Previous Article | Next Article 
Journal of Virology, December 1998, p. 9827-9834, Vol. 72, No. 12
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Zeta Chain of the T-Cell Receptor Interacts with
nef of Simian Immunodeficiency Virus and Human Immunodeficiency
Virus Type 2
Anita Y. M.
Howe,
Jae U.
Jung, and
Ronald C.
Desrosiers*
New England Regional Primate Research Center,
Harvard Medical School, Southborough, Massachusetts 01772-9102
Received 6 July 1998/Accepted 2 September 1998
 |
ABSTRACT |
A truncated version of the nef gene of simian
immunodeficiency virus SIVmac239 capable of encoding amino acids 98 to
263 was used as bait to screen a cDNA library from activated
lymphocytes in a yeast two-hybrid system. The zeta chain of the T-cell
receptor (TCR
) was found to interact specifically not
only with truncated SIV nef in yeast cells but also with full-length
glutathione S-transferase (GST)-SIVnef fusion protein in
vitro. Coimmunoprecipitation of TCR
with full-length SIV
nef was demonstrated in transfected Jurkat cells and in Cos 18 cells
which express the cytoplasmic domain of TCR
fused to the
external domain of CD8 via the CD8 transmembrane domain. Using a series
of nef deletion mutants, we have mapped the binding site within the
central core domain of nef (amino acids 98 to 235). Binding of
TCR
was specific for nef isolated from SIVmac239,
SIVsmH4, and human immunodeficiency virus (HIV)-2ST and was not
detected with nef from five different HIV-1 isolates. An active
tyrosine kinase was coprecipitated with nef-TCR
complexes from Jurkat cells but not from J.CAM1.6 cells which lack a
functional Lck tyrosine kinase. These results demonstrate a specific
association of SIV and HIV-2 nef, but not HIV-1 nef, with
TCR
.
 |
INTRODUCTION |
A nef gene is found in
all subgroups of primate lentiviruses (49, 53).
nef is considered a nonessential auxiliary gene because it
can be deleted without dramatically affecting the ability of virus to
replicate in cell culture (31, 56, 57). Evidence for the
importance of nef for the efficiency of viral replication in
the intact organism and for the maintenance of high virus loads has
been derived both from studies with simian immunodeficiency virus (SIV)
in monkeys and from studies with human immunodeficiency virus type 1 (HIV-1) in humans. Monkeys infected with a derivative of a
pathogenic molecular clone of SIV from which nef gene
sequences were specifically removed maintain low or undetectable virus
loads and usually show no signs of disease progression
(31). Similarly, one human in central Massachusetts
(32) and several in Australia (16) are
infected with nef-deleted forms of HIV-1, and they too are long-term nonprogressors who maintain low viral loads. In Australia, a single blood donor clearly transmitted
nef-deleted HIV-1 to several recipients via blood donations,
and this virus clearly behaved with a markedly attenuated phenotype.
Information is beginning to emerge which suggests that nef may have
evolved a number of different, independent functional activities to
enhance the replication and survival of virus. These include
downregulation of the CD4 receptor from the surface of the cell
(1, 21, 43, 50), downregulation of major
histocompatibility complex class I molecules (52) which may
protect infected cells from killing by cytotoxic T lymphocytes
(15), infectivity enhancement (2, 38), and
lymphocyte activation (3, 6, 17, 18) or inhibition of
lymphocyte activation (23, 26, 39). Each of these functional
activities clearly involves interactions with the host cell. Finding
the cellular partners that couple with nef to achieve these functional
activities is important for defining the biochemical activities and
eventually delineating their relative importance. Cellular proteins
that have been found to couple with nef include src family kinase
(5, 14, 34, 46), a serine/threonine kinase (24, 37,
51), protein kinase C (PKC) theta (55),
-cop
(7), a thioesterase (36), and CD4
(45).
In this report, we describe the specific interaction of the zeta chain
of the T-cell receptor (TCR
) with nef of SIVmac, SIVsm,
and HIV-2. Specific binding to TCR
was not observed with
five different nef alleles of HIV-1. An active tyrosine kinase was
found to coprecipitate with the nef-TCR
complex,
suggesting that the interaction might influence T-cell signaling.
 |
MATERIALS AND METHODS |
Cell lines and plasmids.
The Jurkat human T-cell line and
the J.CAM1.6 cell line were obtained from the American Type Culture
Collection (Rockville, Md.) and grown in RPMI 1640 medium which
contained 25 mM HEPES, 10% fetal calf serum (Gibco/BRL, Grand Island,
N.Y.), penicillin-streptomycin (50 IU and 50 µg/ml, respectively),
and 2 mM L-glutamine (Gibco/BRL). Cos 18 cells were kindly
provided by A. Weiss (Howard Hughes Medical Institute, University of
California, San Francisco, Calif.) and maintained in Dulbecco's
modified Eagle's medium supplemented with 5% fetal calf serum, 0.4 mg
of G418 per ml, penicillin-streptomycin (50 IU and 50 µg/ml,
respectively), and 2 mM L-glutamine (Gibco/BRL). The 221 cell line was grown in RPMI 1640 medium supplemented with 5% fetal
calf serum, 10% interleukin-2 (IL-2), penicillin-streptomycin (50 IU
and 50 µg/ml, respectively), and 2 mM L-glutamine
(Gibco/BRL).
Plasmid pJSP4-27 containing the HIV-2 ST nef gene and
plconsnefSN were obtained from the AIDS Research and Reference Reagent Program (McKesson Bioservices, Rockville, Md.). pSIVsmH4 was obtained from V. Hirsch (National Institute of Allergy and Infectious Diseases, Rockville, Md.). pGEX2T-SF2nef was a gift from D. Baltimore
(Massachusetts Institute of Technology, Cambridge, Mass.).
Yeast two-hybrid screen.
Yeast two-hybrid screening was
performed according to the protocol suggested by the MATCHMAKER
TWO-HYBRID SYSTEM 2 (Clontech, Palo Alto, Calif.). nef hybrid
expression plasmid pBD-239
nef2 was constructed by fusing a truncated
SIVmac239 nef gene encoding amino acids (aa) 1 to 15 and aa
98 to 263 (
nef2; see Fig. 1) to the GAL4-DNA binding
domain in the pAS2-1 vector.
nef2 was used for the yeast two-hybrid
screen in order to minimize high, nonspecific backgrounds seen with the
full-length nef and because nef sequences missing aa 16 to 97 are still
capable of associating with a serine/threonine kinase (data not shown)
(51). A cDNA library from
phytohemagglutinin (PHA)-activated human
lymphocytes fused to the GAL4-DNA activation domain was
purchased from Clontech. The yeast strain Saccharomyces
cerevisiae Y190 (leu his trp auxotroph) harboring the two
reporter genes HIS3 and lacZ was
sequentially transformed with the nef hybrid expression plasmid and the
PHA-activated human lymphocyte cDNA library by using the lithium
acetate transformation method (Clontech). Double transformants were
plated onto synthetic medium agar plates lacking leucine, tryptophan,
and histidine in the presence of 3-amino-1,2,4-triazole
(
L
Y
H+3AT). After 10 days of incubation at 30°C,
His+ colonies were rescued and patched onto
L
Y
H+3AT
plates.
-Galactosidase activities in these His+ colonies
were tested by replica plating on nylon filters which were dipped into
liquid nitrogen, soaked in
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal) buffer, and incubated at room temperature for 3 to 5 h. Colonies of the LacZ+ clones were restreaked onto
L
Y
H+3AT plates to isolate single colony and were retested for
-galactosidase activity. Confirmed positive clones (His+
LacZ+) were grown in leucine-minus synthetic medium in the
presence of 10 µg of cycloheximide per ml for 5 days at 30°C
to counterselect pBD-239
nef2. Plasmids from the segregants
(Leu+ Trp
Cyhr) containing only
the pAD-cDNA were isolated, transformed into Escherichia
coli, and sequenced.
Yeast mating assay.
To verify specific interaction of nef
and the protein expressed by the cDNA clones, S. cerevisiae Y190 containing the pAD-cDNA was mated with another
strain, Y187, previously transformed with the pAS2-1 fused to the wild
type or the truncated SIV nef genes in complete YPD medium
for 18 h at 30°C. Diploid yeast cells were plated onto
L
Y
H+3AT plates and incubated for 5 days at 30°C. His and LacZ phenotypes were scored as described above.
Construction of Nef expression plasmids.
The plasmid
p239SpE3' containing the 3' half of the SIVmac239 open proviral genome
(42) was used as the template for the PCR amplification of
the truncated nef fragments.
nef1,
nef2, and
nef3
fragments were amplified by PCR by using the 5' primers AH1
(5'-GGAAGATCTGGGACAGTATATGAATACTCCATG-3'), AH2
(5'-GGAAGATCTGGGGGTATCAGTGAGGCCAAAA-3'), and AH3
(5'-GGAAGATCTGTACAGTGCAAGAAGACATAGA-3') and the
3' primer 3' NefPsIAU1
(5'-ACG CTGCAGTTATATATAGCGATAGGTGTCGCGAGTTTCCTTCTTGTCAGC- 3'),
respectively, which introduced the unique BglII and
PstI restriction sites (underlined) and a
sequence encoding an AU1 epitope tag (in boldface).
nef4,
nef5,
and
nef6 fragments were amplified by using the 5' primer
5'NefEcoRI (5'-GCGGAATTCATGGGTGGAGCTATTTCCATG-3') and the 3' primers
AH4 (5'-ACGCTGCAGTTATATATAGCGATAGGTGTCGCTTCCAAACTCTTCT GGGTA-3'),
AH5
(5'-ACGCTGCAGTTATATATAGCGATAGGTGTCTAGCCAGCCAAATGTCTTTGG-3'), and AH6
(5'-ACGCTGCAGTTATATATAGCGATAGGTGTCGTAACTCATTGTTCTTAGGGG-3'), respectively, which introduced the unique EcoRI and
PstI restriction sites (underlined) and an AU1 epitope (in
boldface).
nef2-4 and
nef3-4 were constructed by PCR
amplification of p239SPE3' with the 5' primers AH2 and AH3,
respectively, with the 3' primer AH4. The
nef1,
nef2,
nef3,
nef2-4, and
nef3-4 fragments digested with BglII and
PstI and the
nef4,
nef1, and
nef6 fragments digested with EcoRI and PstI were cloned into
pFJ-239nef (18) previously digested with the
corresponding enzymes to create pFJ
nef1, pFJ
nef2,
pFJ
nef3, pFJ
nef4, pFJ
nef5, pFJ
nef6, pFJ
nef2-4, and
pFJ
nef3-4.
To construct pFJSF2nef, the nef open reading frame (ORF) of
pGEX2T-SF2nef was amplified by PCR with 5'EcoRISF2
(5'-GTCCA
GAATTCGCCGCCATGGGTGGCAAGTGGTCAAAA-3')
and 3'PstIAU1SF2
(5'-ACG
CTGCAGTTATATATAGCGATAGGTGTCGCAGTCTTTGTAGTACTCCGG-3').
The PCR DNA fragment was digested with
EcoRI and
PstI and cloned
into pFJ expression vector
(
30) previously digested with the
similar restriction
enzymes to construct pFJSF2nef. pGST-SF2nef
was constructed by removal
of the SF2 nef DNA fragment from the
pFJSF2nef at the
EcoRI
and
XhoI sites and subcloned into a vector
pGEX-4T
(Pharmacia, Piscataway, N.J.). pGST-239nef was derived
from pFJ239nef
(
18) by restricting at the
EcoRI and
XhoI sites
and subcloned into the expression vector pGEX-4T.
The
nef ORFs of the plasmids pFJNL4-3nef, pFJSHIVnef-153,
and pFJSHIVnef-259 were generated by PCR amplification of pNL4-3
and of
proviral clones recovered from two animals infected with
a recombinant
SHIVnef virus (
16a). The primers used for PCR were
5'EcoRISF2 and 3'PstIAU1NL4-3
(5'-ACG
C TGCAGTTATATATAGCGATAGGTGTCGCAGTTCTTGAAGTACTCCGG-
3').
The PCR fragments were subsequently cloned into the expression
vector pFJ. pFJRulda was constructed in a similar manner by using
PCR
amplification from the proviral clone recovered from the animal
infected with SHIVnefRulda with primers 5'EcoRIRulda
(5'-GTCCA
GAATTCGCCGCCATGGGGGGCAAGTGGTCAAAA-3')
and 3'PstIAU1Rulda
(5'-ACG
CTGCAGTTATATATAGCGATAGGTGTCGTTCTTGAAGTACTCCGGATG-3').
pFJSIVsmH4nef and pFJHIV-2ST were constructed by PCR
amplification
of the plasmids pSIVsmH4 and pJSP4-27, respectively, with
primers
SmH45'EcoRI
(5'-GTCCA
GAATTCGCCGCCATGGGTGGCGCTATTTCCAAG-3')
and
SmH43'AU1PstI
(5'-AC G
CTGCAGTTATATATAGCGATAGGTGTCATCTGCCAGCCTCTCCGCAG
A-3')
for pFJSIVsmH4nef and primers 5'EcoRIHIV-2
(5'-CCGGAATTCATGGGGGCGAGTGGATCCAAGAAG-3')
and 3'PSTIAU1HIV-2
(5'-ACG
CTGCAGTTATATATAGCGATAGGTGTC)
for pFJHIV-2ST. The PCR fragments were digested with
EcoRI and
PstI and cloned into pFJ digested with
the similar
enzymes.
The nef ORF of the consensus nef was amplified from pJSP4-27 by PCR
with primers 5'XEConsef
(5'-CTTCAG
TCTAGAATTCGCCACCATGGGTGGCAAG-3')
and
3'BamHIConsnef
(5'-CGC
GGATCCTTATATATAGCGATAGGTGTCGCAGTCTTTGTAGTACTCCGGATG-3').
The PCR DNA fragment was cloned into pFJ previously digested with
EcoRI and
BglII to form pFJconsnef. Each mutant
form of nef was
completely sequenced to verify the presence of the
mutation and
the absence of any other
changes.
All hybrid expression plasmids used for the yeast transformation were
derived from the corresponding pFJ-nef expression plasmids
with
digestion at the
EcoRI and
PstI sites and cloned
into the
pAS2-1 vector
(Clontech).
Expression and purification of recombinant glutathione
S-transferase (GST)-fusion protein.
Ten milliliters of
overnight cultures of E. coli transformed with pGEX-4T or
recombinant plasmids were diluted 1:20 with fresh medium and grown for
2 h at 37°C before inducing with 0.5 mM
isopropyl-
-D-thiogalactopyranoside (IPTG). After a
further 6 h of incubation, the cells were pelleted and resuspended
in 10 ml of bacteria lysis buffer containing 1% Triton X-100, 0.1%
N-lauryl sarconsinate, 0.1 mM phenylmethylsulfonyl fluoride
(PMSF), 0.1% aprotinin, and 1 µg of leupeptin per ml in
phosphate-buffered saline (PBS). Cells were lysed by sonication followed by centrifugation at 10,000 × g for 5 min at
4°C. The cell pellets were sonicated again and centrifuged at
10,000 × g for 15 min at 4°C. The supernatant was
collected and incubated with 500 µl of the preswollen
glutathione-Sepharose beads (Pharmacia) for 2 h at 4°C. The
beads were washed three times with ice-cold PBS and stored at 4°C.
In vitro binding assay.
A total of 107 cells
were lysed in 1 ml of cell lysis buffer (0.5% Nonidet P-40, 50 mM
HEPES [pH 7.5], and 150 mM NaCl) containing 2 mM
NaVO3, 10 mM NaF, 1 mM PMSF, 1 µg of leupeptin per ml,
and 1% aprotinin (Sigma Chemical, St. Louis, Mo.). The cell lysates were centrifuged at 13,000 × g for 30 min at 4°C.
The supernatant was mixed with 30 µl of the glutathione-Sepharose
beads (beads) and 20 µl of the immobilized GST (GST beads; 5 mg/ml)
and incubated for 30 min at 4°C. Precleared cell extracts were
incubated with approximately 30 µg of the soluble GST and 10 µl of
the immobilized GSTnef fusion proteins or GST beads (all loaded beads
contained approximately 2 mg of protein per ml) for 3 h at 4°C.
The coprecipitated proteins were washed three times with ice-cold lysis
buffer, boiled in Laemmli sample treatment buffer (33) for 5 min, separated by sodium dodecyl sulfate (SDS)-10% polyacrylamide gel
electrophoresis (PAGE) and electroblotted onto the Immobilon membrane
(Millipore, Bedford, Mass.). Immunodetection was performed with a
1:3,000 dilution of anti-TCR
mouse monoclonal antibody
(Santa Cruz Biotechnology, Santa Cruz, Calif.) and developed by the
enhanced chemiluminescence (ECL) system with procedures suggested by
the manufacturer (Amersham, Chicago, Ill.).
Association of tyrosine kinase with the nef coprecipitation complex was
performed by procedures similar to those described
above, except that
the coprecipitated complexes were washed three
times with the cell
lysis buffer and once with the kinase buffer
(50 mM Tris-HCl [pH 7.4]
and 10 mM MgCl
2). In vitro kinase reaction
with the
coprecipitated proteins was carried out in the presence
of the kinase
buffer and 1 mM ATP (final volume, 20 µl) for 30
min at room
temperature. Tyrosine-phosphorylated proteins were
analyzed by SDS-10%
PAGE, transferred onto the Immobilon membrane
(Millipore), and
immunodetected by the antiphosphotyrosine mouse
monoclonal antibody
4G10 (immunoglobulin G2b [IgG2b]; 1:10,000
dilution; Upstate
Biotechnology Inc., Lake Placid, N.Y.). The
immunoblot was
developed by the ECL
system.
Transfection, immunoprecipitation, and immunoblotting.
Cos
18 cells were transfected with 5 µg of the nef expression plasmids by
the standard DEAE-dextran method (47). Cells were harvested
48 h after transfection and lysed with 1 ml of the cell lysis
buffer containing a cocktail of protease inhibitors as described above.
The cell lysates were cleared by centrifugation at 13,000 × g for 30 min at 4°C and divided into aliquots of 50 and
950 µl, respectively. The aliquot containing 50 µl of the cell
lysate was used for the analysis of nef protein expression, while the aliquot containing 950 µl of the cell lysate was used for the immunoprecipitation. Immunoprecipitation was performed by adding 1 µl
of anti-AU1 mouse monoclonal antibody (BABCO Biotech, Berkeley, Calif.)
and 30 µl of protein A-agarose (Santa Cruz Biotechnology) to the cell
lysates. The suspension mixtures were rocked at 4°C for 3 h, and
the immune complexes were washed three times with the cell lysis buffer
and once with 50 mM Tris-HCl (pH 7.4). Immunoprecipitated proteins were
separated by SDS-10% PAGE, transferred onto the Immobilon membrane
(Millipore), and reacted with the anti-TCR
mouse
monoclonal antibody (diluted 1:3,000; Santa Cruz Biotechnology), and
detected by the ECL system (Amersham).
Transfection of Jurkat cells was carried out by electroporating
10
7 cells at 210 V and 960 µF with 50 µg of the plasmid
DNA. Cells
were harvested 20 h posttransfection, and
immunoprecipitation
of nef complexes was conducted as described
above.
 |
RESULTS |
SIVmac239 nef binds to a TCR sequence in yeast cells.
We used
a deleted form of SIVmac239 nef protein (aa 1 to 15 and 98 to 263;
nef2 in Fig. 1) fused to the DNA
binding domain of the GAL4 transcription factor as bait in a yeast
two-hybrid screen. The expression plasmid for this fusion construct was
called pBD-239
nef2. A cDNA library prepared from PHA-activated
human lymphocytes was fused to the transcription activation domain of the GAL4 transcription factor (pAD-cDNA) and introduced into S. cerevisiae Y190 previously transformed with pBD-239
nef2. When the protein encoded by pBD-239
nef2 interacts with that encoded by
pAD-cDNA, it will reconstitute a functional GAL4 transcription factor
and activate transcription of two reporter genes, lacZ and
HIS3, respectively, which are present in the S. cerevisiae Y190. Transformants harboring the positive interacting
clones are expected to grow in the absence of histidine and to produce
-galactosidase.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of deletion mutations in nef of
SIVmac239. Sequence motifs are described by Shugars et al.
(53) and Samuel et al. (49). Myr, myristoylation
site; SH2, putative consensus SH2 binding sequence; p34cdc,
consensus cyclin-dependent kinase substrate sequence; D-E, acidic
stretch; PXXP, putative SH3 binding motif; Y-P, tyrosine kinase
recognition sequence; PKC1 and PKC2, PKC
recognition sequences. Clones for expression in mammalian cells
contained an AU1 epitope tag at the carboxyl termini. Dashed lines
represent deleted regions; numbers indicate the positions of the amino
acids.
|
|
Approximately 10
6 individual cDNA clones were screened.
Ninety-one colonies were able to grow in the absence of histidine.
When
these colonies were assayed for the production of

-galactosidase,
20 of the 91 HIS
+ colonies were found to have

-galactosidase activity. To further
eliminate false positives,
candidate yeast colonies were subjected
to cycloheximide
counterselection to remove pBD-239

nef2 from
the cells. The
resulting cycloheximide-resistant yeast colonies,
which carried
only the candidate pAD-cDNA, were then used in mating
assays to
determine the specificity of the interaction. Six independent
clones
remained positive. Sequence analysis of these six clones
revealed that
one (clone 69) had 97% nucleotide sequence identity
to the human
TCR

. Comparison of the amino acid sequence encoded
by clone 69 and the TCR

cDNA showed that clone 69 encoded
a 100-aa polypeptide similar to the cytoplasmic region of the
human TCR

(Fig.
2). There
were three amino acid differences
between the amino acid
sequence deduced from clone 69 and the
published sequence of
TCR

(Fig.
2) (
61).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2.
Comparison of amino acid sequence of clone 69 with that
of the human TCR . The published sequence of the TCR
(61) from the initiating methionine is shown. Dots indicate
amino acid identity. Boldface letters indicate different amino acid
sequences.
|
|
Diploid cells expressing vectors without inserts (pBD and pAD),
expressing the truncated nef fusion without clone 69 (pBD-239

nef2
and pAD), or expressing the clone 69 fusion without the nef fusion
(pBD
and pAD-cDNA69), did not grow in the selective medium and
were negative
for the
lacZ phenotype (Table
1). In contrast,
interaction of the
truncated nef (pBD-239

nef2) and the TCR
(pAD-cDNA69)
conferred on the yeast cells the ability to grow
in

L

Y

H+3AT
medium and to produce

-galactosidase (Table
1).
This interaction was
specific, since negative phenotypes were
observed in cells expressing
clone 69 or the truncated nef fusion
protein in combination with the
p53 or the simian virus 40 large
T antigen (SV40 T-Ag), respectively
(Table
1). As positive controls,
yeast cells expressing the wild-type
GAL4 transcription factor
or the combination of p53 and SV40 large T
antigen previously
shown to interact with each other (
35)
were positive for the
lacZ phenotype (Table
1). Specific
interaction with clone 69
was also observed by using the full-length
SIVmac239nef and by
using a truncated nef containing the central core
region containing
aa 98 to 235 (239

nef2-4) (Table
1). Further
deletion from 98
to 134 (

nef3; Fig.
1 and Table
1), however,
resulted in the
loss of interaction with clone 69, suggesting that aa
98 to 134
in nef are required to bind to the clone 69 sequence.
Use of GST fusions to demonstrate specific interaction.
To
confirm a possible interaction of nef with TCR
, nef was
expressed as a GST-fusion protein in E. coli, purified,
immobilized on glutathione-Sepharose beads, and incubated
with lysates of CD4+ Jurkat T cells or with lysates
of Cos 18 cells which stably express CD8-TCR
fusion
protein (28). Proteins coprecipitated with nef were
separated by electrophoresis in an SDS-12% polyacrylamide gel and
electroblotted onto a nylon membrane; the presence of TCR
was detected with mouse anti-TCR
monoclonal antibody. A protein band of approximately 40 kDa, which was
the size of the CD8-TCR
fusion protein (22),
was specifically detected in the sample containing the extract of Cos
18 cells and GST239nef (Fig. 3). Smaller
species of approximately 16 and 22 kDa, which might have resulted from
the degradation of the CD8-TCR
fusion, were also
detected. No CD8-TCR
was detected when GST without nef
was used (Fig. 3). Similarly, TCR
(18 kDa) was also
specifically detected when GST-SIVmac239 nef (GST239nef) was incubated
with the Jurkat cell lysate (Fig. 3). Again, the nef-TCR
interaction was specific, since no TCR
was found to
interact with GST in the absence of nef. Further evidence for the
specificity of the interaction was obtained by the absence of signal
when nef of HIV-1 strain SF2 was fused to GST and used for the assays
(Fig. 3). The failure of HIV-1 SF2nef to interact with
TCR
is consistent with other results described in more
detail below.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 3.
Binding of GSTnef with TCR in
vitro. GST, recombinant GST239nef, and GSTSF2nef proteins were
expressed in E. coli, affinity purified, and immobilized by
using glutathione-Sepharose beads. The immobilized GST proteins were
incubated with extracts of Cos 18 or Jurkat cells previously precleared
with immobilized GST and glutathione-Sepharose beads. After extensive
washing, proteins coprecipitated with the complexes were analyzed by
SDS-12% PAGE, electroblotted onto a nylon membrane, and reacted with
anti-TCR monoclonal antibody.
|
|
Coprecipitation of TCR
and SIVmac239 nef from
CD8-TCR
-expressing cells.
We also analyzed the
ability of TCR
to be coprecipitated with nef from
CD8-TCR
-expressing cells. For this purpose, an AU1
epitope tag was placed at the carboxyl terminus of nef-coding sequence
in the pFJ expression plasmid and used for transfection into Cos 18 cells, which expressed the CD8-TCR
fusion protein. Transfected cell lysates were incubated with anti-AU1 monoclonal antibody, and precipitated proteins were separated by SDS-12% PAGE. The presence of CD8-TCR
in the nef
immunoprecipitates was detected by reactivity of immunoblotted
proteins with anti-TCR
monoclonal antibody. Specific
coimmunoprecipitation of CD8-TCR
was readily detected
with nef from SIVmac239 but not from mock-transfected cells (Fig.
4).

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 4.
Coprecipitation of TCR with nef from Cos
18 cells. Cos 18 cells expressing CD8-TCR fusion
protein were mock transfected (mock) or transfected with plasmids
encoding full-length (SIVmac239nef) or truncated ( nef1 to
nef3-4) SIVmac239 nef. nef immune complexes were precipitated
with anti-AU1 monoclonal antibody, washed extensively, resolved by
SDS-12% PAGE, and transferred onto a membrane filter.
CD8-TCR coimmunoprecipitated with nef was detected by
the anti-TCR monoclonal antibody (upper panel).
Expression of the full-length or the truncated SIVmac239 nef proteins
in the corresponding transfected Cos 18 cells was detected by
separating the whole-cell lysates in an SDS-12% polyacrylamide gel,
transferring onto a nylon membrane, and probing with the anti-AU1
monoclonal antibody (lower panel).
|
|
The
nef gene of SIVsm strain H4 (
25) was also AU1
tagged and cloned into the pFJ expression vector. Coprecipitation of
authentic
TCR

with nef was examined following
electroporation into
Jurkat T cells. The endogenous TCR

coprecipitated with both
SIVmac239 nef and SIVsmH4 nef (Fig.
5). In contrast, AU1-tagged
nef from
HIV-1 strain NL4-3 did not associate with TCR

in
these
assays (Fig.
5).

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 5.
SIV nef interacts with the endogenous TCR
in Jurkat cells. Jurkat cells were electroporated with expression
plasmids encoding SIVmac239 nef, SIVsmH4 nef, or HIV-1 NL4-3 nef
(NL4-3) tagged with an AU1 epitope. After 20 h, cells were
harvested and nef proteins were immunoprecipitated with anti-AU1
monoclonal antibody. Proteins coimmunoprecipitated with nef were
analyzed by SDS-12% PAGE and immunoblotted onto a nylon membrane which
was probed with the anti-TCR monoclonal antibody (upper
panel). Expression of the nef proteins was detected by separating the
whole-cell lysates in an SDS-12% polyacrylamide gel and immunoblotting
with the anti-AU1 monoclonal antibody (lower panel).
|
|
The central region of SIVmac239 nef is required to bind to
TCR
.
In order to delineate the regions of nef
responsible for binding to TCR
, a series of SIVmac239
nef deletion mutants was constructed and tested for binding to
TCR
. All nef mutants contained aa 1 to 15 at the amino
terminus for myristoylation. The deletion mutants were constructed
with an AU1 tag at the carboxyl terminus and analyzed following
transfection of Cos 18 cells. The cells were lysed and incubated with
AU1 antibody; precipitated proteins were analyzed by SDS-12% PAGE, and
the presence of CD8-TCR
was detected by reactivity of
anti-TCR
monoclonal antibody with immunoblotted proteins
(Fig. 4). As shown in the lower panel of Fig. 4, comparable amounts of
the full-length and the truncated nef proteins were detected in the
transfected Cos 18 cells. When analyzed without heating prior to the
electrophoresis,
nef5 was detected, and the level of its expression
was found to be similar to that of the control (not shown). Deletion of
the amino terminus of nef from aa 16 to 97 (
nef2 in Fig. 1) did not
affect the binding to CD8-TCR
(Fig. 4), suggesting that
the amino-terminal region of nef which contains the putative SH2
binding motif and the acidic stretch may not be required for
interaction with the TCR
. However, further deletion up
to aa 133, including the putative PXXP motif and the potential PKC
phosphorylation site (PKC1) (
nef3 in Fig. 1) resulted in
the loss of binding to TCR
(Fig. 4). While extensive
deletion at the amino-terminal region of nef did not affect its
interaction with the TCR
, only minor deletion at the
carboxyl terminus of the protein was tolerated (
nef4 versus
nef5
and
nef6; Fig. 1 and 4). A minimal construct containing only aa 98 to 235 and 1 to 15 (
nef2-4 in Fig. 1) was shown to bind
CD8-TCR
in these assays (Fig. 4). Thus, we have mapped aa 98 to 235 as a minimal region in nef of SIVmac239 capable of interacting with the TCR
.
SIV nef and HIV-2 nef, but not HIV-1 nef, associate with
TCR
.
The failure of TCR
to bind to
GSTnef from HIV-1 strain SF2 (Fig. 3) and to coimmunoprecipitate with
nef from HIV-1 strain NL4-3 in transfected Jurkat cells (Fig. 5)
prompted us to investigate further this apparent restriction in
specificity. We expressed AU1-tagged nef from five different HIV-1
isolates and analyzed their association with CD8-TCR
in transfected Cos 18 cells. NL4-3 and SF2 nef were derived
from two laboratory strains of HIV-1, whereas Rulda nef was derived
from a primary clinical isolate. nef-153 and nef-259 are derivatives of
NL4-3 nef from monkeys with progressive disease following
infection by SHIVnef chimeras (16a). Expression plasmids
containing these HIV-1 nef genes were transfected into Cos
18 cells, and TCR
was detected in
immunoprecipitates with TCR
monoclonal antiserum
as described for the above experiments. In contrast to nef of
SIVmac239, which coimmunoprecipitated the TCR
, none of
the HIV-1 nefs associated with the TCR
(Fig.
6, upper panel). Failure to coprecipitate
the TCR
was not due to instability or inefficient
expression of the HIV-1 nef genes, since comparable amounts
of the nef proteins were detected in the HIV-1 and the SIV
nef-transfected cells (Fig. 6, lower panel).

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 6.
HIV-1 nef does not associate with TCR .
Cos 18 cells were transfected with expression plasmids encoding
SIVmac239 or HIV-1 nef tagged with an AU1 epitope. nef immune complexes
were precipitated with anti-AU1 monoclonal antibody.
Immunoprecipitation complexes were washed extensively, separated by
SDS-12% PAGE, and transferred onto a nylon membrane which was probed
with the anti-TCR monoclonal antibody (upper panel).
Expression of the nef proteins in the corresponding transfected Cos 18 cells was detected by separating the whole-cell lysates in an SDS-12%
polyacrylamide gel, immunoblotting onto a nylon membrane, and probing
with the anti-AU1 monoclonal antibody (lower panel). Lanes: 1, mock
transfected; 2, wild-type SIVmac239 nef; 3 and 4, HIV nef obtained from
two animals (259 and 153, respectively) infected with a recombinant SIV
in which the SIV nef gene was replaced by the HIV NL4-3
nef allele (SHIVnef); 5, HIV nef derived from a primary
clinical isolate (Rulda); 6, HIV-1 SF2 nef; and 7, HIV-1 NL4-3 nef.
|
|
Proteins which have low affinity binding and transient interaction
might evade detection by the coimmunoprecipitation technique.
Yeast
two-hybrid systems have been shown to detect protein-protein
interactions which were not detected by other conventional methods
(
19,
45,
59). We thus cotransformed
S. cerevisiae
Y190 with
pAD-cDNA69 and hybrid expression plasmids containing the GAL4
DNA binding domain fused to the
nef genes of various HIV-1,
SIV,
and HIV-2 isolates. As shown in Fig.
7, specific interactions
of
TCR

and nef resulting in the production of

-galactosidase
were found in yeast cells cotransformed with
pAD-cDNA69 and pBD-Nef
derived from SIVsmH4, SIVmac239, and HIV-2ST,
whereas neither
pBD-NL4-3nef and pAD-cDNA69 nor pBD-consnef and
pAD-cDNA69 enabled
the yeast cells to grow well in the presence of the
selective
medium or to produce

-galactosidase, consistent with the
results
obtained in the coimmunoprecipitation experiment. Similar
negative
results were obtained when a consensus HIV-1 nef sequence was
used (Fig.
7).

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 7.
SIV and HIV-2 nef, but not HIV-1 nef, associates with
TCR in yeast cells. S. cerevisiae Y190 was
cotransformed with hybrid plasmid encoding the fusion protein of the
GAL4 DNA binding domain and the HIV-1 consensus nef (pBD-consnef),
HIV-1 NL4-3 nef (pBD-NL4-3), SIVsmH4 nef (pBD-SIVsmH4), SIVmac239 nef
(pBD-SIVmac239), or HIV-2 ST nef (pBD-HIV-2ST) alone (left panel) or in
combination with the pAD-cDNA69 (right panel). Transformed yeast cells
were plated onto L Y H+3AT plates, and colonies were assayed for
the production of -galactosidase (blue). The top panel indicates the
positive and negative controls with the yeast cells transformed with
expression plasmids of pVA3-1 (p53) and pTD1-1 (SV40 T-Ag), vectors
with no inserts (pBD+pAD), or pAD-cDNA69 (TCR ) alone.
|
|
Tyrosine kinase activity in nef complexes.
Protein tyrosine
phosphorylation is one of the earliest biochemical events elicited by
stimulation of B-cell receptor (BCR) and TCR in B and T cells,
respectively (10, 29). Neither the BCR nor the TCR has
intrinsic tyrosine kinase activity; both appear to interact with
cytoplasmic protein tyrosine kinase (PTK). Three cytoplasmic PTKs (lck,
fyn, and ZAP70) have been implicated in intracellular TCR signal
transduction (11, 12, 48, 58). In the ensuing experiment, we
asked if the nef-TCR
complex coprecipitated with a PTK.
Immobilized GSTnef from SIVmac239 was incubated with the Jurkat cell
lysate as described previously. After extensive washing, the
coprecipitation complexes were incubated under the conditions for
assay of kinase activity in the presence or absence of ATP. The
reaction products were analyzed by SDS-12% PAGE and immunoblotted onto
a nylon membrane. Tyrosine-phosphorylated proteins were detected
with an antiphosphotyrosine antibody. In the sample supplied with ATP,
two major bands with migration corresponding to the molecular weights
of GSTnef and TCR
were detected by
phosphotyrosine-specific antiserum (Fig.
8, upper panel, lane 2). The presence of
TCR
was confirmed when the same blot was reprobed with
TCR
-specific antiserum (Fig. 8, lower panel, lane 2). In
contrast, tyrosine phosphorylation of the protein band with a molecular
weight similar to that of GSTnef was not detected in the sample without
the addition of ATP (Fig. 8, upper panel, lane 3). No tyrosine
phosphorylation was observed in the samples without prior incubation
with the Jurkat cell lysate (Fig. 8, lanes 7 and 8).

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 8.
TCR -nef complex contains tyrosine kinase
activity. Affinity-purified and immobilized recombinant GST or GSTnef
was incubated in the presence of Jurkat T or J.CAM1.6 cell lysates
previously precleared with immobilized GST and glutathione-Sepharose
beads. Complexes precipitated with GSTnef were washed extensively and
incubated in kinase buffer in the presence or absence of ATP. The
reaction products were analyzed by SDS-12% PAGE, transferred onto a
nylon membrane, and probed with antiphosphotyrosine monoclonal
antibody. As negative controls, GST and recombinant GSTnef were
purified from the bacterial lysates and assayed directly for kinase
activity without prior incubation with the cell extracts (upper panel).
To confirm the presence of TCR in the coprecipitation
complexes, antibodies were stripped and the filter was reprobed with
the anti-TCR monoclonal antibody (lower panel).
|
|
Next, we examined if the tyrosine kinase activity present in the
nef-TCR

complex might be dependent on lck. In vitro
binding assays with GST or GSTnef were performed in the presence
of
extracts prepared from J.CAM1.6 cells, a Jurkat-derived mutant
cell
line which lacks a functional lck but has equivalent amounts
of
ZAP70, TCR, and TCR

proteins (
22,
29). As
shown in
Fig.
8, lower panel, GSTnef precipitated
TCR

from the lysates
of Jurkat cells and J.CAM1.6
cells (lanes 2, 3, 5, and 6). However,
tyrosine phosphorylation
activity was detected only in complexes
prepared from the Jurkat cell
lysate but not in the ones prepared
from the J.CAM1.6 cell lysate (Fig.
8, upper panel, compare lane
2 with lane 5). This result suggested that
binding of nef to TCR
is independent of any prior
tyrosine phosphorylation of TCR
and that the
tyrosine kinase coprecipitated with the nef-TCR
complex is dependent on the presence of a functional
lck.
 |
DISCUSSION |
The TCR is a multimolecular complex containing the polymorphic TCR
and
subunits, the invariant CD3
,
, and
chains, and a
homodimer of
chains or, in a minority of receptors, a heterodimer
of
and
chains (4, 13, 20). The disulfide-linked TCR
and
heterodimer is responsible for antigen recognition, but the
short, 5-aa cytoplasmic domains of the TCR
and
subunits are
insufficient to couple to the intracellular signaling molecules. In
contrast, the
chain has an extracellular region of only 9 aa but an
extensive intracellular domain of 113 aa (60). Using a
chimeric protein consisting of the extracellular and transmembrane domains of CD8 fused to the cytoplasmic domain of the
chain, Irving
and Weiss elegantly showed that this fusion protein could elicit
transducing signals indistinguishable from those generated by the
intact TCR (28). One characteristic feature of the
chain
is the presence of the immunoreceptor tyrosine-based activation motif
(ITAM)
(EX2YX2L/IX7YX2L/I),
which is crucial for
chain coupling to the intracellular tyrosine
kinases and adapter proteins and, hence, is absolutely required for all
subsequent TCR signaling responses (8, 12, 41).
Phosphorylated ITAM sequences function as SH2 binding domains (27,
44). One of the earliest biochemical events in TCR signaling is
the activation of the src family tyrosine kinase lck, which in turn
recruits various enzymes and signaling molecules leading to an altered
pattern of gene expression and cellular activation (9-11,
40).
We used a truncated SIVmac239 nef as bait to screen an activated
lymphocyte cDNA library in a yeast two-hybrid system. We identified
TCR
as one of the cellular proteins associating with
nef. The clone that was identified in the screen actually differed from
the published sequence of TCR
(61) at three amino acid positions. The reasons for this are not clear. However, specific binding of nef to authentic TCR
present in
Jurkat cells and to authentic TCR sequences present in the
CD8-TCR
fusion in Cos 18 cells was demonstrated. Binding
of TCR
to full-length nef was demonstrated in vitro
(Fig. 3) and in cells coexpressing TCR
and nef (Fig. 4,
5, and 6). The association with TCR
was specific for
SIVmac, SIVsm, and HIV-2 nef but was not observed with HIV-1 nef. In
addition, the nef-TCR
complex coprecipitated active
tyrosine kinase, which is present in Jurkat cells but not in J.CAM1.6
cells lacking a functional Lck. Finally, using a series of amino- and
carboxyl-terminal deletion mutants of SIVmac239 nef, we mapped the
central core region (aa 98 to 235) of nef responsible for binding to
the
chain.
We can speculate that the binding of SIV nef to TCR
might be related to reported activities of nef in causing T-lymphocyte activation. An unusual nef allele of SIV, called Y nef, is responsible for causing activation of primary lymphocytes in culture and an unusually acute disease course in monkeys (17, 18). Natural nef alleles of both SIV and HIV allow virus replication in an IL-2-dependent cell line and activate the production of IL-2 from these
cells (3). HIV-1 nef was earlier reported to cause
activation signals in Jurkat cells (6). HIV-1 nef has a
highly conserved SH3 binding element, PXXPXXP, which is principally but
not exclusively responsible for binding to src family kinases
(34). SIV and HIV-2 nefs have a single PXXP element, and,
although these can bind src family kinases, they appear to do so less
well than HIV-1 nefs (14, 18, 46). Perhaps HIV-1 nef can
influence signaling by direct interaction with src family kinases
through the highly conserved PXXPXXP SH3 binding domain, while nef of
SIVmac, SIVsm, and HIV-2, as an alternative means to the same end, may
interact first with TCR
. The interaction of nef with a
TCR
-kinase complex could result in tyrosine
phosphorylation of nef, perhaps on a conserved YXXL sequence near the
amino terminus which resembles an SH2 binding domain, and this could in
turn result in recruitment of other tyrosine kinases through the
phosphorylated SH2 binding domain. Thus, the picture that emerges from
this scenario is that both HIV-1 nef and SIVmac, SIVsm, and HIV-2 nef
may affect signaling through tyrosine kinases but that they may rely on
a slightly different combination of cellular partners and binding
domains to achieve these ends.
 |
ACKNOWLEDGMENTS |
We thank Dean Regier and Kim Deary for assistance in the DNA
sequencing, Joanne Newton for manuscript preparation, and Kristen Toohey for photography support.
This work was supported by PHS grants AI25328, AI38559, and RR00168.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: New England
Regional Primate Research Center, Harvard Medical School, One Pine Hill Dr., Box 9102, Southborough, MA 01772-9102. Phone: (508)
624-8042. Fax: (508) 624-8190. E-mail:
ronald_desrosiers{at}hms.med.harvard.edu.
 |
REFERENCES |
| 1.
|
Aiken, C.,
J. Konner,
N. R. Landau,
M. E. Lenburg, and D. Trono.
1994.
Nef induces CD4 endocytosis: requirement for a critical dileucine motif in the membrane-proximal CD4 cytoplasmic domain.
Cell
76:853-864[Medline].
|
| 2.
|
Aiken, C., and D. Trono.
1995.
Nef stimulates human immunodeficiency virus type 1 proviral DNA synthesis.
J. Virol.
69:5048-5056[Abstract].
|
| 3.
|
Alexander, L.,
Z. Du,
M. Rosenzweig,
J. J. Jung, and R. C. Desrosiers.
1997.
A role for natural SIV and HIV nef alleles in lymphocyte activation.
J. Virol.
71:6094-6099[Abstract].
|
| 4.
|
Baniyash, M.,
P. Garcia-Morales,
J. S. Bonifacino,
L. E. Samelson, and R. D. Klausner.
1988.
Disulfide linkage of the and chains of the T cell receptor.
J. Biol. Chem.
263:9874-9878[Abstract/Free Full Text].
|
| 5.
|
Baur, A. S.,
G. Sass,
B. Laffert,
D. Willbold,
C. Cheng-Mayer, and B. M. Peterlin.
1997.
The N-terminus of nef from HIV-1/SIV associates with a protein complex containing lck and a serine kinase.
Immunity
6:283-291[Medline].
|
| 6.
|
Baur, A. S.,
E. T. Sawai,
P. Dazin,
W. J. Fanti,
C. Cheng-Mayer, and B. M. Peterlin.
1994.
HIV-1 nef leads to inhibition or activation of T cells depending on its intracellular localization.
Immunity
1:373-384[Medline].
|
| 7.
|
Benichou, S.,
M. Bomsel,
M. Bodeus,
H. Durand,
M. Doute,
F. Letourneur,
J. Camonis, and R. Benarous.
1994.
Physical interaction of the HIV-1 nef protein with -cop, a component of non-clathrin-coated vesicles essential for membrane traffic.
J. Biol. Chem.
269:30073-30076[Abstract/Free Full Text].
|
| 8.
|
Cambier, J. C.
1995.
Antigen and Fc receptor signaling: the awesome power of the immunoreceptor tyrosine-based activation motif (ITAM).
J. Immunol.
155:3281-3285[Medline].
|
| 9.
|
Cantrell, D.
1996.
T cell antigen receptor signal transduction pathways.
Annu. Rev. Immunol.
14:259-274[Medline].
|
| 10.
|
Carrera, A. C.,
L. Rodriguez-Borlado,
C. Martinez-Alonso, and I. Merida.
1994.
T cell receptor associated alpha phosphatidylinositol 3-kinase becomes activated by T cell receptor cross linking and requires pp56(lck).
J. Biol. Chem.
269:19435-19440[Abstract/Free Full Text].
|
| 11.
|
Chan, A. C.,
D. M. Desai, and A. Weiss.
1994.
The role of protein tyrosine kinases and protein tyrosine phosphatases in T cell antigen receptor signal transduction.
Annu. Rev. Immunol.
12:555-592[Medline].
|
| 12.
|
Chan, A. C.,
M. Iwashima,
C. W. Turck, and A. Weiss.
1992.
ZAP-70: A 70 kd protein-tyrosine kinase that associates with TCR chain.
Cell
71:649-662[Medline].
|
| 13.
|
Clevers, H.,
B. Alacron,
Y. Willeman, and C. Terhorst.
1988.
The T cell receptor/CD3 complex: a dynamic protein ensemble.
Annu. Rev. Immunol.
6:629-662[Medline].
|
| 14.
|
Collete, Y.,
H. Dutartre,
A. Benziane,
F. Ramos-Morales,
R. Benarous,
M. Harris, and D. Olive.
1996.
Physical and functional interaction of nef with lck.
J. Biol. Chem.
71:6333-6341.
|
| 15.
|
Collins, K. L.,
B. K. Chen,
S. A. Kalams,
B. D. Walker, and D. Baltimore.
1998.
HIV-1 nef protein protects infected primary cells against killing by cytotoxic T lymphocytes.
Nature
391:397-401[Medline].
|
| 16.
|
Deacon, N. J.,
A. Tsykin,
A. Solomon,
K. Smith,
M. Ludford-Menting,
D. J. Hooker,
D. A. Pchee,
A. L. Greenway,
A. Ellett,
C. Chatfield,
V. A. Lawson,
S. Crowe,
A. Maerz,
S. Sonza,
J. Learmont,
J. S. Sullivan,
A. Cuuningham,
D. Dwyer,
D. Downton, and J. Mills.
1995.
Genomic structure of an attenuated quasi species of HIV-1 from a blood transfusion donor and recipients.
Science
270:988-991[Abstract/Free Full Text].
|
| 16a.
| Du, Z., L. Alexander, A. Y. M. Howe, and
R. C. Desrosiers. Unpublished data.
|
| 17.
|
Du, Z.,
P. O. Ilysinskii,
V. G. Sasseville,
A. A. Lackner, and R. C. Desrosiers.
1996.
Requirements for lymphocyte activation by unusual strains of simian immunodeficiency virus.
J. Virol.
70:4157-4161[Abstract].
|
| 18.
|
Du, Z.,
S. M. Lang,
V. G. Sasseville,
A. A. Lackner,
P. O. Ilyinskii,
M. D. Daniel,
J. J. Jung, and R. C. Desrosiers.
1995.
Identification of a nef allele that causes lymphocyte activation and acute disease in macaque monkeys.
Cell
82:665-674[Medline].
|
| 19.
|
Durfee, T.,
K. Becherer,
P. L. Chen,
S. H. Yeh,
Y. Yang,
A. E. Kilburn,
W. H. Lee, and S. J. Elledge.
1993.
The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit.
Genes Dev.
7:555-569[Abstract/Free Full Text].
|
| 20.
|
Frank, S. J.,
L. E. Samelson, and R. D. Klausner.
1990.
The structure and signaling function of the invariant T cell receptor components.
Semin. Immunol.
2:89-97[Medline].
|
| 21.
|
Garcia, J. A., and A. D. Miller.
1991.
Serine phosphorylation independent downregulation of cell-surface CD4 by nef.
Nature
350:508-551[Medline].
|
| 22.
|
Goldsmith, M. A., and A. Weiss.
1987.
Isolation and characterization of a T-lymphocyte somatic mutant with altered signal transduction by the antigen receptor.
Proc. Natl. Acad. Sci. USA
84:6879-6883[Abstract/Free Full Text].
|
| 23.
|
Greenway, A.,
A. Azad, and D. McPhee.
1995.
Human immunodeficiency virus type 1 nef protein inhibits activation pathways in peripheral blood mononuclear cells and T-cell lines.
J. Virol.
69:1842-1850[Abstract].
|
| 24.
|
Greenway, A.,
A. Azad,
J. Mills, and D. McPhee.
1996.
Human immunodeficiency virus type 1 nef binds directly to lck and mitogen-activated protein kinase, inhibiting kinase activity.
J. Virol.
70:6701-6708[Abstract/Free Full Text].
|
| 25.
|
Hirsch, V. M.,
R. A. Olmstead,
M. Murphu-Corb,
R. M. Purcell, and P. R. Johnson.
1989.
An African primate lentivirus (SIVsm) closely related to HIV-2.
Nature
339:389-392[Medline].
|
| 26.
|
Iafrate, A. J.,
S. Bronson, and J. Skowronski.
1997.
Separable functions of Nef disrupt two aspects of T cell receptor machinery: CD4 expression and CD3 signaling.
EMBO
16:673-684[Medline].
|
| 27.
|
Irving, B. A.,
A. C. Chan, and A. Weiss.
1993.
Functional characterization of a signal transducing motif present in the T cell antigen receptor chain.
J. Exp. Med.
177:1093-1103[Abstract/Free Full Text].
|
| 28.
|
Irving, B. A., and A. Weiss.
1991.
The cytoplasmic domain of the T cell receptor chain is sufficient to couple to receptor-associated signal transduction pathways.
Cell
64:891-901[Medline].
|
| 29.
|
Iwashima, M.,
B. A. Irving,
N. S. C. van Oers,
A. C. Chan, and A. Weiss.
1994.
Sequential interactions of the TCR with two distinct cytoplasmic tyrosine kinases.
Science
263:1136-1139[Abstract/Free Full Text].
|
| 30.
|
Jung, J. U.,
S. M. Lang,
U. Friedrich,
T. Jun,
T. M. Roberts,
R. C. Desrosiers, and B. Biesinger.
1995.
Identification of lck-binding elements in tip of herpesvirus saimiri.
J. Biol. Chem.
270:20660-20667[Abstract/Free Full Text].
|
| 31.
|
Kestler, H. W., III,
D. J. Ringler,
K. Mori,
D. L. Panicali,
P. K. Schgal,
M. D. Daniel, and R. C. Desrosiers.
1991.
Importance of the nef gene for maintenance of high virus loads and for development of AIDS.
Cell
65:651-662[Medline].
|
| 32.
|
Kirchoff, F.,
T. C. Greenoug,
D. B. Brettler,
J. L. Sullivan, and R. C. Desrosiers.
1995.
Absence of intact nef sequences in a long-term survivor with non-progressive HIV-1 infection.
N. Engl. J. Med.
332:228-232[Free Full Text].
|
| 33.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 34.
|
Lee, C.-H.,
B. Leung,
M. A. Lemmon,
J. Zheng,
D. Cowburn,
J. Kuriyan, and K. Saksela.
1995.
A single amino acid in the SH3 domain of Hck determines its high affinity and specificity in binding to HIV-1 nef protein.
EMBO
14:5006-5015[Medline].
|
| 35.
|
Li, B., and S. Fields.
1993.
Identification of mutations in p53 that affect its binding to SV40 large T antigen by using the yeast two-hybrid system.
FASEB
7:957-963[Abstract].
|
| 36.
|
Liu, L. X.,
F. Margottin,
S. Le Gall,
O. Schwartz,
L. Selig,
R. Benarous, and S. Benichou.
1997.
Binding of HIV-1 nef to a novel thioesterase enzyme correlates with nef-mediated CD4 down-regulation.
J. Biol. Chem.
272:13779-13785[Abstract/Free Full Text].
|
| 37.
|
Lu, X.,
X. Wu,
A. Plemenitas,
H. Yu,
E. T. Sawai,
A. Abo, and B. M. Peterlin.
1996.
CDC42 and Rac1 are implicated in the activation of the nef-associated kinase and replication of HIV-1.
Curr. Biol.
12:1677-1684.
|
| 38.
|
Miller, M. D.,
M. T. Warmerdam,
I. Gaston,
W. C. Green, and M. B. Feinberg.
1994.
The human immunodeficiency virus-1 nef gene product: a positive factor for viral infection and replication in primary lymphocytes and macrophages.
J. Exp. Med.
179:101-113[Abstract/Free Full Text].
|
| 39.
|
Niederman, T. M.,
W. R. Hastings,
S. Luria, and L. Ratner.
1993.
Human immunodeficiency virus type 1 nef protein inhibits NF-kB induction in human T cells.
Virology
194:338-344[Medline].
|
| 40.
|
Northrop, J. P.,
S. N. Ho,
L. Chen,
D. J. Thomas,
L. A. Timmerman,
G. P. Nolan,
A. Admon, and G. R. Crabtree.
1994.
NF-AT components define a family of transcription factor targeted in T-cell activation.
Nature
369:497-502[Medline].
|
| 41.
|
Ravichandran, K. S.,
K. K. Lee,
Z. Songyang,
L. C. Cantley,
P. Burn, and S. J. Burakoff.
1993.
Interaction of Shc with the zeta chain of the T-cell receptor upon T cell activation.
Science
262:902-905[Abstract/Free Full Text].
|
| 42.
|
Regier, D. A., and R. C. Desrosiers.
1990.
The complete nucleotide sequence of a pathogenic molecular clone of simian immunodeficiency virus.
AIDS Res. Hum. Retroviruses
6:1221-1231[Medline].
|
| 43.
|
Rhee, S. S., and J. W. Marsh.
1994.
Human immunodeficiency virus type 1 nef-induced down-modulation of CD4 is due to rapid internalization and degradation of surface CD4.
J. Virol.
68:5156-5163[Abstract/Free Full Text].
|
| 44.
|
Romeo, C.,
M. Amiot, and B. Seed.
1992.
Sequence requirements for induction of cytolysis by the T cell antigen Fc receptor chain.
Cell
68:889-897[Medline].
|
| 45.
|
Rossi, F.,
A. Gallina, and G. Milanes.
1996.
Nef-CD4 physical interaction sensed with the yeast two-hybrid system.
Virology
217:397-403[Medline].
|
| 46.
|
Saksela, K.,
G. Cheng, and D. Baltimore.
1995.
Proline-rich (PxxP) motifs in HIV-1 nef bind to SH3 domains of a subset of Src kinases and are required for the enhanced growth of Nef+ viruses but not for downregulation of CD4.
EMBO
14:484-491[Medline].
|
| 47.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 48.
|
Samelson, L. E., and R. D. Klausner.
1992.
Tyrosine kinases and tyrosine-based activation motifs. Current research on activation via the T cell antigen receptor.
J. Biol. Chem.
267:24913-24916[Free Full Text].
|
| 49.
|
Samuel, K.,
D. R. Hodge,
Y.-M. A. Chen, and T. S. Papas.
1991.
Nef proteins of the human immunodeficiency viruses (HIV-1 and HIV-2) and simian immunodeficiency virus (SIV) are structurally similar to leucine zipper transcriptional activation factors.
AIDS Res. Hum. Retroviruses
7:697-706[Medline].
|
| 50.
|
Sanfridson, A.,
B. R. Cullen, and C. Doyle.
1994.
The simian immunodeficiency virus nef protein promotes degradation of CD4 in human T cells.
J. Biol. Chem.
269:3917-3920[Abstract/Free Full Text].
|
| 51.
|
Sawai, E. T.,
A. Baur,
H. Struble,
B. M. Peterlin,
J. A. Levy, and C. Cheng-Mayer.
1994.
Human immunodeficiency virus type I nef associates with a cellular serine kinase in T lymphocytes.
Proc. Natl. Acad. Sci. USA
91:1539-1543[Abstract/Free Full Text].
|
| 52.
|
Schwartz, O.,
V. Marechal,
S. Le Gall,
F. Lemonnier, and J. M. Heard.
1996.
Endocytosis of MHC-1 molecules is induced by HIV-1 nef.
Nat. Med.
2:338-342[Medline].
|
| 53.
|
Shugars, D. C.,
M. S. Smith,
D. H. Glueck,
P. V. Nantermet,
F. Seillier-Moiseiwitsch, and R. Swanstrom.
1993.
Analysis of human immunodeficiency virus type 1 nef gene sequences present in vivo.
J. Virol.
67:4639-4650[Abstract/Free Full Text].
|
| 54.
|
Skowronski, J.,
D. Parks, and R. Mariani.
1993.
Altered T cell activation and development in transgenic mice expressing the HIV-1 nef gene.
EMBO
12:703-713[Medline].
|
| 55.
|
Smith, B. L.,
B. W. Krushelnycky,
D. Mochly-Rosen, and P. Berg.
1996.
The HIV nef protein associates with protein kinase C theta.
J. Biol. Chem.
271:16753-16757[Abstract/Free Full Text].
|
| 56.
|
Spina, C. A.,
T. J. Kwoh,
M. Y. Chowers,
J. C. Guatelli, and D. D. Richman.
1994.
The importance of nef in the induction of human immunodeficiency virus type 1 replication from primary quiescent CD4 lymphocytes.
J. Exp. Med.
179:115-123[Abstract/Free Full Text].
|
| 57.
|
Terwilliger, E.,
J. G. Sodroski,
C. A. Rosen, and W. A. Haseltine.
1986.
Effects of mutations with the 3' orf open reading frame region of human T-cell lymphotropic virus type III (HTLV-III/LAV) on replication and cytopathogenicity.
J. Virol.
60:754-760[Abstract/Free Full Text].
|
| 58.
|
Thome, M.,
P. Duplay,
M. Guttinger, and O. Acuto.
1997.
Syk and ZAP70 mediate recruitment of p56lck/CD4 to the activated T cell receptor/CD3/ complex.
J. Exp. Med.
181:1997-2006[Abstract/Free Full Text].
|
| 59.
|
Vojtek, A. B.,
S. M. Hollenberg, and J. A. Cooper.
1993.
Mammalian Ras interacts directly with the serine/threonine kinase Raf.
Cell
74:205-214[Medline].
|
| 60.
|
Weissman, A. M.,
M. Baniyash,
D. Hou,
L. E. Samelson,
W. H. Burgess, and R. D. Klausner.
1988.
Molecular cloning of the zeta chain of the T cell antigen receptor.
Science
239:1018-1021[Abstract/Free Full Text].
|
| 61.
|
Weissman, A. M.,
D. Hou,
D. G. Orloff,
W. S. Modi,
H. Seuanez,
S. J. O'Brien, and R. D. Klausner.
1988.
Molecular cloning and chromosomal localization of the human T-cell receptor chain: distinction from the molecular CD3 complex.
Proc. Natl. Acad. Sci. USA
85:9709-9713[Abstract/Free Full Text].
|
Journal of Virology, December 1998, p. 9827-9834, Vol. 72, No. 12
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Munch, J., Rajan, D., Schindler, M., Specht, A., Rucker, E., Novembre, F. J., Nerrienet, E., Muller-Trutwin, M. C., Peeters, M., Hahn, B. H., Kirchhoff, F.
(2007). Nef-Mediated Enhancement of Virion Infectivity and Stimulation of Viral Replication Are Fundamental Properties of Primate Lentiviruses. J. Virol.
81: 13852-13864
[Abstract]
[Full Text]
-
Brenner, M., Munch, J., Schindler, M., Wildum, S., Stolte, N., Stahl-Hennig, C., Fuchs, D., Matz-Rensing, K., Franz, M., Heeney, J., Ten Haaft, P., Swigut, T., Hrecka, K., Skowronski, J., Kirchhoff, F.
(2006). Importance of the N-Distal AP-2 Binding Element in Nef for Simian Immunodeficiency Virus Replication and Pathogenicity in Rhesus Macaques. J. Virol.
80: 4469-4481
[Abstract]
[Full Text]
-
Brown, A., Gartner, S., Kawano, T., Benoit, N., Cheng-Mayer, C.
(2005). HLA-A2 down-regulation on primary human macrophages infected with an M-tropic EGFP-tagged HIV-1 reporter virus. J. Leukoc. Biol.
78: 675-685
[Abstract]
[Full Text]
-
Munch, J., Schindler, M., Wildum, S., Rucker, E., Bailer, N., Knoop, V., Novembre, F. J., Kirchhoff, F.
(2005). Primary Sooty Mangabey Simian Immunodeficiency Virus and Human Immunodeficiency Virus Type 2 nef Alleles Modulate Cell Surface Expression of Various Human Receptors and Enhance Viral Infectivity and Replication. J. Virol.
79: 10547-10560
[Abstract]
[Full Text]
-
Hrecka, K., Swigut, T., Schindler, M., Kirchhoff, F., Skowronski, J.
(2005). Nef Proteins from Diverse Groups of Primate Lentiviruses Downmodulate CXCR4 To Inhibit Migration to the Chemokine Stromal Derived Factor 1. J. Virol.
79: 10650-10659
[Abstract]
[Full Text]
-
Hodara, V. L., Velasquillo, M. C., Parodi, L. M., Giavedoni, L. D.
(2005). Expression of CD154 by a Simian Immunodeficiency Virus Vector Induces Only Transitory Changes in Rhesus Macaques. J. Virol.
79: 4679-4690
[Abstract]
[Full Text]
-
Hill, B. T., Skowronski, J.
(2005). Human N-Myristoyltransferases Form Stable Complexes with Lentiviral Nef and Other Viral and Cellular Substrate Proteins. J. Virol.
79: 1133-1141
[Abstract]
[Full Text]
-
Swigut, T., Alexander, L., Morgan, J., Lifson, J., Mansfield, K. G., Lang, S., Johnson, R. P., Skowronski, J., Desrosiers, R.
(2004). Impact of Nef-Mediated Downregulation of Major Histocompatibility Complex Class I on Immune Response to Simian Immunodeficiency Virus. J. Virol.
78: 13335-13344
[Abstract]
[Full Text]
-
Schindler, M., Munch, J., Brenner, M., Stahl-Hennig, C., Skowronski, J., Kirchhoff, F.
(2004). Comprehensive Analysis of Nef Functions Selected in Simian Immunodeficiency Virus-Infected Macaques. J. Virol.
78: 10588-10597
[Abstract]
[Full Text]
-
Kirchhoff, F., Schindler, M., Bailer, N., Renkema, G. H., Saksela, K., Knoop, V., Muller-Trutwin, M. C., Santiago, M. L., Bibollet-Ruche, F., Dittmar, M. T., Heeney, J. L., Hahn, B. H., Munch, J.
(2004). Nef Proteins from Simian Immunodeficiency Virus-Infected Chimpanzees Interact with p21-Activated Kinase 2 and Modulate Cell Surface Expression of Various Human Receptors. J. Virol.
78: 6864-6874
[Abstract]
[Full Text]
-
Brown, A., Moghaddam, S., Kawano, T., Cheng-Mayer, C.
(2004). Multiple human immunodeficiency virus type 1 Nef functions contribute to efficient replication in primary human macrophages. J. Gen. Virol.
85: 1463-1469
[Abstract]
[Full Text]
-
Schindler, M., Wurfl, S., Benaroch, P., Greenough, T. C., Daniels, R., Easterbrook, P., Brenner, M., Munch, J., Kirchhoff, F.
(2003). Down-Modulation of Mature Major Histocompatibility Complex Class II and Up-Regulation of Invariant Chain Cell Surface Expression Are Well-Conserved Functions of Human and Simian Immunodeficiency Virus nef Alleles. J. Virol.
77: 10548-10556
[Abstract]
[Full Text]
-
Swigut, T., Greenberg, M., Skowronski, J.
(2003). Cooperative Interactions of Simian Immunodeficiency Virus Nef, AP-2, and CD3-{zeta} Mediate the Selective Induction of T-Cell Receptor-CD3 Endocytosis. J. Virol.
77: 8116-8126
[Abstract]
[Full Text]
-
Badran, B. M., Wolinsky, S. M., Burny, A., Willard-Gallo, K. E.
(2002). Identification of Three NFAT Binding Motifs in the 5'-Upstream Region of the Human CD3gamma Gene That Differentially Bind NFATc1, NFATc2, and NF-kappa B p50. J. Biol. Chem.
277: 47136-47148
[Abstract]
[Full Text]
-
Munch, J., Janardhan, A., Stolte, N., Stahl-Hennig, C., ten Haaft, P., Heeney, J. L., Swigut, T., Kirchhoff, F., Skowronski, J.
(2002). T-Cell Receptor:CD3 Down-Regulation Is a Selected In Vivo Function of Simian Immunodeficiency Virus Nef but Is Not Sufficient for Effective Viral Replication in Rhesus Macaques. J. Virol.
76: 12360-12364
[Abstract]
[Full Text]
-
Wieckowski, E., Wang, G.-Q., Gastman, B. R., Goldstein, L. A., Rabinowich, H.
(2002). Granzyme B-mediated Degradation of T-Cell Receptor {zeta} Chain. Cancer Res.
62: 4884-4889
[Abstract]
[Full Text]
-
Ndolo, T., Dhillon, N. K., Nguyen, H., Guadalupe, M., Mudryj, M., Dandekar, S.
(2002). Simian Immunodeficiency Virus Nef Protein Delays the Progression of CD4+ T Cells through G1/S Phase of the Cell Cycle. J. Virol.
76: 3587-3595
[Abstract]
[Full Text]
-
Simard, M.-C., Chrobak, P., Kay, D. G., Hanna, Z., Jothy, S., Jolicoeur, P.
(2002). Expression of Simian Immunodeficiency Virus nef in Immune Cells of Transgenic Mice Leads to a Severe AIDS-Like Disease. J. Virol.
76: 3981-3995
[Abstract]
[Full Text]
-
Evans, D. T., Tillman, K. C., Desrosiers, R. C.
(2002). Envelope Glycoprotein Cytoplasmic Domains from Diverse Lentiviruses Interact with the Prenylated Rab Acceptor. J. Virol.
76: 327-337
[Abstract]
[Full Text]
-
Bostik, P., Wu, P., Dodd, G. L., Villinger, F., Mayne, A. E., Bostik, V., Grimm, B. D., Robinson, D., Kung, H.-J., Ansari, A. A.
(2001). Identification of Protein Kinases Dysregulated in CD4+ T Cells in Pathogenic versus Apathogenic Simian Immunodeficiency Virus Infection. J. Virol.
75: 11298-11306
[Abstract]
[Full Text]
-
Khatissian, E., Monceaux, V., Cumont, M.-C., Kieny, M.-P., Aubertin, A.-M., Hurtrel, B.
(2001). Persistence of Pathogenic Challenge Virus in Macaques Protected by Simian Immunodeficiency Virus SIVmac{Delta}nef. J. Virol.
75: 1507-1515
[Abstract]
[Full Text]
-
Liu, L. X., Heveker, N., Fackler, O. T., Arold, S., Le Gall, S., Janvier, K., Peterlin, B. M., Dumas, C., Schwartz, O., Benichou, S., Benarous, R.
(2000). Mutation of a Conserved Residue (D123) Required for Oligomerization of Human Immunodeficiency Virus Type 1 Nef Protein Abolishes Interaction with Human Thioesterase and Results in Impairment of Nef Biological Functions. J. Virol.
74: 5310-5319
[Abstract]
[Full Text]
-
Schaefer, T. M, Bell, I., Fallert, B. A., Reinhart, T. A.
(2000). The T-Cell Receptor zeta Chain Contains Two Homologous Domains with Which Simian Immunodeficiency Virus Nef Interacts and Mediates Down-Modulation. J. Virol.
74: 3273-3283
[Abstract]
[Full Text]
-
Brown, A., Wang, X., Sawai, E., Cheng-Mayer, C.
(1999). Activation of the PAK-Related Kinase by Human Immunodeficiency Virus Type 1 Nef in Primary Human Peripheral Blood Lymphocytes and Macrophages Leads to Phosphorylation of a PIX-p95 Complex. J. Virol.
73: 9899-9907
[Abstract]
[Full Text]
-
Kirchhoff, F., Munch, J., Carl, S., Stolte, N., Matz-Rensing, K., Fuchs, D., Ten Haaft, P., Heeney, J. L., Swigut, T., Skowronski, J., Stahl-Hennig, C.
(1999). The Human Immunodeficiency Virus Type 1 nef Gene Can to a Large Extent Replace Simian Immunodeficiency Virus nef In Vivo. J. Virol.
73: 8371-8383
[Abstract]
[Full Text]
-
Alexander, L., Du, Z., Howe, A. Y. M., Czajak, S., Desrosiers, R. C.
(1999). Induction of AIDS in Rhesus Monkeys by a Recombinant Simian Immunodeficiency Virus Expressing nef of Human Immunodeficiency Virus Type 1. J. Virol.
73: 5814-5825
[Abstract]
[Full Text]
-
Xu, X.-N., Laffert, B., Screaton, G. R., Kraft, M., Wolf, D., Kolanus, W., Mongkolsapay, J., McMichael, A. J., Baur, A. S.
(1999). Induction of Fas Ligand Expression by HIV Involves the Interaction of Nef with the T Cell Receptor zeta Chain. JEM
189: 1489-1496
[Abstract]
[Full Text]
-
SKOWRONSKI, J., GREENBERG, M.E., LOCK, M., MARIANI, R., SALGHETTI, S., SWIGUT, T., IAFRATE, A.J.
(1999). HIV and SIV Nef Modulate Signal Transduction and Protein Sorting in T Cells. Cold Spring Harb Symp Quant Biol
64: 453-464
[Abstract]