Previous Article | Next Article 
Journal of Virology, December 1998, p. 9897-9905, Vol. 72, No. 12
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Formation and Amplification of a Novel Tombusvirus
Defective RNA Which Lacks the 5' Nontranslated Region of the
Viral Genome
Baodong
Wu and
K. Andrew
White*
Department of Biology, York University,
Toronto, Ontario, Canada M3J 1P3
Received 8 May 1998/Accepted 11 September 1998
 |
ABSTRACT |
Defective interfering (DI) RNAs of tomato bushy stunt virus (TBSV)
are small, subgenomic, helper-dependent replicons that are believed to
be generated primarily by aberrant events during replication of the
plus-sense RNA genome. Prototypical TBSV DI RNAs contain four
noncontiguous segments (regions I through IV) derived from the 5'
nontranslated region (NTR) (I), an internal section (II), and the
3'-terminal portion (III and IV) of the viral genome. We have studied
the formation of these molecules by using engineered precursor DI RNA
transcripts and report here the consistent accumulation of a novel
defective RNA species, designated RNA B. Northern blot, primer
extension, and sequence analyses indicated that, unlike prototypical DI
RNAs, RNA B lacks region I. In vitro transcripts corresponding to the
region II-III-IV structure of RNA B were amplified when coinoculated
with helper, indicating that the 5' NTR of the genome does not harbor
cis-acting replication elements essential for viral RNA
replication. Region I is, however, important for DI RNA fitness, since
molecules lacking it accumulated to significantly lower levels
(~10-fold reduction). Analysis of the minus-strand sequence of region
I led to the identification of an RNA undecamer sequence, arranged in
tandem, at its very 3' terminus. Additional variants of the undecamer
motif were also identified at internal positions in region I and in the
negative strands of regions II, III, and IV. Features of the undecamer motif, the consensus of which is (
)3'-CCCAAAGAGAG, are
consistent with a role as a cis-acting replication element.
It is proposed that the ability of RNA B to be amplified is due, in
part, to compensatory effects of a strategically positioned undecamer
motif in region II. Possible replicase-mediated mechanisms for the
generation of this novel viral RNA are also presented.
| |
INTRODUCTION |
Genome replication for plus-sense
RNA viruses involves the synthesis of a complementary minus-sense RNA
which serves as a template for the production of additional copies of
the genome. This two-step process is generally asymmetrical, showing
differences in both the kinetics and absolute levels of accumulation of
plus- and minus-sense strands (14, 22). Promoter elements
have been identified in both the 5'- and 3'-terminal regions of
plus-sense RNA viral genomes (5, 7, 9, 21, 27, 37), and RNA signals involved in the synthesis of minus strands have been studied extensively (5, 9, 21, 36, 41). Much less is known about the
mechanisms of plus-strand synthesis or the cis elements necessary for this process to occur. However, various mutations in the
5' nontranslated regions (NTRs) or 5'-terminal regions of different
viral RNAs lead to defects in replication specific for plus-strand
synthesis (1, 8, 16, 30).
Tomato bushy stunt virus (TBSV), a small plus-sense RNA virus, is the
prototype member of the genus Tombusvirus in the family Tombusviridae. Its 4.8-kb genome is neither capped nor
polyadenylated, and it encodes five functional open reading frames
(ORFs) (12). The 5'-proximal ORFs encode the viral
components (p33, p92) required for genome replication (Fig.
1A) (26, 35), and these
products are translated directly from the genome. The ORFs located more 3' in the genome encode the coat protein (p41) and movement proteins (p19, p22) (34) that are translated from two subgenomic (sg) mRNAs (Fig. 1A) (12). In addition to legitimate sg mRNAs,
defective interfering (DI) RNAs have been identified in TBSV infections (13). These molecules maintain cis-acting
promoter elements which make them useful for studies on viral RNA
replication (4, 10, 33a). For TBSV and other members of the
genus Tombusvirus, prototypical DI RNAs contain four
noncontiguous segments (regions I through IV) derived from the 5' NTR
(I), an internal segment within the ORF encoding p92 (II), and
3'-terminal segments (III and IV) of the viral genome (Fig. 1A)
(2, 17, 32). Previous studies on prototypical tombusvirus DI
RNAs suggested that regions I, II, and IV are essential for viability
(4, 10). The requirement for region III was less clear; for
cymbidium ringspot tombusvirus, this region appeared to be essential
for DI RNA accumulation (10), whereas for TBSV and cucumber
necrosis tombusvirus (CNV) it was dispensable (4).
View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Schematic representation of the TBSV RNA genome and
various defective viral RNAs. The wild-type TBSV genome is shown at the
top as a thick horizontal line, with coding regions depicted as open
boxes and the approximate molecular weights (in thousands) of the
encoded proteins indicated (12). The regions corresponding
to the two sg mRNAs are shown as arrows above the genome. Below, a
prototypical DI RNA and various precursor DI RNAs are depicted, with
shaded boxes representing regions of the genome retained in these
molecules and thin lines corresponding to segments which are absent.
DI-72 is composed of four noncontiguous regions (I through IV), the
lengths of which are indicated (in nucleotides) (43).
Various artificially constructed precursor DI RNAs are shown below
DI-72, and the positions of engineered XbaI (X) and
PstI (P) sites in DI-82XP are indicated. The
rightward-pointing arrowheads in LA1 and its derivatives represent the
inserted 191-nt segment, which is complementary to an existing upstream
sequence (leftward-pointing arrowhead). (B) Proposed replicase-mediated
model for generation of prototypical DI RNAs from precursor LA1
containing complementary segments (note: the stem-loop structure
depicted is not to scale) (45). During minus-strand
synthesis (broken arrow) the replicase is able to traverse the base of
the strong secondary structure and resume copying on the other side.
Synthesis of a complementary plus strand (solid arrow) generates a
prototypical DI RNA.
|
|
DI RNAs are thought to be generated by aberrant RNA
synthesis by the viral RNA-dependent RNA polymerase (RDRP),
resulting in the introduction of deletions into nascent RNA strands
(19, 28). In TBSV, this process has been studied in some
detail by analyzing precursor DI RNAs in which the segment normally
absent between regions I and II in a prototypical DI RNA was
reintroduced (Fig. 1A) (43, 45). When protoplasts are
coinoculated with helper genome and a precursor DI RNA, prototypical DI
RNAs are generated from the precursor via internal deletion of the
reintroduced segment. This system was used previously to show that
complementary segments in precursors can facilitate the targeting of
junction sites to the base of the secondary structure that is predicted to form (Fig. 1B) (45).
In the present study, we have identified and characterized a novel TBSV
defective RNA species, RNA B, which was generated from various
precursor DI RNAs. The absence of region I in these molecules indicates
that, despite its invariable presence in prototypical DI RNAs, the 5'
NTR is not essential for viral RNA replication. An RNA sequence
undecamer motif, present in multiple copies in region I, was also
identified in regions II, III, and IV. Possible roles for these
elements in the context of prototypical DI RNAs and RNA B are
discussed, and likely mechanisms for the generation of RNA B are described.
| |
MATERIALS AND METHODS |
Viral and DI RNA constructs.
Plasmid construct K2/M5,
containing cDNA corresponding to the full-length viral genome of CNV,
has been described previously (33). DI-72XP, DI-82XP, and
LA1 [previously termed DI-82XP-191()] have been described
previously (43, 45). The following oligonucleotides were
used in this study (underlined residues correspond to nonviral sequence, whereas those not underlined correspond to viral sequence): P9, 5'-GGCGGCCCGCATGCCCGGGCTGCATTTCTGCAATGTTCC
(TBSV, minus sense, 4754 to 4776); P45,
5'-GGCCTCTAGAGAGAATGATTTGGCCTAAGAAAGAG (TBSV, plus sense, 180 to 204); P46,
5'-GGCCGGCCGGCTAGCCAGCACAATCAGTTTTGAGTAATTC (TBSV, minus sense, 346 to 370); PF7,
5'-GGCGGAGCTCTAATACGACTCACTATAGGAAATTCTCCAGGATTTC TC
(TBSV, plus sense, 1 to 20); PB1,
5'-ACTGTCCTAGCTAGCCCGGTTGCGAAATCACCCA (TBSV,
minus sense, 211 to 245); PB2,
5'-TCATGTATCGCTAGCCCACACGACACACCAATTG (TBSV, minus sense, 262 to 295); PB19,
5'-CCAAAGGCTCCTTTGGTAGGTTGTGGAGTG (TBSV, minus
sense, 1305 to 1334); PB20,
5'-CGCTTGTTTGTTGGAAGTTACAATTTATCC (TBSV, minus sense,
134 to 163); PB21, 5'-GAACTAGGTCGAGAAATCCTGGAGAATTTC (TBSV,
minus sense, 1 to 30); PB22, 5'-AACCTTCTCACAAACCGCTTTCCTGAACGG (TBSV, minus sense, 1345 to 1374); PB23,
5' - CGGCGGAGCTC TAATACGAC TCAC TATAGAGAATGAT T TGGCC TAAGAAAGAG
(TBSV, plus sense, 180 to 204); PB24,
5'-GGCTCAACCACCAGACAATCTG (TBSV, minus sense, 701 to 722);
PB25,
5'-CGGCGGAGCTCTAATACGACTCACTATAGAAGAAACGGGAAGCTCGCTC (TBSV, plus
sense, 1285 to 1303); PB26,
5'-CGGCGGAGCTCTAATACGACTCACTATAGAAACGGGAAGCTCGCTCGC (TBSV, plus sense, 1286 to 1305); PB27,
5'-CGGCGGAGCTCTAATACGACTCACTATAGAACCGGGAAGCTCGCTCGC (TBSV, plus sense, 1286 to 1305, [1289, A to C]); PB31,
5'-CGGCGGAGCTCTAATACGACTCACTATAGCCAAATGGGAATGGTTCATG (TBSV,
plus sense, 370 to 390).
Plasmid construction.
Viral constructs were created by a
combination of PCR- and restriction enzyme-based methods. The following
PCR products were generated with the specified oligonucleotide pairs
and templates, respectively: PCR 1, PF7/P46 and LA1; PCR 2, P46/P9 and
LA1; PCR 3, P45/PB1 and DI-82XP; PCR 4, P45/PB2 and DI-82XP; PCR 5, PF7/PB2 and L6(); PCR 6, PB2/P9 and L6(); PCR 7, PF7/PB1 and
L5(); PCR 8, PB1/P9 and L5(). The uses of these products are
described below.
To construct L6(
), the PCR 3 product was digested with
XbaI and
NheI and inserted into the
XbaI site of DI-82XP in the opposite
orientation. To
construct L5(
), the PCR 4 product was digested
with
XbaI
and
NheI and inserted into the
XbaI site of
DI-82XP
in the opposite orientation. To construct L1, a 339-bp fragment
was removed from LA1 by digestion with
NaeI and
StuI, and the
large fragment was isolated from an agarose
gel and self-ligated.
To construct L2, LA1 was digested with
NaeI and
SphI, and the
smaller fragment was
excised and replaced with the
SphI-digested
PCR 2 product.
To construct L3, LA1 was digested with
SacI and
StuI, and the smaller fragment was excised and replaced with
the
SacI-digested PCR 1 product. L7, L9, and L8 and L11,
L13, and
L12 were generated as described for the construction of L1
through
L3 except that L6(
) and L5(
), respectively, were used as
the
recipients of the PCR products. A summary of the structures of
the
resulting viral constructs is provided in Table
1.
LA1
I was generated by PCR amplification of positions 180 to 722 from
DI-82XP by using the oligonucleotide pair PB23/PB24.
Oligonucleotide
PB23 included a
SacI site and a T7 RNA polymerase
promoter.
The product was digested with
SacI and ligated into
SacI/
NaeI-digested LA1. LA1
I
190 was
generated by PCR amplification
of positions 370 to 722 from DI-82XP by
using oligonucleotide
pair PB31/PB24. Oligonucleotide PB31 included a
SacI site and
a T7 RNA polymerase promoter. The product was
digested with
SacI
and ligated into
SacI/
NaeI-digested LA1. DI-82XP
I was generated
by transferring the smaller fragment of
SacI/
NaeI-digested LA1
I
into
SacI/
NaeI-digested DI-82XP.
B1 was generated by PCR amplification of region II through region IV
from DI-82XP by using oligonucleotide pair PB25/P9. Oligonucleotide
PB25 included a
SacI site and a T7 RNA polymerase promoter.
The
PCR product was digested with
SacI/
BstXI and
inserted into
SacI/
BstXI-digested
DI-82XP. B2 was
generated by PCR amplification of region II through
region IV from
DI-82XP by using oligonucleotide PB26 and oligonucleotide
P9.
Oligonucleotide PB26 included a
SacI site and a T7 RNA
polymerase
promoter. The PCR product was digested with
SacI/
BstXI and inserted
into
SacI/
BstXI-digested DI-82XP. The authenticity of
each construct
was verified by restriction endonuclease digestion
analysis and/or
DNA
sequencing.
In vitro transcription.
Viral transcripts were generated in
vitro via transcription of SmaI-linearized template DNAs
with the Ampliscribe T7 RNA polymerase transcription kit (Epicentre
Technologies). Following the transcription reaction, DNA templates were
removed by treatment with DNase I (Epicentre Technologies), and
unincorporated nucleotides were removed via column chromatography with
a Sephadex G-25 spin column (Pharmacia). Ammonium acetate was added to
the flowthrough to a final concentration of 2 M, and the transcripts
were extracted twice with equal volumes of phenol-chloroform-isoamyl
alcohol and then precipitated with ethanol. Subsequently, the
transcripts were quantified spectrophotometrically and an aliquot was
analyzed by agarose gel electrophoresis to verify integrity.
Isolation and inoculation of protoplasts.
Protoplasts were
prepared from 6- to 8-day-old cucumber cotyledons (var. Straight 8) as
described previously (43). Briefly, the lower epidermis of
the cotyledons was peeled off with forceps, and the cotyledons were
digested in 20 ml of an enzyme mix containing 0.25 g of cellulase
(Calbiochem), 0.025 g of pectinase (ICN), and 0.025 g of bovine serum
albumin (ICN) for 6 to 8 h with gentle shaking (60 rpm) in the
dark. The protoplasts were then washed in 10% mannitol and purified by
banding twice on a 20% sucrose cushion. Quantification was carried out
by bright-field microscopy with a hemacytometer. Purified protoplasts
(approximately 4 × 105) were inoculated with 5 µg
of each viral RNA transcript (unless specified otherwise) and were
incubated in a growth chamber under fluorescent lighting at 22°C for
24 h.
Analysis of viral RNAs.
Total nucleic acid was harvested
from protoplasts at 24 h postinoculation by resuspension in 300 µl of a buffer containing 0.2 M NaCl, 20 mM Tris-Cl (pH 8), 2 mM
EDTA, and 1% sodium dodecyl sulfate (43). Following two
extractions with phenol-chloroform-isoamyl alcohol, 100 µl of 8 M
NH4 acetate was added to the aqueous phase and the mixture
was precipitated with ethanol. Aliquots of the total nucleic acid
preparation (one-sixth) were separated in 4.5% polyacrylamide gels in
the presence of 8 M urea. Viral RNAs were detected by electrophoretic
transfer to nylon (Hybond-N; Amersham) followed by Northern blot
analysis with 32P-end-labeled oligonucleotides
complementary to various segments of the TBSV genome.
Primer extension of viral RNAs.
Approximately 0.2 pmol of
32P-end-labeled oligonucleotide PB22 was mixed with an
aliquot (one-fourth) of the total nucleic acids extracted from
inoculated protoplasts (4 × 105) or with ~20 ng of
gel-purified RNA B. The mixtures, in a volume of 10 µl, were
incubated at 90°C for 2 min and then transferred to ambient
temperature for 5 min. The extension reaction was carried out in a
final volume of 20 µl which included 300 U of Superscript II reverse
transcriptase (Gibco-BRL), a 1× concentration of the buffer provided
by the manufacturer, and a 0.5 mM concentration of each of the four
deoxyribonucleotides. The mixture was incubated at 45°C for 40 min,
after which the samples were extracted with phenol-chloroform-isoamyl
alcohol and then precipitated with ethanol. The recovered pellets were
resuspended in 20 µl of double-distilled H2O, and a
2-µl aliquot was mixed with 2 µl of formamide loading dye and
separated in an 8% polyacrylamide gel in the presence of 8 M urea. A
sequencing ladder was generated with oligonucleotide PB22 and LA1
template, and the products were separated along with those of the
primer extension reactions.
Structural analysis of viral RNA transcripts.
Various viral
RNA transcripts (5 µg) were digested with 0.1, 1, or 10 units of
RNase T1 (Calbiochem) in a final volume of 15 µl of H2O
(containing residual NH4 acetate from prior ethanol precipitation) at 37°C for 1.5 h. The products of the reaction were then separated by neutral 2% agarose gel electrophoresis and
visualized by staining with ethidium bromide. cDNAs corresponding to
RNA B were generated from gel-purified RNA B and amplified by PCR as
described previously (43) or by using a 5' RACE (rapid amplification of cDNA ends) kit (Life Technologies). The products were
subsequently cloned and sequenced.
| |
RESULTS |
Accumulation of novel defective viral RNAs from a precursor DI
RNA.
Previously, analysis of DI RNA formation with a system
utilizing precursor molecules indicated that complementary segments in
precursor LA1 (Fig. 1A) can target junction sites to the base of the
secondary structure predicted to form between the two segments (Fig.
1B) (45). For these studies, a heterologous genome
(CNV-K2/M5) derived from the closely related tombusvirus CNV was used
as helper to enable confirmation of the derivation of smaller
prototypical DI RNAs (i.e., from the precursor versus from the helper).
In this system, accumulation of prototypical DI RNAs was not observed in the initial protoplast infection, but such molecules were detected following a single passage (43, 45). In the present
study, we have focused our analyses on small viral RNAs which
accumulate during initial infections with helper and precursor LA1.
In Fig.
2A, the coinoculation of
protoplasts with CNV-K2/M5 and precursor DI-82XP (Fig.
2A, lane 3)
resulted in very efficient
amplification of the precursor in addition
to authentic genomic
and subgenomic species (compare Fig.
2A lane 3 with lane 2); however,
no readily detectable smaller viral RNAs were
observed (Fig.
2A,
lane 3), consistent with previous results (
43,
45). Inoculations
of DI-82XP alone, or individual inoculations of
any other precursor
DI RNA tested in this study, resulted in no
detectable viral RNA
accumulation (data not shown). Precursor LA1 is a
derivative of
DI-82XP in which a 191-nucleotide (nt) segment, which is
complementary
to an upstream region, was inserted just 5' to region II
(Fig.
1A) (
45). The complementary segments in this precursor
thus
have the potential to participate in a long-distance base-pairing
interaction (as depicted in Fig.
1B). When coinoculated with helper,
the LA1 precursor did not accumulate significantly, but a prominent
low-molecular-weight viral RNA species, designated RNA B, and
a
less-abundant smaller species, designated RNA B', were detected
(Fig.
2B, lanes 5 and 6). The electrophoretic mobilities of these
RNAs were
significantly greater than that anticipated for prototypical
DI RNAs
(Fig.
2B, asterisk). To ensure that these small products
were not
derived from less-than-full-length precursor transcripts
generated
during the in vitro transcription reaction, full-length
LA1 transcripts
were gel purified. Coinoculation of gel-purified
LA1 with helper also
led to efficient accumulation of RNA B (Fig.
2B, lanes 3 and 4).
View larger version (56K):
[in this window]
[in a new window]
|
FIG. 2.
Northern blot analysis of progeny viral RNAs isolated
from cucumber protoplasts inoculated with various combinations of viral
RNA transcripts. (A) Coinoculation of precursor DI-82XP and CNV-K2/M5
helper transcripts. (B) Coinoculations of precursor LA1 (2 µg [lane
5] or 5 µg [lane 6]), gel-purified LA1 (GP-LA1) (2 µg [lane 3]
or 5 µg [lane 4]), and CNV-K2/M5 helper transcripts. The RNA
transcripts used in the inoculations are indicated at the top, and the
positions of the genome RNA (gRNA), sg mRNAs (sgRNA1 and sgRNA2), and
defective RNAs (RNAs B and B') are shown on the left. The predicted
position for prototypical DI RNAs is indicated with an asterisk. Total
nucleic acids were isolated from approximately 4 × 105 protoplasts after a 24-h incubation and were separated
in a 4.5% polyacrylamide gel in the presence of 8 M urea, transferred
to a nylon membrane, and hybridized with a 32P-end-labeled
oligonucleotide probe (P9) complementary to the 3'-terminal 23 nt of
the TBSV and CNV genomes.
|
|
Accumulation of RNA B is facilitated by the inserted segment and
sequence complementarity.
Region I, which corresponds to the 5'
NTR of the genome and is present in all prototypical DI RNAs, has been
implicated in viral RNA replication (4, 10). To determine
whether region I in precursor LA1 was required for the generation of
RNA B, transcripts lacking region I, LA1I (Fig. 1A), were
coinoculated with helper into protoplasts. Despite the absence of this
region, RNA B accumulated efficiently (Fig.
3A, lane 5). To test whether the
potential base-pairing activity of LA1 was a contributing factor in the
accumulation of RNA B, a derivative of LA1, LA1I191, which lacked
both region I and the upstream segment complementary to the 191-nt
insertion, was constructed (Fig. 1A). Coinoculation of LA1I191
and CNV-K2/M5 consistently led to decreased levels of accumulation of
RNA B and increased levels of RNA B' (Fig. 3A, lane 6). Interestingly, this coinoculation also resulted in efficient accumulation of an
additional larger RNA product, designated RNA BX.
View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
(A) Northern blot analysis of progeny viral RNAs
isolated from cucumber protoplasts inoculated with CNV-K2/M5 helper and
various precursor DI RNA transcripts. The RNA transcripts used in the
inoculations are shown at the top, and the positions of the genome RNA
(gRNA), sg mRNAs (sgRNA1 and sgRNA2), and defective RNAs (RNAs B, B',
and BX) are indicated. Total nucleic acids were isolated and analyzed
as described in the legend to Fig. 2. (B) Analysis of products
generated from digestion of RNA transcripts of various precursor DI
RNAs with RNase T1. The identity of the precursor analyzed is shown at
the top, with the total number of units of RNase T1 present in each
reaction indicated. HpaII-digested pUC19 is separated in
lane M, and the sizes (in base pairs) of relevant fragments are
indicated to the left. At right, an asterisk denotes the positions of
full-length precursor transcripts and an arrowhead indicates products
resistant to digestion. The samples were separated in a nondenaturing
2% agarose gel and then stained with ethidium bromide.
|
|
Two differences between DI-82XP and LA1 are evident. First, DI-82XP
does not contain the 191-nt insertion present in LA1.
Secondly, DI-82XP
is amplifiable and accumulates efficiently,
whereas LA1 does not. It is
possible that one or both of these
differences contribute to the
absence of detectable RNA B in DI-82XP
and helper coinfections (Fig.
2A, lane 3). As suggested by the
results from the LA1
I
191 and
helper coinfection, the inserted
segment, which is absent in DI-82XP,
may possess important properties
which allow the generation and/or
accumulation of RNA B. Alternatively,
or additionally, the poorly
amplifying LA1 may compete weakly
for
trans-acting
replication factors, and this may in turn allow
efficient accumulation
of other less-competitive defective RNA
species (e.g., RNA B). Thus,
the lack of RNA B accumulation in
DI-82XP and helper coinoculations may
be the consequence of competitive
suppression by the efficiently
replicating precursor. To address
this possibility, an
accumulation-defective derivative of DI-82XP,
DI-82XP
I (Fig.
1A),
was tested. Only very low levels of RNA B-
and B'-sized species were
detected in coinoculations with CNV-M2/K5
(Fig.
3A, lane
3).
Our results suggest that sequence complementarity facilitates
accumulation of RNA B. The ability of LA1 or LA1
I to form a
stable stem structure was confirmed by subjecting in vitro-generated
transcripts of these precursors to digestion with
single-strand-specific
RNase T1. For both LA1 and LA1
I, an
approximately 191-bp nuclease-resistant
fragment was
generated, which was not observed for digestion of
LA1
I
191, which
lacks the upstream complementary segment (Fig.
3B). To test for
possible limitations of RNA B accumulation due
to the length
and/or spacing of the complementary sequences, numerous
derivatives of
LA1 in which these structural features were varied
were constructed
(Table
1). Complementary segments of 191, 101,
and 45 nt were tested in
combination with various lengths of intervening
sequences. In all
cases, coinoculation of the various precursor
DI RNAs with the helper
led to efficient accumulation of RNA B
but, interestingly, no
significant accumulation of any precursor
was observed (Fig.
4). This result indicates a significant
degree
of flexibility in the process leading to RNA B formation and/or
amplification with respect to the structural parameters tested.
The
ability of selected precursors, with complementary segments
of 101 or
45 nt, to form the predicted secondary structures was
confirmed via
digestion with RNase T1 (data not shown).
View larger version (65K):
[in this window]
[in a new window]
|
FIG. 4.
Northern blot analysis of progeny viral RNAs isolated
from cucumber protoplasts coinoculated with helper and precursor DI RNA
transcripts containing different-sized complementary segments and
intervening sequences. See Table 1 for additional information on the
structures of the precursors. The RNA transcripts used in the
inoculations are indicated at the top, and the positions of the genome
RNA (gRNA), sg mRNAs (sgRNA1 and sgRNA2), and RNA B are shown on the
left. Total nucleic acids were isolated and analyzed as described in
the legend to Fig. 2.
|
|
Analysis of RNA B structure.
The accumulation of RNA B only in
coinoculations which included precursor DI RNAs indicated that its
production was dependent on the precursors and that the small RNA
species was likely derived from them. Northern blot analyses with a 3'
terminus-specific probe established that RNA B contained a 3' terminus
analogous to that of LA1 (Fig. 2 through 4). To determine further the
general structure of RNA B, oligonucleotides complementary to various regions of LA1 were used as probes for Northern blot analyses (Fig.
5A). Oligonucleotides PB21 and PB20,
complementary to 5' and 3' segments in region I, respectively, did not
hybridize to RNA B but did hybridize efficiently to in vitro-generated
transcripts of LA1 (Fig. 5B). Oligonucleotide PB19, complementary to a
5' section in region II, but not oligonucleotide P45, complementary to
a 3' segment of the 191-nt insert, hybridized to RNA B (Fig. 5B). These
results suggest that RNA B does not contain region I and possesses a 5'
terminus which maps between the sites complementary to oligonucleotides
PB19 and P45.
View larger version (38K):
[in this window]
[in a new window]
|
FIG. 5.
Analysis of the structure of RNA B. (A) Schematic
representation of LA1, with the relative positions of various
complementary oligodeoxyribonucleotides indicated (note: the stem-loop
structure depicted is not to scale). (B) Northern blot analysis of
progeny viral RNAs isolated from cucumber protoplasts coinoculated with
helper and precursor LA1. The RNA transcripts used in the inoculations
are indicated at the top, except for lanes labeled LA1, where ~70 ng
of the LA1 transcript was analyzed in the gels. The positions of the
LA1 transcripts and RNA B are shown on the left, and the
oligonucleotide probes used for detection are indicated at the bottom.
Total nucleic acids were isolated and analyzed as described in the
legend to Fig. 2 except that blots were hybridized with
32P-end-labeled oligonucleotide probes complementary to
various segments of LA1.
|
|
To more precisely map the 5' terminus of RNA B, primer extension
analysis was performed. Extension of a
32P-end-labeled
primer (PB22) with total nucleic acids prepared
from protoplasts
coinoculated with helper and LA1, or gel-purified
RNA B, resulted in
two major products (Fig.
6A). The
predicted
termini of the primary products mapped within four residues
of
each other and indicated 5'-terminal residues containing the base
guanine (Fig.
6). The positions of these termini were between
the
binding sites of PB19 and P45 and are thus consistent with
the results
obtained from Northern blot analysis (Fig.
5). Taken
together, these
data suggest that RNA B represents a set of structurally
related
molecules which contain somewhat heterogeneous 5' termini
but which are
3' coterminal with LA1. Cloning and sequencing of
RNA B, via reverse
transcription-PCR and 5' RACE, confirmed the
predicted region II-III-IV
structure and mapped the 5' termini,
respectively (data not shown).
View larger version (22K):
[in this window]
[in a new window]
|
FIG. 6.
Mapping of the 5' termini of RNA B. (A) Primer extension
analysis of RNA B. The sources of the nucleic acids which were analyzed
by primer extension are identified above lanes 5 to 8, and the
corresponding sequencing ladder of LA1 is identified above lanes 1 to
4. Major termination sites, along with their corresponding positions in
the plus-strand sequence, are indicated on the right by arrowheads.
Products were separated in an 8% polyacrylamide gel in the presence of
8 M urea. (B) Schematic representation of an internal segment of LA1
showing the relative positions of the mapped 5' termini of RNA B. The
arrows below the sequence indicate the predicted 5' termini, whereas
the arrow above the sequence defines the 5' terminus of region II.
Sequence corresponding to the 3'-terminal region of the inserted 191-nt
segment is in boldface type, and the engineered XbaI site is
italicized. The relative position of oligonucleotide PB22, used for
primer extension analysis, is indicated.
|
|
Replication and accumulation kinetics of RNA B.
Our results
indicate that RNA B is generated from different precursors. Various
mechanisms might account for its generation from these molecules. For
example, its formation may be replicase mediated, whereby a minus
strand corresponding to LA1 serves as the template for its production.
Alternatively, RNA B may be generated directly from the input LA1
transcript via endoribonucleolytic activity. To determine if the
accumulating RNA B represented a stable degradation product of the
input precursor DI RNAs, a time course experiment was performed. In
coinoculations with helper and either LA1 or LA1I, only trace
amounts of the precursors were detected at the zero time point;
however, a clear increase in accumulation of RNA B was observed over
time (Fig. 7A and B). The limited
quantity of precursor detected early in the time course would therefore
be insufficient to generate, via nucleolytic cleavage, the significant
levels of RNA B which accumulated. To address the question of
replicability, transcripts corresponding to the region II-III-IV
structures of the two major RNA B species, RNA B1 and RNA B2 (Fig. 6),
were synthesized. When coinoculated with CNV-K2/M5, both showed
significant increases in levels of accumulation over 24 h (Fig. 7C
and D), confirming their capacities to be trans amplified.
View larger version (60K):
[in this window]
[in a new window]
|
FIG. 7.
Northern blot analysis of progeny viral RNAs showing the
kinetics of accumulation of RNA B. The RNA transcripts used in the
inoculations are indicated at the top, and the positions of the genome
RNA (gRNA), sg mRNAs (sgRNA1 and sgRNA2), and RNA B are shown on the
left. The times after inoculation at which the nucleic acid samples
were isolated are indicated (in hours) above each lane. Total nucleic
acids were isolated and analyzed as described in the legend to Fig.
2.
|
|
| |
DISCUSSION |
Genome replication is a central process in the reproductive cycle
of plus-sense RNA viruses, and RNA structure is a key determinant of
the specificity and efficiency with which viral RDRPs utilize various
templates. By analyzing different amplifiable viral RNAs, it is
possible to gain insight into the structural features of templates that
influence RDRP activity. In this study, we have identified a novel
defective viral RNA species, RNA B, and have characterized its
structure, biological activity, and some of the properties of its
precursors which influence its accumulation. Our results provide clues
to possible mechanisms responsible for generating RNA B and reveal
valuable information on the cis-acting elements involved in
viral RNA replication.
Formation and accumulation of RNA B.
Various properties of the
precursor were analyzed to determine their effects on the accumulation
of RNA B. The results suggest that (i) region I in the LA1 precursor is
not essential for RNA B accumulation, (ii) the 191-nt insert in LA1 and
its derivatives facilitate RNA B accumulation, (iii) the positive
effect of the inserted segment on RNA B accumulation is stimulated
further by the presence of a complementary upstream segment, and (iv)
the absence of the complementary upstream sequence facilitates the accumulation of defective RNA species other than RNA B (which remain to
be characterized).
The inserted 191-nt segment (in the absence of the complementary
upstream sequence) significantly increased RNA B accumulation,
most
likely by facilitating its formation. Possible mechanisms
for its
generation include (i) internal initiation of plus-strand
synthesis on
a minus-strand template, (ii) premature termination
of minus-strand RNA
synthesis, and/or (iii) cleavage of the precursor
RNA. Analysis of the
3' junction site of the inserted segment
revealed partial sequence
identity with the predicted sg mRNA
2 promoter (
15) (Fig.
8A). Since various sg mRNA promoters have
been shown to induce internal initiation of RNA synthesis on
minus-strand
templates (
23,
39,
42), it is possible that
this cryptic
promoter could function in a similar manner, thereby
generating
RNA B. Internal initiation of plus-strand synthesis on
a minus-strand
template has been proposed as the mechanism generating
5'-terminally
truncated forms of alfalfa mosaic virus RNA 3 (
40); however,
sg mRNA promoter-like sequences were not
implicated.
View larger version (30K):
[in this window]
[in a new window]
|
FIG. 8.
(A) Alignment of the predicted sg RNA2 promoter (Psg2)
sequence (15) with the sequence in LA1 corresponding to the
mapped 5' termini of RNA B. The termini mapped for the two major RNA B
species are in boldface type and underlined in the LA1 sequence, and
the initiating nucleotide for sg mRNA2 synthesis (12) is in
boldface type and indicated by an arrow. Identical nucleotides between
Psg2 and LA1 are indicated by asterisks. The coordinates of the 3'-most
residues in the sequences are shown in parentheses to the right and
correspond to the numbering of the TBSV genome (12). (B)
Replicase-mediated mechanism proposed to explain how secondary
structure could facilitate the generation of RNA B from precursor LA1
(note: the stem-loop structure depicted is not to scale). Synthesis of
a minus strand (broken arrow) complementary to LA1 is stalled at the
strong secondary structure. The prematurely terminated minus strand is
then copied to generate RNA B (solid arrow), which is amplified further
via replication. (C) Alignment of selected conserved undecamer
sequences present in the minus strand of DI-72 (Fig. 1), a prototypical
TBSV DI RNA (43). The DI RNA regions from which the
sequences were derived are indicated on the left, and individual
sequences are numbered consecutively. The numbers in parentheses on the
right indicate the coordinates of the 5'-most residues of the sequences
shown and correspond to the numbering of the TBSV genome
(12). Residues in sequences 1 through 16 which conform (see
below) to the undecamer consensus sequence (boxed) are in boldface type
and shaded. The undecamer consensus represents the most prevalent
nucleotides at the respective positions. The sequences shown contain a
minimum of 6 of the 11 consensus residues. For comparison, the
consensus sequence of a carmovirus motif implicated in plus-strand
synthesis is also shown (8). (D) 3'-terminal sequences of
the minus strands of region I and RNAs B1 and B2. The terminal and
adjacent undecamer motifs in the region I sequence are over- and
underlined, respectively, and those in RNAs B1 and B2 are underlined.
The boxes indicate nucleotides in the more 5' undecamer in region I
which are identical to those in RNAs B1 and B2. Terminal RNA B segments
identical to the region I terminus are in boldface type and doubly
underlined. Gaps were introduced into the RNA B sequences to maximize
the alignment of 3'-terminal nucleotides with identical residues in
region I.
|
|
The inserted sequence might, in the absence of the upstream
complementary segment, promote RNA B formation by facilitating
stalling
and/or dissociation of the RDRP during minus-strand synthesis.
However,
no conspicuous sequences and/or structures which might
potentially facilitate such a process were identified. The
production
of RNA B was clearly enhanced when the inserted segment was
accompanied
by a complementary upstream sequence. Previous studies have
provided
evidence that strong secondary structures in RNA templates
can
stall and/or cause the dissociation of an actively copying RDRP
(
11,
20,
24,
45). It is therefore possible that the
facilitatory
effect of the secondary structure involves blocking of
RDRP movement
during minus-strand synthesis (Fig.
8B). This
template-mediated
pausing might in turn promote dissociation and/or
premature termination
of minus-strand synthesis and/or initiation of
plus-strand synthesis.
A mechanism similar to this has been proposed
recently for the
generation of an sg mRNA of red clover necrotic mosaic
virus (
35a);
however, in that case the potentially
obstructive secondary structure
was formed between two viral RNAs
(i.e., in
trans). The positions
of the 5' termini of RNA B
are consistent with replicase obstruction,
as they are located 4 and 7 nt 3' to the base of the secondary
structure. Following its generation,
RNA B might then be amplified
further in a precursor-independent
fashion. Interestingly, formation
of the secondary structure would
sequester the inserted sequence
into a double-stranded form, thereby
limiting its participation
in alternate structures. This suggests that
the mechanisms of
action in the presence or absence of the upstream
complementary
element may be partially or entirely
independent.
It is also possible that initial generation of RNA B involved
ribonuclease cleavage of the precursor. Such a mechanism would
require
that a ribonuclease(s) preferentially acts on LA1 (and
its derivatives)
but not on DI-82XP
I. Although this possibility
cannot be precluded,
we feel that the replicase-mediated mechanisms
suggested are more
likely
applicable.
It has been shown previously that competitive ability plays an
important role in both the observed accumulation levels and
the
evolutionary pathways of DI RNAs (
43,
44). For LA1,
efficient
accumulation of RNA B in the initial infection and its
absence
after a single passage (data not shown) is contrary to that
observed
for prototypical DI RNAs (
43). One explanation for
these reciprocal
accumulation profiles is that RNA B is generated from
LA1 more
efficiently than are prototypical DI RNAs (e.g., the frequency
of stalling at the structure exceeds that of bypassing it). As
a
consequence, RNA B would dominate early (i.e., in the initial
infection) but over time (i.e., following a passage) would be
outcompeted by the more fit prototypical
molecules.
Implications for viral RNA replication.
Our results indicate
that insertion of RNA segments with significant base-pairing potential
into precursor DI RNAs causes a significant decrease in their
viability. Base-paired sections as short as 45 bp, formed by sequences
at distant positions, were able to dramatically reduce the accumulation
of precursors. It is unlikely that the insertions inactivated essential
cis-acting elements, since numerous similarly sized
insertions of different sequences at the same site had no deleterious
effects on precursor accumulation (46). It appears,
therefore, that the ability to form a stable secondary structure may be
the primary property exerting a negative influence on precursor
accumulation. This effect may result from secondary structure-mediated
inhibition of RNA replication in a manner akin to that depicted in Fig.
8B (i.e., blocking of replicase movement). However, other mechanisms which are unrelated to secondary structure (e.g., the inserted sequence
is itself inhibitory) or which involve an indirect role for secondary
structure (e.g., by binding an inhibitory protein factor) are also possible.
The replication of RNA B, which lacks the entire 5' NTR of the genome,
is significant since 5'-terminal segments are important
or essential
for genome replication and/or viability in numerous
plus-sense RNA
plant and animal viruses (
7,
16,
25,
27,
30,
40).
Interestingly, entire 3' NTRs of picornavirus genomes
can be deleted
while viability is maintained (
38). This result
is notable,
since these regions have been shown to harbor
cis-acting
elements important for genome replication (
29,
31). Despite
the apparent dispensability of the TBSV 5' NTR for replication,
its
absence did lead to decreased levels of accumulation of the
viral
replicon (i.e., RNA B accumulated to levels of approximately
1 order of
magnitude less than that of DI-72, which contains region
I [data not
shown]), thus underscoring the importance of this
terminal segment for
optimal amplification. In the context of
a TBSV DI RNA, the role of
region I is likely limited to replication
and/or stability, since these
molecules are neither translated
nor packaged efficiently
(
12).
Although our present results indicate that the 5' NTR in its entirety
is not required in
cis for replication of a subviral
RNA, we
cannot preclude the possibility that this region is essential
but that
its activity is provided in
trans by the helper genome.
Alternatively, region II, or other regions of the molecule, might
harbor sequences which are able to compensate partially for the
absence
of those in region I.
cis elements important for plus-strand
synthesis of prototypical DI RNAs likely reside at or near the
minus-strand 3' terminus, as has been shown for a subviral RNA
of the
closely related carmovirus turnip crinkle virus (a member
of the family
Tombusviridae) (
8). Examination of the
minus-strand
sequence of the prototypical TBSV DI RNA, DI-72 (Fig.
1),
revealed
a tandemly arranged semiconserved 11-nt sequence present at
the
3' terminus of region I (Fig.
8C, lines 1 and 2). Further
examination
of the minus strand of the TBSV DI RNA allowed the
identification
of additional variants of the semiconserved undecamer
sequence
at locations more 5' in region I and in regions II, III, and
IV
(Fig.
8C). Alignment of the segments containing the sequence
variants
allowed the determination of a consensus undecamer motif (Fig.
8C). Interestingly, the deduced consensus sequence,
3'-CCCAAAGAGAG,
is very similar to a sequence motif
identified by Guan et al.
(
8), 3'-CCCAAAXGAXXU, at
the 3' termini of minus strands of
carmoviruses and carmovirus-related
RNAs (Fig.
8C). Additionally,
the carmovirus motif variant
(
)3'-UCCCAAAGUAU has been shown
to have plus-strand promoter activity
in vitro (
8). This finding,
the high degree of similarity
between the two consensus motifs,
their presence at 3'-terminal and
internal locations in strands
of the same sense, and the close
relatedness of the virally encoded
components of the RDRPs of
tombusviruses and carmoviruses (
18)
support the concept that
at least some of the TBSV motif variants
identified are also involved
in plus-strand synthesis. It should
be noted that three of the
undecamer motifs in the minus strand
of region I partially overlap
copies of a motif identified by
Finnen and Rochon (
6) in the
plus strand of region I in CNV
DI RNAs. It was suggested that the
plus-strand motifs facilitate
synthesis of minus-strand CNV DI RNAs
from DI RNA dimers (
6).
Either one or two copies of the carmovirus motif were identified at or
near the 3' termini of the minus-strand viral RNAs
examined
(
8). Similarly, the 3' termini of minus strands of
region I
contain two copies of the undecamer motif (Fig.
8C, lines
1 and 2), and
versions of the motif can be found at similar positions
(and also
internally) in other tombusvirus genomic and satellite
RNAs (data not
shown). Examination of the minus strands of RNAs
B1 and B2 revealed
that an undecamer motif derived from region
II (Fig.
8C, line 7) was
positioned at 9 and 6 nt, respectively,
from their 3' termini (Fig.
8D). This observation suggests that
this originally internal motif,
when repositioned adjacent to
a 3' terminus, may function in a capacity
similar to those motifs
normally located terminally in region I. In
addition, the sequence
identity between the most 3' nucleotides of
region I and those
in RNAs B1 and B2 implies that they too may be
important for RNA
synthesis (Fig.
8D).
The roles of the internally positioned undecamer motifs in prototypical
DI RNA and RNA B species are less obvious. However,
their conservation
in different tombusvirus genomes and satellite
RNAs (data not shown)
indicates likely functional roles. For example,
the sequence
(
)3'-CCCAAAGAGAG, which conforms precisely to the
undecamer consensus, is present in two different TBSV satellite
RNAs
(
3) and is located approximately 45 nt from the 3' termini
of their minus strands. In addition, the two TBSV satellite RNAs
contain other internal segments that have very significant sequence
identities to internal portions of region I that harbor undecamer
motifs (data not shown). The conservation of internal copies of
the
motif, along with its homology with terminal elements and
a defined
plus-strand promoter element (
8), suggests possible
roles as promoters, enhancers, and/or regulatory elements of
plus-strand
synthesis. Systematic mutagenesis of the undecamer
motifs in DI
RNA and satellite RNAs is currently under way and should
provide
further information regarding these repetitive
elements.
| |
ACKNOWLEDGMENTS |
We thank Laurie Baggio and members of our laboratory for
reviewing the manuscript. We are also grateful to D'Ann Rochon for providing CNV-K2/M5.
This work was supported by grants to K.A.W. from the Natural Sciences
and Engineering Research Council of Canada.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biology, York University, 4700 Keele St., Toronto, Ontario, Canada M3J 1P3. Phone: (416) 736-2100, ext. 40890 or 70352. Fax: (416) 736-5698. E-mail: kawhite{at}yorku.ca.
| |
REFERENCES |
| 1.
|
Ball, L. A.
1994.
Replication of the genomic RNA of a positive-strand RNA animal virus from negative-sense transcripts.
Proc. Natl. Acad. Sci. USA
91:12443-12447[Abstract/Free Full Text].
|
| 2.
|
Burgyan, J.,
L. Rubino, and M. Russo.
1991.
De novo generation of cymbidium ringspot virus defective interfering RNA.
J. Gen. Virol.
72:505-509[Abstract/Free Full Text].
|
| 3.
|
Celix, A.,
E. Rodriguez-Cerezo, and F. Garcia-Arenal.
1997.
New satellite RNAs, but not DI RNAs, are found in natural populations of tomato bushy stunt virus.
Virology
239:277-284[Medline].
|
| 4.
|
Chang, Y. C.,
M. Borja,
H. B. Scholthof,
A. O. Jackson, and T. J. Morris.
1995.
Host effects and sequences essential for accumulation of defective interfering RNAs of cucumber necrosis and tomato bushy stunt tombusviruses.
Virology
210:41-53[Medline].
|
| 5.
|
Dreher, T. W., and T. C. Hall.
1988.
Mutational analysis of the sequence and structural requirements in brome mosaic virus RNA for minus strand promoter activity.
J. Mol. Biol.
210:31-40.
|
| 6.
|
Finnen, R. L., and D. M. Rochon.
1995.
Characterization and biological activity of DI RNA dimers formed during cucumber necrosis virus coinfections.
Virology
207:282-286[Medline].
|
| 7.
|
French, R., and P. Ahlquist.
1987.
Intercistronic as well as terminal sequences are required for efficient amplification of brome mosaic virus RNA3.
J. Virol.
61:1457-1465[Abstract/Free Full Text].
|
| 8.
|
Guan, H.,
C. Song, and A. E. Simon.
1997.
RNA promoters located on ()-strands of a subviral RNA associated with turnip crinkle virus.
RNA
3:1401-1412[Abstract].
|
| 9.
|
Havelda, Z., and J. Burgyan.
1995.
3' terminal putative stem-loop structure required for the accumulation of cymbidium ringspot viral RNA.
Virology
214:269-272[Medline].
|
| 10.
|
Havelda, Z.,
T. Dalmay, and J. Burgyan.
1995.
Localization of cis-acting sequences essential for cymbidium ringspot tombusvirus defective interfering RNA replication.
J. Gen. Virol.
76:2311-2316[Abstract/Free Full Text].
|
| 11.
|
Havelda, Z.,
T. Dalmay, and J. Burgyan.
1997.
Secondary structure-dependent evolution of cymbidium ringspot virus defective interfering RNA.
J. Gen. Virol.
78:1227-1234[Abstract].
|
| 12.
|
Hearne, P. Q.,
D. A. Knorr,
B. I. Hillman, and T. J. Morris.
1990.
The complete genome structure and synthesis of infectious RNA from clones of tomato bushy stunt virus.
Virology
177:141-151[Medline].
|
| 13.
|
Hillman, B. I.,
J. C. Carrington, and T. J. Morris.
1987.
A defective interfering RNA that contains a mosaic of a plant virus genome.
Cell
51:427-433[Medline].
|
| 14.
|
Ishikawa, M.,
T. Meshi,
T. Ohno, and Y. Okada.
1991.
Specific cessation of minus-strand RNA accumulation at an early stage of tobacco mosaic virus infection.
J. Virol.
65:861-868[Abstract/Free Full Text].
|
| 15.
|
Johnston, J. C., and D. M. Rochon.
1995.
Deletion analysis of the promoter for the cucumber necrosis virus 0.9-kb subgenomic RNA.
Virology
214:100-109[Medline].
|
| 16.
|
Kim, K., and C. Hemenway.
1996.
The 5' nontranslated region of potato virus X RNA affects both genomic and subgenomic RNA synthesis.
J. Virol.
70:5533-5540[Abstract/Free Full Text].
|
| 17.
|
Knorr, D. A.,
R. H. Mullin,
P. Q. Hearne, and T. J. Morris.
1991.
De novo generation of defective interfering RNAs of tomato bushy stunt virus by high multiplicity passage.
Virology
181:193-202[Medline].
|
| 18.
|
Koonin, E. V., and V. V. Dolja.
1993.
Evolution and taxonomy of positive-strand RNA viruses: implications of comparative analysis of amino acid sequences.
Crit. Rev. Biochem. Mol. Biol.
28:375-430[Medline].
|
| 19.
|
Lazzarini, R. A.,
J. D. Keene, and M. Schubert.
1981.
The origins of defective interfering particles of the negative-strand RNA viruses.
Cell
26:145-154[Medline].
|
| 20.
|
Li, Y., and L. A. Ball.
1993.
Nonhomologous RNA recombination during negative-strand synthesis of flock house virus RNA.
J. Virol.
67:3854-3860[Abstract/Free Full Text].
|
| 21.
|
Lin, Y. J.,
C. L. Liao, and M. M. Lai.
1994.
Identification of the cis-acting signal for minus-strand RNA synthesis of a murine coronavirus: implications for the role of minus-strand RNA in RNA replication and transcription.
J. Virol.
68:8131-8140[Abstract/Free Full Text].
|
| 22.
|
Marsh, L. E.,
C. C. Huntley,
G. P. Pogue,
J. P. Connell, and T. C. Hall.
1991.
Regulation of (+):()-strand asymmetry in replication of brome mosaic virus RNA.
Virology
182:76-83[Medline].
|
| 23.
|
Miller, W. A.,
T. W. Dreher, and T. C. Hall.
1985.
Synthesis of brome mosaic virus subgenomic RNA in vitro by internal initiation on () sense genomic RNA.
Nature
313:68-70[Medline].
|
| 24.
|
Nagy, P. D., and J. J. Bujarski.
1993.
Targeting the site of RNA-RNA recombination in brome mosaic virus with antisense sequences.
Proc. Natl. Acad. Sci. USA
90:6390-6394[Abstract/Free Full Text].
|
| 25.
|
Niesters, H. G., and J. H. Strauss.
1990.
Defined mutation in the 5' nontranslated sequence of Sindbis virus RNA.
J. Virol.
64:4162-4168[Abstract/Free Full Text].
|
| 26.
|
Oster, S. K.,
B. Wu, and K. A. White.
1998.
Uncoupled expression of p33 and p92 permit amplification of tomato bushy stunt virus RNAs.
J. Virol.
72:5845-5851[Abstract/Free Full Text].
|
| 27.
|
Pacha, R. F., and P. Ahlquist.
1992.
Substantial portions of the 5' and intercistronic noncoding regions of cowpea chlorotic mottle virus RNA3 are dispensable for systemic infection but influence viral competitiveness and infection pathology.
Virology
187:298-307[Medline].
|
| 28.
|
Perrault, J.
1981.
Origin and replication of defective interfering particles.
Curr. Top. Microbiol. Immunol.
93:151-207[Medline].
|
| 29.
|
Pilipenko, E.,
V. K. Poperechny,
S. V. Maslova,
J. G. Melchers,
H. J. Bruins Slot, and V. Agol.
1996.
Cis-element, oriR, involved in the initiation of () strand poliovirus RNA: a quasi-globular multi-domain RNA structure maintained by tertiary (`kissing') interactions.
EMBO J.
15:5428-5436[Medline].
|
| 30.
|
Pogue, G. P.,
L. E. Marsh, and T. C. Hall.
1990.
Point mutations in the ICR2 motif of brome mosaic virus RNAs debilitate (+)-strand replication.
Virology
178:152-160[Medline].
|
| 31.
|
Rholl, J. B.,
D. H. Moon,
D. J. Evans, and J. W. Almond.
1995.
The 3' untranslated region of picornavirus RNA: features required for efficient genome replication.
J. Virol.
69:7835-7844[Abstract].
|
| 32.
|
Rochon, D. M.
1991.
Rapid de novo generation of defective interfering RNA by cucumber necrosis virus mutants that do not express the 20-kDa nonstructural protein.
Proc. Natl. Acad. Sci. USA
88:11153-11157[Abstract/Free Full Text].
|
| 33.
|
Rochon, D. M., and J. C. Johnston.
1991.
Infectious transcripts from cloned cucumber necrosis virus cDNA: evidence for a bifunctional subgenomic promoter.
Virology
181:656-665[Medline].
|
| 33a.
|
Roux, L.,
A. E. Simon, and J. J. Holland.
1991.
Effects of defective interfering viruses on virus replication and pathogenesis in vitro and in vivo.
Adv. Virus Res.
40:181-211[Medline].
|
| 34.
|
Scholthof, H. B.,
K. B. Scholthof,
M. Kikkert, and A. O. Jackson.
1995.
Tomato bushy stunt virus spread is regulated by two nested genes that function in cell-to-cell movement and host-dependent systemic invasion.
Virology
213:425-438[Medline].
|
| 35.
|
Scholthof, K. B.,
H. B. Scholthof, and A. O. Jackson.
1995.
The tomato bushy stunt virus replicase proteins are coordinately expressed and membrane associated.
Virology
208:365-369[Medline].
|
| 35a.
|
Sit, T. L.,
A. A. Vaewhongs, and S. A. Lommel.
1998.
RNA-mediated trans-activation of transcription from a viral RNA.
Science
281:829-832[Abstract/Free Full Text].
|
| 36.
|
Song, C., and A. E. Simon.
1995.
Requirement of a 3'-terminal stem-loop in vitro transcription of an RNA-dependent RNA polymerase.
J. Mol. Biol.
254:6-14[Medline].
|
| 37.
|
Takamatsu, N.,
Y. Watanabe,
T. Iwasaki,
T. Shiba,
T. Meshi, and Y. Okada.
1991.
Deletion analysis of the 5' untranslated leader sequence of tobacco mosaic virus RNA.
J. Virol.
65:1619-1622[Abstract/Free Full Text].
|
| 38.
|
Todd, S.,
J. S. Towner,
D. M. Brown, and B. L. Semler.
1997.
Replication-competent picornaviruses with complete genomic RNA 3' noncoding region deletions.
J. Virol.
71:8868-8874[Abstract].
|
| 39.
|
Van der Kuyl, A. C.,
K. Langereis,
C. J. Howing,
E. M. J. Jaspars, and J. F. Bol.
1990.
Cis-acting elements involved in replication of alfalfa mosaic virus RNAs in vitro.
Virology
176:346-354[Medline].
|
| 40.
|
Van der Vossen, E. A. G.,
L. Neeleman, and J. F. Bol.
1996.
The 5' terminal sequence of alfalfa mosaic virus RNA 3 is dispensable for replication and contains a determinant for symptom formation.
Virology
221:271-280[Medline].
|
| 41.
|
van Rossum, C. M.,
C. B. Reusken,
F. T. Brederode, and J. F. Bol.
1997.
The 3' untranslated region of alfalfa mosaic virus RNA3 contains a core promoter for minus-strand RNA synthesis and an enhancer element.
J. Gen. Virol.
78:3045-3049[Abstract].
|
| 42.
|
Wang, J., and A. E. Simon.
1997.
Analysis of the two subgenomic RNA promoters for turnip crinkle virus in vivo and in vitro.
Virology
232:174-186[Medline].
|
| 43.
|
White, K. A., and T. J. Morris.
1994.
Nonhomologous RNA recombination in tombusviruses: generation and evolution of defective interfering RNAs by stepwise deletions.
J. Virol.
68:14-24[Abstract/Free Full Text].
|
| 44.
|
White, K. A., and T. J. Morris.
1994.
Enhanced competitiveness of tomato bushy stunt virus defective interfering RNAs by segment duplication or nucleotide insertion.
J. Virol.
68:6092-6096[Abstract/Free Full Text].
|
| 45.
|
White, K. A., and T. J. Morris.
1995.
RNA determinants of junction site selection in RNA virus recombinants and defective interfering RNAs.
RNA
1:1029-1040[Abstract].
|
| 46.
| Wu, B., and K. A. White. Unpublished data.
|
Journal of Virology, December 1998, p. 9897-9905, Vol. 72, No. 12
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Monkewich, S., Lin, H.-X., Fabian, M. R., Xu, W., Na, H., Ray, D., Chernysheva, O. A., Nagy, P. D., White, K. A.
(2005). The p92 Polymerase Coding Region Contains an Internal RNA Element Required at an Early Step in Tombusvirus Genome Replication. J. Virol.
79: 4848-4858
[Abstract]
[Full Text]
-
Rubino, L., Pantaleo, V., Navarro, B., Russo, M.
(2004). Expression of tombusvirus open reading frames 1 and 2 is sufficient for the replication of defective interfering, but not satellite, RNA. J. Gen. Virol.
85: 3115-3122
[Abstract]
[Full Text]
-
Ray, D., Na, H., White, K. A.
(2004). Structural Properties of a Multifunctional T-Shaped RNA Domain That Mediate Efficient Tomato Bushy Stunt Virus RNA Replication. J. Virol.
78: 10490-10500
[Abstract]
[Full Text]
-
RAY, D., WU, B., WHITE, K. A.
(2003). A second functional RNA domain in the 5' UTR of the Tomato bushy stunt virus genome: Intra- and interdomain interactions mediate viral RNA replication. RNA
9: 1232-1245
[Abstract]
[Full Text]
-
Ray, D., White, K. A.
(2002). An Internally Located RNA Hairpin Enhances Replication of Tomato Bushy Stunt Virus RNAs. J. Virol.
77: 245-257
[Abstract]
[Full Text]
-
Qiu, W., Scholthof, H. B.
(2001). Effects of inactivation of the coat protein and movement genes of Tomato bushy stunt virus on early accumulation of genomic and subgenomic RNAs. J. Gen. Virol.
82: 3107-3114
[Abstract]
[Full Text]
-
Qiu, W., Scholthof, K.-B. G.
(2000). In Vitro- and In Vivo-Generated Defective RNAs of Satellite Panicum Mosaic Virus Define cis-Acting RNA Elements Required for Replication and Movement. J. Virol.
74: 2247-2254
[Abstract]
[Full Text]
-
Wu, B., White, K. A.
(1999). A Primary Determinant of Cap-Independent Translation Is Located in the 3'-Proximal Region of the Tomato Bushy Stunt Virus Genome. J. Virol.
73: 8982-8988
[Abstract]
[Full Text]
Top
Abstract
Introduction
