This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Howe, A. Y. M.
Right arrow Articles by Desrosiers, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Howe, A. Y. M.
Right arrow Articles by Desrosiers, R. C.

 Previous Article  |  Next Article 

Journal of Virology, December 1998, p. 9827-9834, Vol. 72, No. 12
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Zeta Chain of the T-Cell Receptor Interacts with nef of Simian Immunodeficiency Virus and Human Immunodeficiency Virus Type 2

Anita Y. M. Howe, Jae U. Jung, and Ronald C. Desrosiers*

New England Regional Primate Research Center, Harvard Medical School, Southborough, Massachusetts 01772-9102

Received 6 July 1998/Accepted 2 September 1998

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

A truncated version of the nef gene of simian immunodeficiency virus SIVmac239 capable of encoding amino acids 98 to 263 was used as bait to screen a cDNA library from activated lymphocytes in a yeast two-hybrid system. The zeta chain of the T-cell receptor (TCRzeta ) was found to interact specifically not only with truncated SIV nef in yeast cells but also with full-length glutathione S-transferase (GST)-SIVnef fusion protein in vitro. Coimmunoprecipitation of TCRzeta with full-length SIV nef was demonstrated in transfected Jurkat cells and in Cos 18 cells which express the cytoplasmic domain of TCRzeta fused to the external domain of CD8 via the CD8 transmembrane domain. Using a series of nef deletion mutants, we have mapped the binding site within the central core domain of nef (amino acids 98 to 235). Binding of TCRzeta was specific for nef isolated from SIVmac239, SIVsmH4, and human immunodeficiency virus (HIV)-2ST and was not detected with nef from five different HIV-1 isolates. An active tyrosine kinase was coprecipitated with nef-TCRzeta complexes from Jurkat cells but not from J.CAM1.6 cells which lack a functional Lck tyrosine kinase. These results demonstrate a specific association of SIV and HIV-2 nef, but not HIV-1 nef, with TCRzeta .

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

A nef gene is found in all subgroups of primate lentiviruses (49, 53). nef is considered a nonessential auxiliary gene because it can be deleted without dramatically affecting the ability of virus to replicate in cell culture (31, 56, 57). Evidence for the importance of nef for the efficiency of viral replication in the intact organism and for the maintenance of high virus loads has been derived both from studies with simian immunodeficiency virus (SIV) in monkeys and from studies with human immunodeficiency virus type 1 (HIV-1) in humans. Monkeys infected with a derivative of a pathogenic molecular clone of SIV from which nef gene sequences were specifically removed maintain low or undetectable virus loads and usually show no signs of disease progression (31). Similarly, one human in central Massachusetts (32) and several in Australia (16) are infected with nef-deleted forms of HIV-1, and they too are long-term nonprogressors who maintain low viral loads. In Australia, a single blood donor clearly transmitted nef-deleted HIV-1 to several recipients via blood donations, and this virus clearly behaved with a markedly attenuated phenotype.

Information is beginning to emerge which suggests that nef may have evolved a number of different, independent functional activities to enhance the replication and survival of virus. These include downregulation of the CD4 receptor from the surface of the cell (1, 21, 43, 50), downregulation of major histocompatibility complex class I molecules (52) which may protect infected cells from killing by cytotoxic T lymphocytes (15), infectivity enhancement (2, 38), and lymphocyte activation (3, 6, 17, 18) or inhibition of lymphocyte activation (23, 26, 39). Each of these functional activities clearly involves interactions with the host cell. Finding the cellular partners that couple with nef to achieve these functional activities is important for defining the biochemical activities and eventually delineating their relative importance. Cellular proteins that have been found to couple with nef include src family kinase (5, 14, 34, 46), a serine/threonine kinase (24, 37, 51), protein kinase C (PKC) theta (55), beta -cop (7), a thioesterase (36), and CD4 (45).

In this report, we describe the specific interaction of the zeta chain of the T-cell receptor (TCRzeta ) with nef of SIVmac, SIVsm, and HIV-2. Specific binding to TCRzeta was not observed with five different nef alleles of HIV-1. An active tyrosine kinase was found to coprecipitate with the nef-TCRzeta complex, suggesting that the interaction might influence T-cell signaling.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Cell lines and plasmids. The Jurkat human T-cell line and the J.CAM1.6 cell line were obtained from the American Type Culture Collection (Rockville, Md.) and grown in RPMI 1640 medium which contained 25 mM HEPES, 10% fetal calf serum (Gibco/BRL, Grand Island, N.Y.), penicillin-streptomycin (50 IU and 50 µg/ml, respectively), and 2 mM L-glutamine (Gibco/BRL). Cos 18 cells were kindly provided by A. Weiss (Howard Hughes Medical Institute, University of California, San Francisco, Calif.) and maintained in Dulbecco's modified Eagle's medium supplemented with 5% fetal calf serum, 0.4 mg of G418 per ml, penicillin-streptomycin (50 IU and 50 µg/ml, respectively), and 2 mM L-glutamine (Gibco/BRL). The 221 cell line was grown in RPMI 1640 medium supplemented with 5% fetal calf serum, 10% interleukin-2 (IL-2), penicillin-streptomycin (50 IU and 50 µg/ml, respectively), and 2 mM L-glutamine (Gibco/BRL).

Plasmid pJSP4-27 containing the HIV-2 ST nef gene and plconsnefSN were obtained from the AIDS Research and Reference Reagent Program (McKesson Bioservices, Rockville, Md.). pSIVsmH4 was obtained from V. Hirsch (National Institute of Allergy and Infectious Diseases, Rockville, Md.). pGEX2T-SF2nef was a gift from D. Baltimore (Massachusetts Institute of Technology, Cambridge, Mass.).

Yeast two-hybrid screen. Yeast two-hybrid screening was performed according to the protocol suggested by the MATCHMAKER TWO-HYBRID SYSTEM 2 (Clontech, Palo Alto, Calif.). nef hybrid expression plasmid pBD-239Delta nef2 was constructed by fusing a truncated SIVmac239 nef gene encoding amino acids (aa) 1 to 15 and aa 98 to 263 (Delta nef2; see Fig. 1) to the GAL4-DNA binding domain in the pAS2-1 vector. Delta nef2 was used for the yeast two-hybrid screen in order to minimize high, nonspecific backgrounds seen with the full-length nef and because nef sequences missing aa 16 to 97 are still capable of associating with a serine/threonine kinase (data not shown) (51). A cDNA library from phytohemagglutinin (PHA)-activated human lymphocytes fused to the GAL4-DNA activation domain was purchased from Clontech. The yeast strain Saccharomyces cerevisiae Y190 (leu his trp auxotroph) harboring the two reporter genes HIS3 and lacZ was sequentially transformed with the nef hybrid expression plasmid and the PHA-activated human lymphocyte cDNA library by using the lithium acetate transformation method (Clontech). Double transformants were plated onto synthetic medium agar plates lacking leucine, tryptophan, and histidine in the presence of 3-amino-1,2,4-triazole (-L-Y-H+3AT). After 10 days of incubation at 30°C, His+ colonies were rescued and patched onto -L-Y-H+3AT plates. beta -Galactosidase activities in these His+ colonies were tested by replica plating on nylon filters which were dipped into liquid nitrogen, soaked in 5-bromo-4-chloro-3-indolyl-beta -D-galactopyranoside (X-Gal) buffer, and incubated at room temperature for 3 to 5 h. Colonies of the LacZ+ clones were restreaked onto -L-Y-H+3AT plates to isolate single colony and were retested for beta -galactosidase activity. Confirmed positive clones (His+ LacZ+) were grown in leucine-minus synthetic medium in the presence of 10 µg of cycloheximide per ml for 5 days at 30°C to counterselect pBD-239Delta nef2. Plasmids from the segregants (Leu+ Trp- Cyhr) containing only the pAD-cDNA were isolated, transformed into Escherichia coli, and sequenced.

Yeast mating assay. To verify specific interaction of nef and the protein expressed by the cDNA clones, S. cerevisiae Y190 containing the pAD-cDNA was mated with another strain, Y187, previously transformed with the pAS2-1 fused to the wild type or the truncated SIV nef genes in complete YPD medium for 18 h at 30°C. Diploid yeast cells were plated onto -L-Y-H+3AT plates and incubated for 5 days at 30°C. His and LacZ phenotypes were scored as described above.

Construction of Nef expression plasmids. The plasmid p239SpE3' containing the 3' half of the SIVmac239 open proviral genome (42) was used as the template for the PCR amplification of the truncated nef fragments. Delta nef1, Delta nef2, and Delta nef3 fragments were amplified by PCR by using the 5' primers AH1 (5'-GGAAGATCTGGGACAGTATATGAATACTCCATG-3'), AH2 (5'-GGAAGATCTGGGGGTATCAGTGAGGCCAAAA-3'), and AH3 (5'-GGAAGATCTGTACAGTGCAAGAAGACATAGA-3') and the 3' primer 3' NefPsIAU1 (5'-ACG CTGCAGTTATATATAGCGATAGGTGTCGCGAGTTTCCTTCTTGTCAGC- 3'), respectively, which introduced the unique BglII and PstI restriction sites (underlined) and a sequence encoding an AU1 epitope tag (in boldface). Delta nef4, Delta nef5, and Delta nef6 fragments were amplified by using the 5' primer 5'NefEcoRI (5'-GCGGAATTCATGGGTGGAGCTATTTCCATG-3') and the 3' primers AH4 (5'-ACGCTGCAGTTATATATAGCGATAGGTGTCGCTTCCAAACTCTTCT GGGTA-3'), AH5 (5'-ACGCTGCAGTTATATATAGCGATAGGTGTCTAGCCAGCCAAATGTCTTTGG-3'), and AH6 (5'-ACGCTGCAGTTATATATAGCGATAGGTGTCGTAACTCATTGTTCTTAGGGG-3'), respectively, which introduced the unique EcoRI and PstI restriction sites (underlined) and an AU1 epitope (in boldface). Delta nef2-4 and Delta nef3-4 were constructed by PCR amplification of p239SPE3' with the 5' primers AH2 and AH3, respectively, with the 3' primer AH4. The Delta nef1, Delta nef2, Delta nef3, Delta nef2-4, and Delta nef3-4 fragments digested with BglII and PstI and the Delta nef4, Delta nef1, and Delta nef6 fragments digested with EcoRI and PstI were cloned into pFJ-239nef (18) previously digested with the corresponding enzymes to create pFJDelta nef1, pFJDelta nef2, pFJDelta nef3, pFJDelta nef4, pFJDelta nef5, pFJDelta nef6, pFJDelta nef2-4, and pFJDelta nef3-4.

To construct pFJSF2nef, the nef open reading frame (ORF) of pGEX2T-SF2nef was amplified by PCR with 5'EcoRISF2 (5'-GTCCAGAATTCGCCGCCATGGGTGGCAAGTGGTCAAAA-3') and 3'PstIAU1SF2 (5'-ACGCTGCAGTTATATATAGCGATAGGTGTCGCAGTCTTTGTAGTACTCCGG-3'). The PCR DNA fragment was digested with EcoRI and PstI and cloned into pFJ expression vector (30) previously digested with the similar restriction enzymes to construct pFJSF2nef. pGST-SF2nef was constructed by removal of the SF2 nef DNA fragment from the pFJSF2nef at the EcoRI and XhoI sites and subcloned into a vector pGEX-4T (Pharmacia, Piscataway, N.J.). pGST-239nef was derived from pFJ239nef (18) by restricting at the EcoRI and XhoI sites and subcloned into the expression vector pGEX-4T.

The nef ORFs of the plasmids pFJNL4-3nef, pFJSHIVnef-153, and pFJSHIVnef-259 were generated by PCR amplification of pNL4-3 and of proviral clones recovered from two animals infected with a recombinant SHIVnef virus (16a). The primers used for PCR were 5'EcoRISF2 and 3'PstIAU1NL4-3 (5'-ACGC TGCAGTTATATATAGCGATAGGTGTCGCAGTTCTTGAAGTACTCCGG- 3'). The PCR fragments were subsequently cloned into the expression vector pFJ. pFJRulda was constructed in a similar manner by using PCR amplification from the proviral clone recovered from the animal infected with SHIVnefRulda with primers 5'EcoRIRulda (5'-GTCCAGAATTCGCCGCCATGGGGGGCAAGTGGTCAAAA-3') and 3'PstIAU1Rulda (5'-ACGCTGCAGTTATATATAGCGATAGGTGTCGTTCTTGAAGTACTCCGGATG-3'). pFJSIVsmH4nef and pFJHIV-2ST were constructed by PCR amplification of the plasmids pSIVsmH4 and pJSP4-27, respectively, with primers SmH45'EcoRI (5'-GTCCAGAATTCGCCGCCATGGGTGGCGCTATTTCCAAG-3') and SmH43'AU1PstI (5'-AC GCTGCAGTTATATATAGCGATAGGTGTCATCTGCCAGCCTCTCCGCAG A-3') for pFJSIVsmH4nef and primers 5'EcoRIHIV-2 (5'-CCGGAATTCATGGGGGCGAGTGGATCCAAGAAG-3') and 3'PSTIAU1HIV-2 (5'-ACGCTGCAGTTATATATAGCGATAGGTGTC) for pFJHIV-2ST. The PCR fragments were digested with EcoRI and PstI and cloned into pFJ digested with the similar enzymes.

The nef ORF of the consensus nef was amplified from pJSP4-27 by PCR with primers 5'XEConsef (5'-CTTCAGTCTAGAATTCGCCACCATGGGTGGCAAG-3') and 3'BamHIConsnef (5'-CGCGGATCCTTATATATAGCGATAGGTGTCGCAGTCTTTGTAGTACTCCGGATG-3'). The PCR DNA fragment was cloned into pFJ previously digested with EcoRI and BglII to form pFJconsnef. Each mutant form of nef was completely sequenced to verify the presence of the mutation and the absence of any other changes.

All hybrid expression plasmids used for the yeast transformation were derived from the corresponding pFJ-nef expression plasmids with digestion at the EcoRI and PstI sites and cloned into the pAS2-1 vector (Clontech).

Expression and purification of recombinant glutathione S-transferase (GST)-fusion protein. Ten milliliters of overnight cultures of E. coli transformed with pGEX-4T or recombinant plasmids were diluted 1:20 with fresh medium and grown for 2 h at 37°C before inducing with 0.5 mM isopropyl-beta -D-thiogalactopyranoside (IPTG). After a further 6 h of incubation, the cells were pelleted and resuspended in 10 ml of bacteria lysis buffer containing 1% Triton X-100, 0.1% N-lauryl sarconsinate, 0.1 mM phenylmethylsulfonyl fluoride (PMSF), 0.1% aprotinin, and 1 µg of leupeptin per ml in phosphate-buffered saline (PBS). Cells were lysed by sonication followed by centrifugation at 10,000 × g for 5 min at 4°C. The cell pellets were sonicated again and centrifuged at 10,000 × g for 15 min at 4°C. The supernatant was collected and incubated with 500 µl of the preswollen glutathione-Sepharose beads (Pharmacia) for 2 h at 4°C. The beads were washed three times with ice-cold PBS and stored at 4°C.

In vitro binding assay. A total of 107 cells were lysed in 1 ml of cell lysis buffer (0.5% Nonidet P-40, 50 mM HEPES [pH 7.5], and 150 mM NaCl) containing 2 mM NaVO3, 10 mM NaF, 1 mM PMSF, 1 µg of leupeptin per ml, and 1% aprotinin (Sigma Chemical, St. Louis, Mo.). The cell lysates were centrifuged at 13,000 × g for 30 min at 4°C. The supernatant was mixed with 30 µl of the glutathione-Sepharose beads (beads) and 20 µl of the immobilized GST (GST beads; 5 mg/ml) and incubated for 30 min at 4°C. Precleared cell extracts were incubated with approximately 30 µg of the soluble GST and 10 µl of the immobilized GSTnef fusion proteins or GST beads (all loaded beads contained approximately 2 mg of protein per ml) for 3 h at 4°C. The coprecipitated proteins were washed three times with ice-cold lysis buffer, boiled in Laemmli sample treatment buffer (33) for 5 min, separated by sodium dodecyl sulfate (SDS)-10% polyacrylamide gel electrophoresis (PAGE) and electroblotted onto the Immobilon membrane (Millipore, Bedford, Mass.). Immunodetection was performed with a 1:3,000 dilution of anti-TCRzeta mouse monoclonal antibody (Santa Cruz Biotechnology, Santa Cruz, Calif.) and developed by the enhanced chemiluminescence (ECL) system with procedures suggested by the manufacturer (Amersham, Chicago, Ill.).

Association of tyrosine kinase with the nef coprecipitation complex was performed by procedures similar to those described above, except that the coprecipitated complexes were washed three times with the cell lysis buffer and once with the kinase buffer (50 mM Tris-HCl [pH 7.4] and 10 mM MgCl2). In vitro kinase reaction with the coprecipitated proteins was carried out in the presence of the kinase buffer and 1 mM ATP (final volume, 20 µl) for 30 min at room temperature. Tyrosine-phosphorylated proteins were analyzed by SDS-10% PAGE, transferred onto the Immobilon membrane (Millipore), and immunodetected by the antiphosphotyrosine mouse monoclonal antibody 4G10 (immunoglobulin G2b [IgG2b]; 1:10,000 dilution; Upstate Biotechnology Inc., Lake Placid, N.Y.). The immunoblot was developed by the ECL system.

Transfection, immunoprecipitation, and immunoblotting. Cos 18 cells were transfected with 5 µg of the nef expression plasmids by the standard DEAE-dextran method (47). Cells were harvested 48 h after transfection and lysed with 1 ml of the cell lysis buffer containing a cocktail of protease inhibitors as described above. The cell lysates were cleared by centrifugation at 13,000 × g for 30 min at 4°C and divided into aliquots of 50 and 950 µl, respectively. The aliquot containing 50 µl of the cell lysate was used for the analysis of nef protein expression, while the aliquot containing 950 µl of the cell lysate was used for the immunoprecipitation. Immunoprecipitation was performed by adding 1 µl of anti-AU1 mouse monoclonal antibody (BABCO Biotech, Berkeley, Calif.) and 30 µl of protein A-agarose (Santa Cruz Biotechnology) to the cell lysates. The suspension mixtures were rocked at 4°C for 3 h, and the immune complexes were washed three times with the cell lysis buffer and once with 50 mM Tris-HCl (pH 7.4). Immunoprecipitated proteins were separated by SDS-10% PAGE, transferred onto the Immobilon membrane (Millipore), and reacted with the anti-TCRzeta mouse monoclonal antibody (diluted 1:3,000; Santa Cruz Biotechnology), and detected by the ECL system (Amersham).

Transfection of Jurkat cells was carried out by electroporating 107 cells at 210 V and 960 µF with 50 µg of the plasmid DNA. Cells were harvested 20 h posttransfection, and immunoprecipitation of nef complexes was conducted as described above.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

SIVmac239 nef binds to a TCR sequence in yeast cells. We used a deleted form of SIVmac239 nef protein (aa 1 to 15 and 98 to 263; Delta nef2 in Fig. 1) fused to the DNA binding domain of the GAL4 transcription factor as bait in a yeast two-hybrid screen. The expression plasmid for this fusion construct was called pBD-239 Delta nef2. A cDNA library prepared from PHA-activated human lymphocytes was fused to the transcription activation domain of the GAL4 transcription factor (pAD-cDNA) and introduced into S. cerevisiae Y190 previously transformed with pBD-239Delta nef2. When the protein encoded by pBD-239Delta nef2 interacts with that encoded by pAD-cDNA, it will reconstitute a functional GAL4 transcription factor and activate transcription of two reporter genes, lacZ and HIS3, respectively, which are present in the S. cerevisiae Y190. Transformants harboring the positive interacting clones are expected to grow in the absence of histidine and to produce beta -galactosidase.


View larger version (14K):
[in this window]
[in a new window]
 
FIG. 1.   Schematic representation of deletion mutations in nef of SIVmac239. Sequence motifs are described by Shugars et al. (53) and Samuel et al. (49). Myr, myristoylation site; SH2, putative consensus SH2 binding sequence; p34cdc, consensus cyclin-dependent kinase substrate sequence; D-E, acidic stretch; PXXP, putative SH3 binding motif; Y-P, tyrosine kinase recognition sequence; PKC1 and PKC2, PKC recognition sequences. Clones for expression in mammalian cells contained an AU1 epitope tag at the carboxyl termini. Dashed lines represent deleted regions; numbers indicate the positions of the amino acids.

Approximately 106 individual cDNA clones were screened. Ninety-one colonies were able to grow in the absence of histidine. When these colonies were assayed for the production of beta -galactosidase, 20 of the 91 HIS+ colonies were found to have beta -galactosidase activity. To further eliminate false positives, candidate yeast colonies were subjected to cycloheximide counterselection to remove pBD-239Delta nef2 from the cells. The resulting cycloheximide-resistant yeast colonies, which carried only the candidate pAD-cDNA, were then used in mating assays to determine the specificity of the interaction. Six independent clones remained positive. Sequence analysis of these six clones revealed that one (clone 69) had 97% nucleotide sequence identity to the human TCRzeta . Comparison of the amino acid sequence encoded by clone 69 and the TCRzeta cDNA showed that clone 69 encoded a 100-aa polypeptide similar to the cytoplasmic region of the human TCRzeta (Fig. 2). There were three amino acid differences between the amino acid sequence deduced from clone 69 and the published sequence of TCRzeta (Fig. 2) (61).


View larger version (19K):
[in this window]
[in a new window]
 
FIG. 2.   Comparison of amino acid sequence of clone 69 with that of the human TCRzeta . The published sequence of the TCR (61) from the initiating methionine is shown. Dots indicate amino acid identity. Boldface letters indicate different amino acid sequences.

Diploid cells expressing vectors without inserts (pBD and pAD), expressing the truncated nef fusion without clone 69 (pBD-239Delta nef2 and pAD), or expressing the clone 69 fusion without the nef fusion (pBD and pAD-cDNA69), did not grow in the selective medium and were negative for the lacZ phenotype (Table 1). In contrast, interaction of the truncated nef (pBD-239Delta nef2) and the TCRzeta (pAD-cDNA69) conferred on the yeast cells the ability to grow in -L-Y-H+3AT medium and to produce beta -galactosidase (Table 1). This interaction was specific, since negative phenotypes were observed in cells expressing clone 69 or the truncated nef fusion protein in combination with the p53 or the simian virus 40 large T antigen (SV40 T-Ag), respectively (Table 1). As positive controls, yeast cells expressing the wild-type GAL4 transcription factor or the combination of p53 and SV40 large T antigen previously shown to interact with each other (35) were positive for the lacZ phenotype (Table 1). Specific interaction with clone 69 was also observed by using the full-length SIVmac239nef and by using a truncated nef containing the central core region containing aa 98 to 235 (239Delta nef2-4) (Table 1). Further deletion from 98 to 134 (Delta nef3; Fig. 1 and Table 1), however, resulted in the loss of interaction with clone 69, suggesting that aa 98 to 134 in nef are required to bind to the clone 69 sequence.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Growth and lacZ phenotypes in diploid S. cerevisiae harboring hybrid expression plasmids

Use of GST fusions to demonstrate specific interaction. To confirm a possible interaction of nef with TCRzeta , nef was expressed as a GST-fusion protein in E. coli, purified, immobilized on glutathione-Sepharose beads, and incubated with lysates of CD4+ Jurkat T cells or with lysates of Cos 18 cells which stably express CD8-TCRzeta fusion protein (28). Proteins coprecipitated with nef were separated by electrophoresis in an SDS-12% polyacrylamide gel and electroblotted onto a nylon membrane; the presence of TCRzeta was detected with mouse anti-TCRzeta monoclonal antibody. A protein band of approximately 40 kDa, which was the size of the CD8-TCRzeta fusion protein (22), was specifically detected in the sample containing the extract of Cos 18 cells and GST239nef (Fig. 3). Smaller species of approximately 16 and 22 kDa, which might have resulted from the degradation of the CD8-TCRzeta fusion, were also detected. No CD8-TCRzeta was detected when GST without nef was used (Fig. 3). Similarly, TCRzeta (18 kDa) was also specifically detected when GST-SIVmac239 nef (GST239nef) was incubated with the Jurkat cell lysate (Fig. 3). Again, the nef-TCRzeta interaction was specific, since no TCRzeta was found to interact with GST in the absence of nef. Further evidence for the specificity of the interaction was obtained by the absence of signal when nef of HIV-1 strain SF2 was fused to GST and used for the assays (Fig. 3). The failure of HIV-1 SF2nef to interact with TCRzeta is consistent with other results described in more detail below.


View larger version (45K):
[in this window]
[in a new window]
 
FIG. 3.   Binding of GSTnef with TCRzeta in vitro. GST, recombinant GST239nef, and GSTSF2nef proteins were expressed in E. coli, affinity purified, and immobilized by using glutathione-Sepharose beads. The immobilized GST proteins were incubated with extracts of Cos 18 or Jurkat cells previously precleared with immobilized GST and glutathione-Sepharose beads. After extensive washing, proteins coprecipitated with the complexes were analyzed by SDS-12% PAGE, electroblotted onto a nylon membrane, and reacted with anti-TCRzeta monoclonal antibody.

Coprecipitation of TCRzeta and SIVmac239 nef from CD8-TCRzeta -expressing cells. We also analyzed the ability of TCRzeta to be coprecipitated with nef from CD8-TCRzeta -expressing cells. For this purpose, an AU1 epitope tag was placed at the carboxyl terminus of nef-coding sequence in the pFJ expression plasmid and used for transfection into Cos 18 cells, which expressed the CD8-TCRzeta fusion protein. Transfected cell lysates were incubated with anti-AU1 monoclonal antibody, and precipitated proteins were separated by SDS-12% PAGE. The presence of CD8-TCRzeta in the nef immunoprecipitates was detected by reactivity of immunoblotted proteins with anti-TCRzeta monoclonal antibody. Specific coimmunoprecipitation of CD8-TCRzeta was readily detected with nef from SIVmac239 but not from mock-transfected cells (Fig. 4).


View larger version (66K):
[in this window]
[in a new window]
 
FIG. 4.   Coprecipitation of TCRzeta with nef from Cos 18 cells. Cos 18 cells expressing CD8-TCRzeta fusion protein were mock transfected (mock) or transfected with plasmids encoding full-length (SIVmac239nef) or truncated (Delta nef1 to Delta nef3-4) SIVmac239 nef. nef immune complexes were precipitated with anti-AU1 monoclonal antibody, washed extensively, resolved by SDS-12% PAGE, and transferred onto a membrane filter. CD8-TCRzeta coimmunoprecipitated with nef was detected by the anti-TCRzeta monoclonal antibody (upper panel). Expression of the full-length or the truncated SIVmac239 nef proteins in the corresponding transfected Cos 18 cells was detected by separating the whole-cell lysates in an SDS-12% polyacrylamide gel, transferring onto a nylon membrane, and probing with the anti-AU1 monoclonal antibody (lower panel).

The nef gene of SIVsm strain H4 (25) was also AU1 tagged and cloned into the pFJ expression vector. Coprecipitation of authentic TCRzeta with nef was examined following electroporation into Jurkat T cells. The endogenous TCRzeta coprecipitated with both SIVmac239 nef and SIVsmH4 nef (Fig. 5). In contrast, AU1-tagged nef from HIV-1 strain NL4-3 did not associate with TCRzeta in these assays (Fig. 5).


View larger version (50K):
[in this window]
[in a new window]
 
FIG. 5.   SIV nef interacts with the endogenous TCRzeta in Jurkat cells. Jurkat cells were electroporated with expression plasmids encoding SIVmac239 nef, SIVsmH4 nef, or HIV-1 NL4-3 nef (NL4-3) tagged with an AU1 epitope. After 20 h, cells were harvested and nef proteins were immunoprecipitated with anti-AU1 monoclonal antibody. Proteins coimmunoprecipitated with nef were analyzed by SDS-12% PAGE and immunoblotted onto a nylon membrane which was probed with the anti-TCRzeta monoclonal antibody (upper panel). Expression of the nef proteins was detected by separating the whole-cell lysates in an SDS-12% polyacrylamide gel and immunoblotting with the anti-AU1 monoclonal antibody (lower panel).

The central region of SIVmac239 nef is required to bind to TCRzeta . In order to delineate the regions of nef responsible for binding to TCRzeta , a series of SIVmac239 nef deletion mutants was constructed and tested for binding to TCRzeta . All nef mutants contained aa 1 to 15 at the amino terminus for myristoylation. The deletion mutants were constructed with an AU1 tag at the carboxyl terminus and analyzed following transfection of Cos 18 cells. The cells were lysed and incubated with AU1 antibody; precipitated proteins were analyzed by SDS-12% PAGE, and the presence of CD8-TCRzeta was detected by reactivity of anti-TCRzeta monoclonal antibody with immunoblotted proteins (Fig. 4). As shown in the lower panel of Fig. 4, comparable amounts of the full-length and the truncated nef proteins were detected in the transfected Cos 18 cells. When analyzed without heating prior to the electrophoresis, Delta nef5 was detected, and the level of its expression was found to be similar to that of the control (not shown). Deletion of the amino terminus of nef from aa 16 to 97 (Delta nef2 in Fig. 1) did not affect the binding to CD8-TCRzeta (Fig. 4), suggesting that the amino-terminal region of nef which contains the putative SH2 binding motif and the acidic stretch may not be required for interaction with the TCRzeta . However, further deletion up to aa 133, including the putative PXXP motif and the potential PKC phosphorylation site (PKC1) (Delta nef3 in Fig. 1) resulted in the loss of binding to TCRzeta (Fig. 4). While extensive deletion at the amino-terminal region of nef did not affect its interaction with the TCRzeta , only minor deletion at the carboxyl terminus of the protein was tolerated (Delta nef4 versus Delta nef5 and Delta nef6; Fig. 1 and 4). A minimal construct containing only aa 98 to 235 and 1 to 15 (Delta nef2-4 in Fig. 1) was shown to bind CD8-TCRzeta in these assays (Fig. 4). Thus, we have mapped aa 98 to 235 as a minimal region in nef of SIVmac239 capable of interacting with the TCRzeta .

SIV nef and HIV-2 nef, but not HIV-1 nef, associate with TCRzeta . The failure of TCRzeta to bind to GSTnef from HIV-1 strain SF2 (Fig. 3) and to coimmunoprecipitate with nef from HIV-1 strain NL4-3 in transfected Jurkat cells (Fig. 5) prompted us to investigate further this apparent restriction in specificity. We expressed AU1-tagged nef from five different HIV-1 isolates and analyzed their association with CD8-TCRzeta in transfected Cos 18 cells. NL4-3 and SF2 nef were derived from two laboratory strains of HIV-1, whereas Rulda nef was derived from a primary clinical isolate. nef-153 and nef-259 are derivatives of NL4-3 nef from monkeys with progressive disease following infection by SHIVnef chimeras (16a). Expression plasmids containing these HIV-1 nef genes were transfected into Cos 18 cells, and TCRzeta was detected in immunoprecipitates with TCRzeta monoclonal antiserum as described for the above experiments. In contrast to nef of SIVmac239, which coimmunoprecipitated the TCRzeta , none of the HIV-1 nefs associated with the TCRzeta (Fig. 6, upper panel). Failure to coprecipitate the TCRzeta was not due to instability or inefficient expression of the HIV-1 nef genes, since comparable amounts of the nef proteins were detected in the HIV-1 and the SIV nef-transfected cells (Fig. 6, lower panel).


View larger version (71K):
[in this window]
[in a new window]
 
FIG. 6.   HIV-1 nef does not associate with TCRzeta . Cos 18 cells were transfected with expression plasmids encoding SIVmac239 or HIV-1 nef tagged with an AU1 epitope. nef immune complexes were precipitated with anti-AU1 monoclonal antibody. Immunoprecipitation complexes were washed extensively, separated by SDS-12% PAGE, and transferred onto a nylon membrane which was probed with the anti-TCRzeta monoclonal antibody (upper panel). Expression of the nef proteins in the corresponding transfected Cos 18 cells was detected by separating the whole-cell lysates in an SDS-12% polyacrylamide gel, immunoblotting onto a nylon membrane, and probing with the anti-AU1 monoclonal antibody (lower panel). Lanes: 1, mock transfected; 2, wild-type SIVmac239 nef; 3 and 4, HIV nef obtained from two animals (259 and 153, respectively) infected with a recombinant SIV in which the SIV nef gene was replaced by the HIV NL4-3 nef allele (SHIVnef); 5, HIV nef derived from a primary clinical isolate (Rulda); 6, HIV-1 SF2 nef; and 7, HIV-1 NL4-3 nef.

Proteins which have low affinity binding and transient interaction might evade detection by the coimmunoprecipitation technique. Yeast two-hybrid systems have been shown to detect protein-protein interactions which were not detected by other conventional methods (19, 45, 59). We thus cotransformed S. cerevisiae Y190 with pAD-cDNA69 and hybrid expression plasmids containing the GAL4 DNA binding domain fused to the nef genes of various HIV-1, SIV, and HIV-2 isolates. As shown in Fig. 7, specific interactions of TCRzeta and nef resulting in the production of beta -galactosidase were found in yeast cells cotransformed with pAD-cDNA69 and pBD-Nef derived from SIVsmH4, SIVmac239, and HIV-2ST, whereas neither pBD-NL4-3nef and pAD-cDNA69 nor pBD-consnef and pAD-cDNA69 enabled the yeast cells to grow well in the presence of the selective medium or to produce beta -galactosidase, consistent with the results obtained in the coimmunoprecipitation experiment. Similar negative results were obtained when a consensus HIV-1 nef sequence was used (Fig. 7).


View larger version (51K):
[in this window]
[in a new window]
 
FIG. 7.   SIV and HIV-2 nef, but not HIV-1 nef, associates with TCRzeta in yeast cells. S. cerevisiae Y190 was cotransformed with hybrid plasmid encoding the fusion protein of the GAL4 DNA binding domain and the HIV-1 consensus nef (pBD-consnef), HIV-1 NL4-3 nef (pBD-NL4-3), SIVsmH4 nef (pBD-SIVsmH4), SIVmac239 nef (pBD-SIVmac239), or HIV-2 ST nef (pBD-HIV-2ST) alone (left panel) or in combination with the pAD-cDNA69 (right panel). Transformed yeast cells were plated onto -L-Y-H+3AT plates, and colonies were assayed for the production of beta -galactosidase (blue). The top panel indicates the positive and negative controls with the yeast cells transformed with expression plasmids of pVA3-1 (p53) and pTD1-1 (SV40 T-Ag), vectors with no inserts (pBD+pAD), or pAD-cDNA69 (TCRzeta ) alone.

Tyrosine kinase activity in nef complexes. Protein tyrosine phosphorylation is one of the earliest biochemical events elicited by stimulation of B-cell receptor (BCR) and TCR in B and T cells, respectively (10, 29). Neither the BCR nor the TCR has intrinsic tyrosine kinase activity; both appear to interact with cytoplasmic protein tyrosine kinase (PTK). Three cytoplasmic PTKs (lck, fyn, and ZAP70) have been implicated in intracellular TCR signal transduction (11, 12, 48, 58). In the ensuing experiment, we asked if the nef-TCRzeta complex coprecipitated with a PTK. Immobilized GSTnef from SIVmac239 was incubated with the Jurkat cell lysate as described previously. After extensive washing, the coprecipitation complexes were incubated under the conditions for assay of kinase activity in the presence or absence of ATP. The reaction products were analyzed by SDS-12% PAGE and immunoblotted onto a nylon membrane. Tyrosine-phosphorylated proteins were detected with an antiphosphotyrosine antibody. In the sample supplied with ATP, two major bands with migration corresponding to the molecular weights of GSTnef and TCRzeta were detected by phosphotyrosine-specific antiserum (Fig. 8, upper panel, lane 2). The presence of TCRzeta was confirmed when the same blot was reprobed with TCRzeta -specific antiserum (Fig. 8, lower panel, lane 2). In contrast, tyrosine phosphorylation of the protein band with a molecular weight similar to that of GSTnef was not detected in the sample without the addition of ATP (Fig. 8, upper panel, lane 3). No tyrosine phosphorylation was observed in the samples without prior incubation with the Jurkat cell lysate (Fig. 8, lanes 7 and 8).


View larger version (67K):
[in this window]
[in a new window]
 
FIG. 8.   TCRzeta -nef complex contains tyrosine kinase activity. Affinity-purified and immobilized recombinant GST or GSTnef was incubated in the presence of Jurkat T or J.CAM1.6 cell lysates previously precleared with immobilized GST and glutathione-Sepharose beads. Complexes precipitated with GSTnef were washed extensively and incubated in kinase buffer in the presence or absence of ATP. The reaction products were analyzed by SDS-12% PAGE, transferred onto a nylon membrane, and probed with antiphosphotyrosine monoclonal antibody. As negative controls, GST and recombinant GSTnef were purified from the bacterial lysates and assayed directly for kinase activity without prior incubation with the cell extracts (upper panel). To confirm the presence of TCRzeta in the coprecipitation complexes, antibodies were stripped and the filter was reprobed with the anti-TCRzeta monoclonal antibody (lower panel).

Next, we examined if the tyrosine kinase activity present in the nef-TCRzeta complex might be dependent on lck. In vitro binding assays with GST or GSTnef were performed in the presence of extracts prepared from J.CAM1.6 cells, a Jurkat-derived mutant cell line which lacks a functional lck but has equivalent amounts of ZAP70, TCR, and TCRzeta proteins (22, 29). As shown in Fig. 8, lower panel, GSTnef precipitated TCRzeta from the lysates of Jurkat cells and J.CAM1.6 cells (lanes 2, 3, 5, and 6). However, tyrosine phosphorylation activity was detected only in complexes prepared from the Jurkat cell lysate but not in the ones prepared from the J.CAM1.6 cell lysate (Fig. 8, upper panel, compare lane 2 with lane 5). This result suggested that binding of nef to TCRzeta is independent of any prior tyrosine phosphorylation of TCRzeta and that the tyrosine kinase coprecipitated with the nef-TCRzeta complex is dependent on the presence of a functional lck.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The TCR is a multimolecular complex containing the polymorphic TCR alpha  and beta  subunits, the invariant CD3 gamma , delta , and varepsilon  chains, and a homodimer of zeta  chains or, in a minority of receptors, a heterodimer of zeta  and eta  chains (4, 13, 20). The disulfide-linked TCR alpha  and beta  heterodimer is responsible for antigen recognition, but the short, 5-aa cytoplasmic domains of the TCR alpha  and beta  subunits are insufficient to couple to the intracellular signaling molecules. In contrast, the zeta  chain has an extracellular region of only 9 aa but an extensive intracellular domain of 113 aa (60). Using a chimeric protein consisting of the extracellular and transmembrane domains of CD8 fused to the cytoplasmic domain of the zeta  chain, Irving and Weiss elegantly showed that this fusion protein could elicit transducing signals indistinguishable from those generated by the intact TCR (28). One characteristic feature of the zeta  chain is the presence of the immunoreceptor tyrosine-based activation motif (ITAM) (EX2YX2L/IX7YX2L/I), which is crucial for zeta  chain coupling to the intracellular tyrosine kinases and adapter proteins and, hence, is absolutely required for all subsequent TCR signaling responses (8, 12, 41). Phosphorylated ITAM sequences function as SH2 binding domains (27, 44). One of the earliest biochemical events in TCR signaling is the activation of the src family tyrosine kinase lck, which in turn recruits various enzymes and signaling molecules leading to an altered pattern of gene expression and cellular activation (9-11, 40).

We used a truncated SIVmac239 nef as bait to screen an activated lymphocyte cDNA library in a yeast two-hybrid system. We identified TCRzeta as one of the cellular proteins associating with nef. The clone that was identified in the screen actually differed from the published sequence of TCRzeta (61) at three amino acid positions. The reasons for this are not clear. However, specific binding of nef to authentic TCRzeta present in Jurkat cells and to authentic TCR sequences present in the CD8-TCRzeta fusion in Cos 18 cells was demonstrated. Binding of TCRzeta to full-length nef was demonstrated in vitro (Fig. 3) and in cells coexpressing TCRzeta and nef (Fig. 4, 5, and 6). The association with TCRzeta was specific for SIVmac, SIVsm, and HIV-2 nef but was not observed with HIV-1 nef. In addition, the nef-TCRzeta complex coprecipitated active tyrosine kinase, which is present in Jurkat cells but not in J.CAM1.6 cells lacking a functional Lck. Finally, using a series of amino- and carboxyl-terminal deletion mutants of SIVmac239 nef, we mapped the central core region (aa 98 to 235) of nef responsible for binding to the zeta  chain.

We can speculate that the binding of SIV nef to TCRzeta might be related to reported activities of nef in causing T-lymphocyte activation. An unusual nef allele of SIV, called Y nef, is responsible for causing activation of primary lymphocytes in culture and an unusually acute disease course in monkeys (17, 18). Natural nef alleles of both SIV and HIV allow virus replication in an IL-2-dependent cell line and activate the production of IL-2 from these cells (3). HIV-1 nef was earlier reported to cause activation signals in Jurkat cells (6). HIV-1 nef has a highly conserved SH3 binding element, PXXPXXP, which is principally but not exclusively responsible for binding to src family kinases (34). SIV and HIV-2 nefs have a single PXXP element, and, although these can bind src family kinases, they appear to do so less well than HIV-1 nefs (14, 18, 46). Perhaps HIV-1 nef can influence signaling by direct interaction with src family kinases through the highly conserved PXXPXXP SH3 binding domain, while nef of SIVmac, SIVsm, and HIV-2, as an alternative means to the same end, may interact first with TCRzeta . The interaction of nef with a TCRzeta -kinase complex could result in tyrosine phosphorylation of nef, perhaps on a conserved YXXL sequence near the amino terminus which resembles an SH2 binding domain, and this could in turn result in recruitment of other tyrosine kinases through the phosphorylated SH2 binding domain. Thus, the picture that emerges from this scenario is that both HIV-1 nef and SIVmac, SIVsm, and HIV-2 nef may affect signaling through tyrosine kinases but that they may rely on a slightly different combination of cellular partners and binding domains to achieve these ends.

    ACKNOWLEDGMENTS

We thank Dean Regier and Kim Deary for assistance in the DNA sequencing, Joanne Newton for manuscript preparation, and Kristen Toohey for photography support.

This work was supported by PHS grants AI25328, AI38559, and RR00168.

    FOOTNOTES

* Corresponding author. Mailing address: New England Regional Primate Research Center, Harvard Medical School, One Pine Hill Dr., Box 9102, Southborough, MA 01772-9102. Phone: (508) 624-8042. Fax: (508) 624-8190. E-mail: ronald_desrosiers{at}hms.med.harvard.edu.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Aiken, C., J. Konner, N. R. Landau, M. E. Lenburg, and D. Trono. 1994. Nef induces CD4 endocytosis: requirement for a critical dileucine motif in the membrane-proximal CD4 cytoplasmic domain. Cell 76:853-864[Medline].
2. Aiken, C., and D. Trono. 1995. Nef stimulates human immunodeficiency virus type 1 proviral DNA synthesis. J. Virol. 69:5048-5056[Abstract].
3. Alexander, L., Z. Du, M. Rosenzweig, J. J. Jung, and R. C. Desrosiers. 1997. A role for natural SIV and HIV nef alleles in lymphocyte activation. J. Virol. 71:6094-6099[Abstract].
4. Baniyash, M., P. Garcia-Morales, J. S. Bonifacino, L. E. Samelson, and R. D. Klausner. 1988. Disulfide linkage of the zeta  and eta  chains of the T cell receptor. J. Biol. Chem. 263:9874-9878[Abstract/Free Full Text].
5. Baur, A. S., G. Sass, B. Laffert, D. Willbold, C. Cheng-Mayer, and B. M. Peterlin. 1997. The N-terminus of nef from HIV-1/SIV associates with a protein complex containing lck and a serine kinase. Immunity 6:283-291[Medline].
6. Baur, A. S., E. T. Sawai, P. Dazin, W. J. Fanti, C. Cheng-Mayer, and B. M. Peterlin. 1994. HIV-1 nef leads to inhibition or activation of T cells depending on its intracellular localization. Immunity 1:373-384[Medline].
7. Benichou, S., M. Bomsel, M. Bodeus, H. Durand, M. Doute, F. Letourneur, J. Camonis, and R. Benarous. 1994. Physical interaction of the HIV-1 nef protein with beta -cop, a component of non-clathrin-coated vesicles essential for membrane traffic. J. Biol. Chem. 269:30073-30076[Abstract/Free Full Text].
8. Cambier, J. C. 1995. Antigen and Fc receptor signaling: the awesome power of the immunoreceptor tyrosine-based activation motif (ITAM). J. Immunol. 155:3281-3285[Medline].
9. Cantrell, D. 1996. T cell antigen receptor signal transduction pathways. Annu. Rev. Immunol. 14:259-274[Medline].
10. Carrera, A. C., L. Rodriguez-Borlado, C. Martinez-Alonso, and I. Merida. 1994. T cell receptor associated alpha phosphatidylinositol 3-kinase becomes activated by T cell receptor cross linking and requires pp56(lck). J. Biol. Chem. 269:19435-19440[Abstract/Free Full Text].
11. Chan, A. C., D. M. Desai, and A. Weiss. 1994. The role of protein tyrosine kinases and protein tyrosine phosphatases in T cell antigen receptor signal transduction. Annu. Rev. Immunol. 12:555-592[Medline].
12. Chan, A. C., M. Iwashima, C. W. Turck, and A. Weiss. 1992. ZAP-70: A 70 kd protein-tyrosine kinase that associates with TCR zeta  chain. Cell 71:649-662[Medline].
13. Clevers, H., B. Alacron, Y. Willeman, and C. Terhorst. 1988. The T cell receptor/CD3 complex: a dynamic protein ensemble. Annu. Rev. Immunol. 6:629-662[Medline].
14. Collete, Y., H. Dutartre, A. Benziane, F. Ramos-Morales, R. Benarous, M. Harris, and D. Olive. 1996. Physical and functional interaction of nef with lck. J. Biol. Chem. 71:6333-6341.
15. Collins, K. L., B. K. Chen, S. A. Kalams, B. D. Walker, and D. Baltimore. 1998. HIV-1 nef protein protects infected primary cells against killing by cytotoxic T lymphocytes. Nature 391:397-401[Medline].
16. Deacon, N. J., A. Tsykin, A. Solomon, K. Smith, M. Ludford-Menting, D. J. Hooker, D. A. Pchee, A. L. Greenway, A. Ellett, C. Chatfield, V. A. Lawson, S. Crowe, A. Maerz, S. Sonza, J. Learmont, J. S. Sullivan, A. Cuuningham, D. Dwyer, D. Downton, and J. Mills. 1995. Genomic structure of an attenuated quasi species of HIV-1 from a blood transfusion donor and recipients. Science 270:988-991[Abstract/Free Full Text].
16a. Du, Z., L. Alexander, A. Y. M. Howe, and R. C. Desrosiers. Unpublished data.
17. Du, Z., P. O. Ilysinskii, V. G. Sasseville, A. A. Lackner, and R. C. Desrosiers. 1996. Requirements for lymphocyte activation by unusual strains of simian immunodeficiency virus. J. Virol. 70:4157-4161[Abstract].
18. Du, Z., S. M. Lang, V. G. Sasseville, A. A. Lackner, P. O. Ilyinskii, M. D. Daniel, J. J. Jung, and R. C. Desrosiers. 1995. Identification of a nef allele that causes lymphocyte activation and acute disease in macaque monkeys. Cell 82:665-674[Medline].
19. Durfee, T., K. Becherer, P. L. Chen, S. H. Yeh, Y. Yang, A. E. Kilburn, W. H. Lee, and S. J. Elledge. 1993. The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit. Genes Dev. 7:555-569[Abstract/Free Full Text].
20. Frank, S. J., L. E. Samelson, and R. D. Klausner. 1990. The structure and signaling function of the invariant T cell receptor components. Semin. Immunol. 2:89-97[Medline].
21. Garcia, J. A., and A. D. Miller. 1991. Serine phosphorylation independent downregulation of cell-surface CD4 by nef. Nature 350:508-551[Medline].
22. Goldsmith, M. A., and A. Weiss. 1987. Isolation and characterization of a T-lymphocyte somatic mutant with altered signal transduction by the antigen receptor. Proc. Natl. Acad. Sci. USA 84:6879-6883[Abstract/Free Full Text].
23. Greenway, A., A. Azad, and D. McPhee. 1995. Human immunodeficiency virus type 1 nef protein inhibits activation pathways in peripheral blood mononuclear cells and T-cell lines. J. Virol. 69:1842-1850[Abstract].
24. Greenway, A., A. Azad, J. Mills, and D. McPhee. 1996. Human immunodeficiency virus type 1 nef binds directly to lck and mitogen-activated protein kinase, inhibiting kinase activity. J. Virol. 70:6701-6708[Abstract/Free Full Text].
25. Hirsch, V. M., R. A. Olmstead, M. Murphu-Corb, R. M. Purcell, and P. R. Johnson. 1989. An African primate lentivirus (SIVsm) closely related to HIV-2. Nature 339:389-392[Medline].
26. Iafrate, A. J., S. Bronson, and J. Skowronski. 1997. Separable functions of Nef disrupt two aspects of T cell receptor machinery: CD4 expression and CD3 signaling. EMBO 16:673-684[Medline].
27. Irving, B. A., A. C. Chan, and A. Weiss. 1993. Functional characterization of a signal transducing motif present in the T cell antigen receptor zeta  chain. J. Exp. Med. 177:1093-1103[Abstract/Free Full Text].
28. Irving, B. A., and A. Weiss. 1991. The cytoplasmic domain of the T cell receptor zeta  chain is sufficient to couple to receptor-associated signal transduction pathways. Cell 64:891-901[Medline].
29. Iwashima, M., B. A. Irving, N. S. C. van Oers, A. C. Chan, and A. Weiss. 1994. Sequential interactions of the TCR with two distinct cytoplasmic tyrosine kinases. Science 263:1136-1139[Abstract/Free Full Text].
30. Jung, J. U., S. M. Lang, U. Friedrich, T. Jun, T. M. Roberts, R. C. Desrosiers, and B. Biesinger. 1995. Identification of lck-binding elements in tip of herpesvirus saimiri. J. Biol. Chem. 270:20660-20667[Abstract/Free Full Text].
31. Kestler, H. W., III, D. J. Ringler, K. Mori, D. L. Panicali, P. K. Schgal, M. D. Daniel, and R. C. Desrosiers. 1991. Importance of the nef gene for maintenance of high virus loads and for development of AIDS. Cell 65:651-662[Medline].
32. Kirchoff, F., T. C. Greenoug, D. B. Brettler, J. L. Sullivan, and R. C. Desrosiers. 1995. Absence of intact nef sequences in a long-term survivor with non-progressive HIV-1 infection. N. Engl. J. Med. 332:228-232[Free Full Text].
33. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline].
34. Lee, C.-H., B. Leung, M. A. Lemmon, J. Zheng, D. Cowburn, J. Kuriyan, and K. Saksela. 1995. A single amino acid in the SH3 domain of Hck determines its high affinity and specificity in binding to HIV-1 nef protein. EMBO 14:5006-5015[Medline].
35. Li, B., and S. Fields. 1993. Identification of mutations in p53 that affect its binding to SV40 large T antigen by using the yeast two-hybrid system. FASEB 7:957-963[Abstract].
36. Liu, L. X., F. Margottin, S. Le Gall, O. Schwartz, L. Selig, R. Benarous, and S. Benichou. 1997. Binding of HIV-1 nef to a novel thioesterase enzyme correlates with nef-mediated CD4 down-regulation. J. Biol. Chem. 272:13779-13785[Abstract/Free Full Text].
37. Lu, X., X. Wu, A. Plemenitas, H. Yu, E. T. Sawai, A. Abo, and B. M. Peterlin. 1996. CDC42 and Rac1 are implicated in the activation of the nef-associated kinase and replication of HIV-1. Curr. Biol. 12:1677-1684.
38. Miller, M. D., M. T. Warmerdam, I. Gaston, W. C. Green, and M. B. Feinberg. 1994. The human immunodeficiency virus-1 nef gene product: a positive factor for viral infection and replication in primary lymphocytes and macrophages. J. Exp. Med. 179:101-113[Abstract/Free Full Text].
39. Niederman, T. M., W. R. Hastings, S. Luria, and L. Ratner. 1993. Human immunodeficiency virus type 1 nef protein inhibits NF-kB induction in human T cells. Virology 194:338-344[Medline].
40. Northrop, J. P., S. N. Ho, L. Chen, D. J. Thomas, L. A. Timmerman, G. P. Nolan, A. Admon, and G. R. Crabtree. 1994. NF-AT components define a family of transcription factor targeted in T-cell activation. Nature 369:497-502[Medline].
41. Ravichandran, K. S., K. K. Lee, Z. Songyang, L. C. Cantley, P. Burn, and S. J. Burakoff. 1993. Interaction of Shc with the zeta chain of the T-cell receptor upon T cell activation. Science 262:902-905[Abstract/Free Full Text].
42. Regier, D. A., and R. C. Desrosiers. 1990. The complete nucleotide sequence of a pathogenic molecular clone of simian immunodeficiency virus. AIDS Res. Hum. Retroviruses 6:1221-1231[Medline].
43. Rhee, S. S., and J. W. Marsh. 1994. Human immunodeficiency virus type 1 nef-induced down-modulation of CD4 is due to rapid internalization and degradation of surface CD4. J. Virol. 68:5156-5163[Abstract/Free Full Text].
44. Romeo, C., M. Amiot, and B. Seed. 1992. Sequence requirements for induction of cytolysis by the T cell antigen Fc receptor zeta  chain. Cell 68:889-897[Medline].
45. Rossi, F., A. Gallina, and G. Milanes. 1996. Nef-CD4 physical interaction sensed with the yeast two-hybrid system. Virology 217:397-403[Medline].
46. Saksela, K., G. Cheng, and D. Baltimore. 1995. Proline-rich (PxxP) motifs in HIV-1 nef bind to SH3 domains of a subset of Src kinases and are required for the enhanced growth of Nef+ viruses but not for downregulation of CD4. EMBO 14:484-491[Medline].
47. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
48. Samelson, L. E., and R. D. Klausner. 1992. Tyrosine kinases and tyrosine-based activation motifs. Current research on activation via the T cell antigen receptor. J. Biol. Chem. 267:24913-24916[Free Full Text].
49. Samuel, K., D. R. Hodge, Y.-M. A. Chen, and T. S. Papas. 1991. Nef proteins of the human immunodeficiency viruses (HIV-1 and HIV-2) and simian immunodeficiency virus (SIV) are structurally similar to leucine zipper transcriptional activation factors. AIDS Res. Hum. Retroviruses 7:697-706[Medline].
50. Sanfridson, A., B. R. Cullen, and C. Doyle. 1994. The simian immunodeficiency virus nef protein promotes degradation of CD4 in human T cells. J. Biol. Chem. 269:3917-3920[Abstract/Free Full Text].
51. Sawai, E. T., A. Baur, H. Struble, B. M. Peterlin, J. A. Levy, and C. Cheng-Mayer. 1994. Human immunodeficiency virus type I nef associates with a cellular serine kinase in T lymphocytes. Proc. Natl. Acad. Sci. USA 91:1539-1543[Abstract/Free Full Text].
52. Schwartz, O., V. Marechal, S. Le Gall, F. Lemonnier, and J. M. Heard. 1996. Endocytosis of MHC-1 molecules is induced by HIV-1 nef. Nat. Med. 2:338-342[Medline].
53. Shugars, D. C., M. S. Smith, D. H. Glueck, P. V. Nantermet, F. Seillier-Moiseiwitsch, and R. Swanstrom. 1993. Analysis of human immunodeficiency virus type 1 nef gene sequences present in vivo. J. Virol. 67:4639-4650[Abstract/Free Full Text].
54. Skowronski, J., D. Parks, and R. Mariani. 1993. Altered T cell activation and development in transgenic mice expressing the HIV-1 nef gene. EMBO 12:703-713[Medline].
55. Smith, B. L., B. W. Krushelnycky, D. Mochly-Rosen, and P. Berg. 1996. The HIV nef protein associates with protein kinase C theta. J. Biol. Chem. 271:16753-16757[Abstract/Free Full Text].
56. Spina, C. A., T. J. Kwoh, M. Y. Chowers, J. C. Guatelli, and D. D. Richman. 1994. The importance of nef in the induction of human immunodeficiency virus type 1 replication from primary quiescent CD4 lymphocytes. J. Exp. Med. 179:115-123[Abstract/Free Full Text].
57. Terwilliger, E., J. G. Sodroski, C. A. Rosen, and W. A. Haseltine. 1986. Effects of mutations with the 3' orf open reading frame region of human T-cell lymphotropic virus type III (HTLV-III/LAV) on replication and cytopathogenicity. J. Virol. 60:754-760[Abstract/Free Full Text].
58. Thome, M., P. Duplay, M. Guttinger, and O. Acuto. 1997. Syk and ZAP70 mediate recruitment of p56lck/CD4 to the activated T cell receptor/CD3/zeta complex. J. Exp. Med. 181:1997-2006[Abstract/Free Full Text].
59. Vojtek, A. B., S. M. Hollenberg, and J. A. Cooper. 1993. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell 74:205-214[Medline].
60. Weissman, A. M., M. Baniyash, D. Hou, L. E. Samelson, W. H. Burgess, and R. D. Klausner. 1988. Molecular cloning of the zeta chain of the T cell antigen receptor. Science 239:1018-1021[Abstract/Free Full Text].
61. Weissman, A. M., D. Hou, D. G. Orloff, W. S. Modi, H. Seuanez, S. J. O'Brien, and R. D. Klausner. 1988. Molecular cloning and chromosomal localization of the human T-cell receptor zeta  chain: distinction from the molecular CD3 complex. Proc. Natl. Acad. Sci. USA 85:9709-9713[Abstract/Free Full Text].


Journal of Virology, December 1998, p. 9827-9834, Vol. 72, No. 12
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Rudolph, J. M., Eickel, N., Haller, C., Schindler, M., Fackler, O. T. (2009). Inhibition of T-Cell Receptor-Induced Actin Remodeling and Relocalization of Lck Are Evolutionarily Conserved Activities of Lentiviral Nef Proteins. J. Virol. 83: 11528-11539 [Abstract] [Full Text]  
  • Munch, J., Rajan, D., Schindler, M., Specht, A., Rucker, E., Novembre, F. J., Nerrienet, E., Muller-Trutwin, M. C., Peeters, M., Hahn, B. H., Kirchhoff, F. (2007). Nef-Mediated Enhancement of Virion Infectivity and Stimulation of Viral Replication Are Fundamental Properties of Primate Lentiviruses. J. Virol. 81: 13852-13864 [Abstract] [Full Text]  
  • Brenner, M., Munch, J., Schindler, M., Wildum, S., Stolte, N., Stahl-Hennig, C., Fuchs, D., Matz-Rensing, K., Franz, M., Heeney, J., Ten Haaft, P., Swigut, T., Hrecka, K., Skowronski, J., Kirchhoff, F. (2006). Importance of the N-Distal AP-2 Binding Element in Nef for Simian Immunodeficiency Virus Replication and Pathogenicity in Rhesus Macaques. J. Virol. 80: 4469-4481 [Abstract] [Full Text]  
  • Brown, A., Gartner, S., Kawano, T., Benoit, N., Cheng-Mayer, C. (2005). HLA-A2 down-regulation on primary human macrophages infected with an M-tropic EGFP-tagged HIV-1 reporter virus. J. Leukoc. Biol. 78: 675-685 [Abstract] [Full Text]  
  • Munch, J., Schindler, M., Wildum, S., Rucker, E., Bailer, N., Knoop, V., Novembre, F. J., Kirchhoff, F. (2005). Primary Sooty Mangabey Simian Immunodeficiency Virus and Human Immunodeficiency Virus Type 2 nef Alleles Modulate Cell Surface Expression of Various Human Receptors and Enhance Viral Infectivity and Replication. J. Virol. 79: 10547-10560 [Abstract] [Full Text]  
  • Hrecka, K., Swigut, T., Schindler, M., Kirchhoff, F., Skowronski, J. (2005). Nef Proteins from Diverse Groups of Primate Lentiviruses Downmodulate CXCR4 To Inhibit Migration to the Chemokine Stromal Derived Factor 1. J. Virol. 79: 10650-10659 [Abstract] [Full Text]  
  • Hodara, V. L., Velasquillo, M. C., Parodi, L. M., Giavedoni, L. D. (2005). Expression of CD154 by a Simian Immunodeficiency Virus Vector Induces Only Transitory Changes in Rhesus Macaques. J. Virol. 79: 4679-4690 [Abstract] [Full Text]  
  • Hill, B. T., Skowronski, J. (2005). Human N-Myristoyltransferases Form Stable Complexes with Lentiviral Nef and Other Viral and Cellular Substrate Proteins. J. Virol. 79: 1133-1141 [Abstract] [Full Text]  
  • Swigut, T., Alexander, L., Morgan, J., Lifson, J., Mansfield, K. G., Lang, S., Johnson, R. P., Skowronski, J., Desrosiers, R. (2004). Impact of Nef-Mediated Downregulation of Major Histocompatibility Complex Class I on Immune Response to Simian Immunodeficiency Virus. J. Virol. 78: 13335-13344 [Abstract] [Full Text]  
  • Schindler, M., Munch, J., Brenner, M., Stahl-Hennig, C., Skowronski, J., Kirchhoff, F. (2004). Comprehensive Analysis of Nef Functions Selected in Simian Immunodeficiency Virus-Infected Macaques. J. Virol. 78: 10588-10597 [Abstract] [Full Text]  
  • Kirchhoff, F., Schindler, M., Bailer, N., Renkema, G. H., Saksela, K., Knoop, V., Muller-Trutwin, M. C., Santiago, M. L., Bibollet-Ruche, F., Dittmar, M. T., Heeney, J. L., Hahn, B. H., Munch, J. (2004). Nef Proteins from Simian Immunodeficiency Virus-Infected Chimpanzees Interact with p21-Activated Kinase 2 and Modulate Cell Surface Expression of Various Human Receptors. J. Virol. 78: 6864-6874 [Abstract] [Full Text]  
  • Brown, A., Moghaddam, S., Kawano, T., Cheng-Mayer, C. (2004). Multiple human immunodeficiency virus type 1 Nef functions contribute to efficient replication in primary human macrophages. J. Gen. Virol. 85: 1463-1469 [Abstract] [Full Text]  
  • Schindler, M., Wurfl, S., Benaroch, P., Greenough, T. C., Daniels, R., Easterbrook, P., Brenner, M., Munch, J., Kirchhoff, F. (2003). Down-Modulation of Mature Major Histocompatibility Complex Class II and Up-Regulation of Invariant Chain Cell Surface Expression Are Well-Conserved Functions of Human and Simian Immunodeficiency Virus nef Alleles. J. Virol. 77: 10548-10556 [Abstract] [Full Text]  
  • Swigut, T., Greenberg, M., Skowronski, J. (2003). Cooperative Interactions of Simian Immunodeficiency Virus Nef, AP-2, and CD3-{zeta} Mediate the Selective Induction of T-Cell Receptor-CD3 Endocytosis. J. Virol. 77: 8116-8126 [Abstract] [Full Text]  
  • Badran, B. M., Wolinsky, S. M., Burny, A., Willard-Gallo, K. E. (2002). Identification of Three NFAT Binding Motifs in the 5'-Upstream Region of the Human CD3gamma Gene That Differentially Bind NFATc1, NFATc2, and NF-kappa B p50. J. Biol. Chem. 277: 47136-47148 [Abstract] [Full Text]  
  • Munch, J., Janardhan, A., Stolte, N., Stahl-Hennig, C., ten Haaft, P., Heeney, J. L., Swigut, T., Kirchhoff, F., Skowronski, J. (2002). T-Cell Receptor:CD3 Down-Regulation Is a Selected In Vivo Function of Simian Immunodeficiency Virus Nef but Is Not Sufficient for Effective Viral Replication in Rhesus Macaques. J. Virol. 76: 12360-12364 [Abstract] [Full Text]  
  • Wieckowski, E., Wang, G.-Q., Gastman, B. R., Goldstein, L. A., Rabinowich, H. (2002). Granzyme B-mediated Degradation of T-Cell Receptor {zeta} Chain. Cancer Res. 62: 4884-4889 [Abstract] [Full Text]  
  • Ndolo, T., Dhillon, N. K., Nguyen, H., Guadalupe, M., Mudryj, M., Dandekar, S. (2002). Simian Immunodeficiency Virus Nef Protein Delays the Progression of CD4+ T Cells through G1/S Phase of the Cell Cycle. J. Virol. 76: 3587-3595 [Abstract] [Full Text]  
  • Simard, M.-C., Chrobak, P., Kay, D. G., Hanna, Z., Jothy, S., Jolicoeur, P. (2002). Expression of Simian Immunodeficiency Virus nef in Immune Cells of Transgenic Mice Leads to a Severe AIDS-Like Disease. J. Virol. 76: 3981-3995 [Abstract] [Full Text]  
  • Evans, D. T., Tillman, K. C., Desrosiers, R. C. (2002). Envelope Glycoprotein Cytoplasmic Domains from Diverse Lentiviruses Interact with the Prenylated Rab Acceptor. J. Virol. 76: 327-337 [Abstract] [Full Text]  
  • Bostik, P., Wu, P., Dodd, G. L., Villinger, F., Mayne, A. E., Bostik, V., Grimm, B. D., Robinson, D., Kung, H.-J., Ansari, A. A. (2001). Identification of Protein Kinases Dysregulated in CD4+ T Cells in Pathogenic versus Apathogenic Simian Immunodeficiency Virus Infection. J. Virol. 75: 11298-11306 [Abstract] [Full Text]  
  • Khatissian, E., Monceaux, V., Cumont, M.-C., Kieny, M.-P., Aubertin, A.-M., Hurtrel, B. (2001). Persistence of Pathogenic Challenge Virus in Macaques Protected by Simian Immunodeficiency Virus SIVmac{Delta}nef. J. Virol. 75: 1507-1515 [Abstract] [Full Text]  
  • Liu, L. X., Heveker, N., Fackler, O. T., Arold, S., Le Gall, S., Janvier, K., Peterlin, B. M., Dumas, C., Schwartz, O., Benichou, S., Benarous, R. (2000). Mutation of a Conserved Residue (D123) Required for Oligomerization of Human Immunodeficiency Virus Type 1 Nef Protein Abolishes Interaction with Human Thioesterase and Results in Impairment of Nef Biological Functions. J. Virol. 74: 5310-5319 [Abstract] [Full Text]  
  • Schaefer, T. M, Bell, I., Fallert, B. A., Reinhart, T. A. (2000). The T-Cell Receptor zeta Chain Contains Two Homologous Domains with Which Simian Immunodeficiency Virus Nef Interacts and Mediates Down-Modulation. J. Virol. 74: 3273-3283 [Abstract] [Full Text]  
  • Brown, A., Wang, X., Sawai, E., Cheng-Mayer, C. (1999). Activation of the PAK-Related Kinase by Human Immunodeficiency Virus Type 1 Nef in Primary Human Peripheral Blood Lymphocytes and Macrophages Leads to Phosphorylation of a PIX-p95 Complex. J. Virol. 73: 9899-9907 [Abstract] [Full Text]  
  • Kirchhoff, F., Munch, J., Carl, S., Stolte, N., Matz-Rensing, K., Fuchs, D., Ten Haaft, P., Heeney, J. L., Swigut, T., Skowronski, J., Stahl-Hennig, C. (1999). The Human Immunodeficiency Virus Type 1 nef Gene Can to a Large Extent Replace Simian Immunodeficiency Virus nef In Vivo. J. Virol. 73: 8371-8383 [Abstract] [Full Text]  
  • Alexander, L., Du, Z., Howe, A. Y. M., Czajak, S., Desrosiers, R. C. (1999). Induction of AIDS in Rhesus Monkeys by a Recombinant Simian Immunodeficiency Virus Expressing nef of Human Immunodeficiency Virus Type 1. J. Virol. 73: 5814-5825 [Abstract] [Full Text]  
  • Xu, X.-N., Laffert, B., Screaton, G. R., Kraft, M., Wolf, D., Kolanus, W., Mongkolsapay, J., McMichael, A. J., Baur, A. S. (1999). Induction of Fas Ligand Expression by HIV Involves the Interaction of Nef with the T Cell Receptor {zeta} Chain. JEM 189: 1489-1496 [Abstract] [Full Text]  
  • SKOWRONSKI, J., GREENBERG, M.E., LOCK, M., MARIANI, R., SALGHETTI, S., SWIGUT, T., IAFRATE, A.J. (1999). HIV and SIV Nef Modulate Signal Transduction and Protein Sorting in T Cells. Cold Spring Harb Symp Quant Biol 64: 453-464 [Abstract]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Howe, A. Y. M.
Right arrow Articles by Desrosiers, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Howe, A. Y. M.
Right arrow Articles by Desrosiers, R. C.