186:389-397[Medline].
|
| 36.
|
Osborn, R. W., and M. R. Hartley.
1990.
Dual effects of the ricin A chain on protein synthesis in rabbit reticulocyte lysate. Inhibition of initiation and translocation.
Eur. J. Biochem.
193:401-407[Medline].
|
| 37.
|
Somogyi, P.,
A. J. Jenner,
I. A. Brierley, and S. C. Inglis.
1993.
Ribosomal pausing during translation of an RNA pseudoknot.
Mol. Cell. Biol.
13:6931-6940[Abstract/Free Full Text].
|
| 38.
|
Stirpe, F.,
S. Bailey,
S. P. Miller, and J. W. Bodley.
1988.
Modification of ribosomal RNA by ribosome-inactivating proteins from plants.
Nucleic Acids Res.
16:1349-1357[Abstract/Free Full Text].
|
| 39.
|
Stocklein, W., and W. Piepersberg.
1980.
Altered ribosomal protein L29 in a cycloheximide-resistant strain of S. cerevisiae.
Curr. Genet.
1:177-183.
|
| 40.
|
TenDam, E.,
K. Pleij, and D. Draper.
1992.
Structural and functional aspects of RNA pseudoknots.
Biochemistry
31:11665-11676[Medline].
|
| 41.
|
Tomlinson, J. A.,
V. M. Walker,
T. H. Flewett, and G. R. Barclay.
1974.
The inhibition of infection by cucumber mosaic virus and influenza virus by extracts from Phytolacca americana.
J. Gen. Virol.
22:225-232[Abstract/Free Full Text].
|
| 42.
|
Tu, C.,
T.-H. Tzeng, and J. A. Bruenn.
1992.
Ribosomal movement impeded at a pseudoknot required for ribosomal frameshifting.
Proc. Natl. Acad. Sci. USA
89:8636-8640[Abstract/Free Full Text].
|
| 43.
|
Tumer, N. E.,
D.-J. Hwang, and M. Bonness.
1997.
C-terminal deletion mutant of pokeweed antiviral protein inhibits viral infection but does not depurinate host ribosomes.
Proc. Natl. Acad. Sci. USA
94:3866-3871[Abstract/Free Full Text].
|
| 44.
|
Ussery, M. A.,
J. D. Irvin, and B. Hardesty.
1977.
Inhibition of poliovirus replication by a plant antiviral peptide.
Ann. N. Y. Acad. Sci.
284:431-440.
|
| 45.
|
Wickner, R. B.
1996.
Double-stranded RNA viruses of Saccharomyces cerevisiae.
Microbiol. Rev.
60:250-265[Free Full Text].
|
| 46.
|
Xu, J., and J. D. Boeke.
1990.
Host genes that influence transposition in yeast: the abundance of a rare tRNA regulates Ty1 transposition frequency.
Proc. Natl. Acad. Sci. USA
87:8360-8364[Abstract/Free Full Text].
|
| 47.
|
Zarling, J. M.,
P. A. Moran,
O. Haffar,
J. Sias,
D. D. Richman,
C. A. Spina,
D. E. Myers,
V. Kuelbeck,
J. A. Ledbetter, and F. M. Uckun.
1990.
Inhibition of HIV replication by pokeweed antiviral protein targeted to CD4+ cells by monoclonal antibodies.
Nature
347:92-95[Medline].
|
J Virol, February 1998, p. 1036-1042, Vol. 72, No. 2
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Parikh, B. A., Tortora, A., Li, X.-P., Tumer, N. E.
(2008). Ricin Inhibits Activation of the Unfolded Protein Response by Preventing Splicing of the HAC1 mRNA. J. Biol. Chem.
283: 6145-6153
[Abstract]
[Full Text]
-
Li, X.-P., Baricevic, M., Saidasan, H., Tumer, N. E.
(2007). Ribosome Depurination Is Not Sufficient for Ricin-Mediated Cell Death in Saccharomyces cerevisiae. Infect. Immun.
75: 417-428
[Abstract]
[Full Text]
-
Mansouri, S., Nourollahzadeh, E., Hudak, K. A.
(2006). Pokeweed antiviral protein depurinates the sarcin/ricin loop of the rRNA prior to binding of aminoacyl-tRNA to the ribosomal A-site. RNA
12: 1683-1692
[Abstract]
[Full Text]
-
LEGER, M., SIDANI, S., BRAKIER-GINGRAS, L.
(2004). A reassessment of the response of the bacterial ribosome to the frameshift stimulatory signal of the human immunodeficiency virus type 1. RNA
10: 1225-1235
[Abstract]
[Full Text]
-
MESKAUSKAS, A., HARGER, J. W., MULDOON JACOBS, K. L., DINMAN, J. D.
(2003). Decreased peptidyltransferase activity correlates with increased programmed -1 ribosomal frameshifting and viral maintenance defects in the yeast Saccharomyces cerevisiae. RNA
9: 982-992
[Abstract]
[Full Text]
-
Meskauskas, A., Baxter, J. L., Carr, E. A., Yasenchak, J., Gallagher, J. E. G., Baserga, S. J., Dinman, J. D.
(2003). Delayed rRNA Processing Results in Significant Ribosome Biogenesis and Functional Defects. Mol. Cell. Biol.
23: 1602-1613
[Abstract]
[Full Text]
-
Parikh, B. A., Coetzer, C., Tumer, N. E.
(2002). Pokeweed Antiviral Protein Regulates the Stability of Its Own mRNA by a Mechanism That Requires Depurination but Can Be Separated from Depurination of the alpha -Sarcin/Ricin Loop of rRNA. J. Biol. Chem.
277: 41428-41437
[Abstract]
[Full Text]
-
Lawler, J. F. Jr., Haeusser, D. P., Dull, A., Boeke, J. D., Keeney, J. B.
(2002). Ty1 Defect in Proteolysis at High Temperature. J. Virol.
76: 4233-4240
[Abstract]
[Full Text]
-
Lawler, J. F. Jr., Merkulov, G. V., Boeke, J. D.
(2002). A Nucleocapsid Functionality Contained within the Amino Terminus of the Ty1 Protease That Is Distinct and Separable from Proteolytic Activity. J. Virol.
76: 346-354
[Abstract]
[Full Text]
-
Li, L., Wang, A. L., Wang, C. C.
(2001). Structural Analysis of the -1 Ribosomal Frameshift Elements in Giardiavirus mRNA. J. Virol.
75: 10612-10622
[Abstract]
[Full Text]
-
Holton, N. J., Goodwin, T. J. D., Butler, M. I., Poulter, R. T. M.
(2001). An active retrotransposon in Candida albicans. Nucleic Acids Res
29: 4014-4024
[Abstract]
[Full Text]
-
Kim, Y.-G., Maas, S., Rich, A.
(2001). Comparative mutational analysis of cis-acting RNA signals for translational frameshifting in HIV-1 and HTLV-2. Nucleic Acids Res
29: 1125-1131
[Abstract]
[Full Text]
-
BRIERLEY, I., PENNELL, S.
(2001). Structure and Function of the Stimulatory RNAs Involved in Programmed Eukaryotic -1 Ribosomal Frameshifting. Cold Spring Harb Symp Quant Biol
66: 233-248
[Abstract]
-
Uckun, F. M., Bellomy, K., O'Neill, K., Messinger, Y., Johnson, T., Chen, C.-L.
(1999). Toxicity, Biological Activity, and Pharmacokinetics of TXU (Anti-CD7)-Pokeweed Antiviral Protein in Chimpanzees and Adult Patients Infected with Human Immunodeficiency Virus. J. Pharmacol. Exp. Ther.
291: 1301-1307
[Abstract]
[Full Text]
-
Hammell, A. B., Taylor, R. C., Peltz, S. W., Dinman, J. D.
(1999). Identification of Putative Programmed -1 Ribosomal Frameshift Signals in Large DNA Databases. Genome Res
9: 417-427
[Abstract]
[Full Text]
-
Hudak, K. A., Dinman, J. D., Tumer, N. E.
(1999). Pokeweed Antiviral Protein Accesses Ribosomes by Binding to L3. J. Biol. Chem.
274: 3859-3864
[Abstract]
[Full Text]
-
Peltz, S. W., Hammell, A. B., Cui, Y., Yasenchak, J., Puljanowski, L., Dinman, J. D.
(1999). Ribosomal Protein L3 Mutants Alter Translational Fidelity and Promote Rapid Loss of the Yeast Killer Virus. Mol. Cell. Biol.
19: 384-391
[Abstract]
[Full Text]
-
Edskes, H. K., Ohtake, Y., Wickner, R. B.
(1998). Mak21p of Saccharomyces cerevisiae, a Homolog of Human CAATT-binding Protein, Is Essential for 60 S Ribosomal Subunit Biogenesis. J. Biol. Chem.
273: 28912-28920
[Abstract]
[Full Text]