Previous Article | Next Article ![]()
Journal of Virology, November 1998, p. 9131-9141, Vol. 72, No. 11
Virology/Immunology
Laboratories1 and
Departments of
Pharmacology and Experimental Therapeutics and
Microbiology,2 University of Maryland School of
Medicine, Baltimore, Maryland 21201
Received 30 March 1998/Accepted 7 July 1998
The large subunit of herpes simplex virus (HSV) ribonucleotide
reductase (RR), RR1, contains a unique amino-terminal domain which has
serine/threonine protein kinase (PK) activity. To examine the role of
the PK activity in virus replication, we studied an HSV type 2 (HSV-2)
mutant with a deletion in the RR1 PK domain (ICP10 Herpes simplex virus (HSV) expresses
a distinct ribonucleotide reductase (RR) that consists of two
heterologous protein subunits. The small subunit (RR2) is a 38-kDa
protein encoded by UL40; the large subunit (RR1), designated ICP6 and
ICP10 for HSV type 1 (HSV-1) and HSV-2, respectively, is a 140-kDa
protein encoded by UL39 (3, 6, 24, 45). The two RR subunits
have different expression kinetics and can function independently.
Thus, RR2 is regulated with characteristic RR1 is a multifunctional protein. It consists of an intrinsic
serine/threonine-specific protein kinase (PK) localized at the amino
terminus and RR1 localized at the carboxy terminus (10, 11, 14,
16, 41, 42, 46, 50). Sequences homologous to ICP10 PK DNA were
cloned from human tissue, suggesting that the PK domain may have
evolved from a cellular gene (62). This implies that by
participating in the viral life cycle, the cellular gene provided a
functional advantage which justified its conservation. Studies of HSV-2
(63) and HSV-1 (25, 26) RR1 mutants led to the
conclusion that RR1 is required for virus growth in nondividing cells
in culture. Furthermore, HSV-1 RR1 mutants are less neurovirulent (7, 31) and less likely to reactivate from latency (33, 58). Inasmuch as RR activity in infected cells is regulated with
Here we describe the results of our studies with an HSV-2 mutant
(ICP10 Cells.
Vero (African green monkey kidney) cells were grown
in Eagle's minimal essential medium (EMEM) supplemented with 10%
fetal calf serum (FCS) and antibiotics. JHLa1 cells (which
constitutively express ICP10) were previously described (30, 41,
64). They were cultured in EMEM with 10% FCS, 1 mM Na pyruvate
(GIBCO-BRL, Gaithersburg, Md.), 1× nonessential amino acids
(GIBCO-BRL), and antibiotics. Vero-ICP10 cells were derived by
transfection of Vero cells with an ICP10 expression vector that has an
SV2-neo cassette (pJW17N) (41). For
serum starvation, cells grown to confluency in EMEM containing 10% FCS
were washed with phosphate-buffered saline (PBS) at pH 7.0 and grown
for 2 days in medium containing 1 or 0.5% FCS.
Construction of ICP10 mutant viruses.
The construction of
the ICP10
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The PK Domain of the Large Subunit of Herpes
Simplex Virus Type 2 Ribonucleotide Reductase (ICP10) Is Required for
Immediate-Early Gene Expression and Virus Growth

![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
PK). ICP10
PK
expressed a 95-kDa RR1 protein (p95) which was PK negative but retained
the ability to complex with the small RR subunit, RR2. Its RR activity
was similar to that of HSV-2. In dividing cells, onset of virus growth
was delayed, with replication initiating at 10 to 15 h
postinfection, depending on the multiplicity of infection. In addition
to the delayed growth onset, virus replication was significantly
impaired (1,000-fold lower titers) in nondividing cells, and
plaque-forming ability was severely compromised. The RR1 protein
expressed by a revertant virus [HSV-2(R)] was structurally and
functionally similar to the wild-type protein, and the virus had
wild-type growth and plaque-forming properties. The growth of the
ICP10
PK virus and its plaque-forming potential were restored to
wild-type levels in cells that constitutively express ICP10. Immediate-early (IE) genes for ICP4, ICP27, and ICP22 were not expressed in Vero cells infected with ICP10
PK early in infection or
in the presence of cycloheximide, and the levels of ICP0 and p95 were
significantly (three- to sevenfold) lower than those in HSV-2- or
HSV-2(R)-infected cells. IE gene expression was similar to that of the
wild-type virus in cells that constitutively express ICP10. The data
indicate that ICP10 PK is required for early expression of the viral
regulatory IE genes and, consequently, for timely initiation of the
protein cascade and HSV-2 growth in cultured cells.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
(also known as
delayed-early)-class kinetics. Its expression peaks at 6 to 8 h
postinfection (p.i.), and it requires functional ICP4 (73).
It imparts
-class kinetics to RR activity (13, 36, 73).
By contrast, RR1 expression is regulated with
(also known as
immediate-early [IE])-class kinetics, as evidenced by the onset of
synthesis at 2 h p.i. and RR1 production in the presence of
cycloheximide (3, 29, 69, 75). The RR1 promoter has an
octamer/TAATGARAT sequence that responds to the VP16/oct1 complex
(18, 70, 77, 78). Basal expression from the RR1 promoter
requires AP-1 factors, but not functional ICP4. RR1 is expressed in
cells infected with ICP4- or ICP0-defective mutants (17, 43-45,
59). Its expression is enhanced by ICP0, involving the
interaction of ICP0 with AP-1 factors (18, 70, 77, 78, 81).
-class kinetics, like the RR2 protein, it seems reasonable to
conclude that the IE component of RR1 regulation is required for the
role of PK activity early in infection. Indeed, the RR and PK
activities of the RR1 proteins can be dissociated by various means,
including cellular proteolysis (10, 32, 37, 42). However, PK
activity is not required for ribonucleotide reduction (15),
and its role in virus growth is still unknown.
PK) with a deletion in the PK domain of ICP10. The data
indicate that ICP10 PK activity is required for virus growth in
exponential-phase and growth-restricted cells in culture, involving optimal expression of IE genes.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
PK virus was described previously (50). Briefly,
wild-type sequences in a plasmid (TP101) that contains the HSV-2
BamHI E and T fragments were replaced with the 1.8-kb
SalI/BglII fragment from pJHL9 (ICP10 mutant with a deletion in the PK catalytic domain [41]). The
resulting plasmid, TP9, contains sequences which code for ICP10 with a
deletion in the PK catalytic domain flanked by 4- and 2.8-kb HSV-2 DNA
sequences at the 5' and 3' ends, respectively. The 10-kb
HindIII/EcoRI fragment from TP9 was
introduced by marker transfer into ICP10
RR, in which the RR domain
of ICP10 had been replaced with the lacZ gene. The resulting
recombinant virus, designated ICP10
PK, was obtained by selecting
white plaques on a background of blue plaques after staining with
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal).
A few white plaques were picked, purified, and grown in Vero cells in
EMEM with 10% FCS.
PK, and a 10-fold molar excess of the wild-type BamHI E/T fragment and progeny virus were titrated on
serum-starved Vero cells (EMEM-1% FCS). ICP10
PK plaque formation
is significantly impaired in serum-starved cells (ratio of plaquing
efficiencies [expressed as PFU per milliliter] of recombinant
virus/wild-type virus, 0.0001), and the plaques are morphologically
distinct. Therefore, recombinants with wild-type plaque morphology were easily detected. A few such plaques were picked, purified, and grown in
Vero cells. The identity of the revertant virus was confirmed by
restored plaquing efficiency (ratio, 0.9) and the ability to express
the 140-kDa ICP10 protein. Revertants were not obtained by
cotransfection of ICP10
PK DNA with a BamHI E/T fragment
that had a deletion in the domain which codes for ICP10 PK due to
MscI/StuI digestion, nor with a BglII
I fragment which contains the VP16 coding sequences.
Plaque assay. Virus titers were determined by plaque assay as previously described (5). Vero-ICP10 cells were used under an overlay consisting of EMEM supplemented with 10 or 0.5% FCS and 0.3% pooled human serum immunoglobulin G (IgG).
Antibodies. The production and specificity of the anti-LA-1 antibody against ICP10 amino acids 13 to 26 were previously described (4, 12). Capsid antibody was prepared in rabbits by using HSV-2 nucleocapsids purified as previously described (67). It recognized primarily the 155-kDa major capsid protein (VP5) in an immunoblotting assay (data not shown). The antibody was adsorbed with Vero cells fixed with paraformaldehyde (PFA) and permeabilized with Triton X-100 (30) and used at the highest dilution that gave no signal with uninfected cells. ICP4 and ICP0 monoclonal antibodies were purchased from Advanced Biotechnologies, Columbia, Md.
Southern blot hybridization with an oligonucleotide probe. Viral DNA was isolated from cytoplasmic virions as previously described (52, 63). Briefly, Vero cells were infected at a multiplicity of infection (MOI) of 5. At 48 h p.i., cells were resuspended (2 × 107/ml) in a buffer consisting of 10 mM Tris-HCl (pH 7.9), 10 mM EDTA, and 0.25% Triton. Following incubation on ice (15 min), NaCl was added at a final concentration of 0.2 M and the nuclei were pelleted by centrifugation at 1,000 × g (10 min, 4°C). The supernatant containing cytoplasmic virions was incubated in 200-µg/ml proteinase K and 0.2% sodium dodecyl sulfate (SDS) (4 h at 37°C), mixed with saturated NaI (final concentration, 1.525 g/ml) and ethidium bromide (final concentration, 3 µg/ml), and centrifuged at 100,000 × g for 16 h.
Viral DNA (5 µg) was digested with BamHI, and the fragments were separated by 1% agarose gel electrophoresis in Tris-acetate-EDTA buffer (40 mM Tris-acetate, 1 mM EDTA) and transferred to GeneScreen membranes (New England Nuclear Corp., Boston, Mass.). The membranes were incubated at 42°C for 2 h in a prehybridization solution containing 5× SSC (750 mM NaCl, 75 mM sodium citrate, pH 7.0), 2% casein, 0.1% N-laurylsarcosine, and 0.02% SDS. The hybridization probes were oligonucleotides AU25 (CAAATGGGATTCATGGACACGTTA) and AU26 (CCCCTTCATCATGTTTAAGGA), which represent sequences in the ICP10 promoter and RR coding regions, respectively. They were 3' tailed with digoxigenin (DIG)-dUTP by terminal transferase (Boehringer Mannheim, Indianapolis, Ind.) in a 20-µl volume with 1× reaction buffer (5 mM CoCl2, 0.05 mM DIG-dUTP, 5-nmol/ml AU25 or AU26, 0.5 mM dATP, and 2.5-U/µl terminal transferase) at 37°C for 15 min and diluted to a final concentration of 5 pmol/ml in prehybridization solution. Hybridization was done at 42°C for 3 h. Membranes were washed once (room temperature) in a solution containing 2× SSC-0.1% SDS for 5 min and twice in 0.5× SSC-0.1% SDS for 15 min each time. For detection of the hybridized DNA fragments, the membranes were rinsed in buffer 1 (100 mM Tris-HCl [pH 7.5], 150 mM NaCl), incubated in buffer 2 (2% [wt/vol] casein in buffer 1) for 40 min and in buffer 2 containing 3 × 10
4-U/ml alkaline phosphatase-conjugated anti-DIG
antibody (Boehringer Mannheim) for 30 min. After washing with buffer 1 (twice) and soaking in buffer 3 (100 mM Tris-HCl [pH 9.5], 100 mM
NaCl, 50 mM MgCl2) for 2 min, the membranes were exposed to
the chemiluminescent substrate Lumi-Phos 530 (Boehringer Mannheim) and
the reaction was developed on X-ray film.
Metabolic labeling and immunoprecipitation.
Cells were mock
infected with PBS (pH 7.4) or infected with 200-PFU/cell HSV-2,
ICP10
PK, or HSV-2(R). They were labeled with [35S]methionine (100 µCi/ml) (specific activity, 1,120 Ci/mmol; Dupont, NEN) in methionine-free EMEM with 10% dialyzed FCS
(64). In some experiments, infection was done in the
presence of cycloheximide (50 µg/ml) for 6 h. At that time, the
cycloheximide was removed and the cells were washed extensively with
PBS and incubated (3 h) in the presence of 10-µg/ml actinomycin D and
100-µCi/ml [35S]methionine (69). For
immunoprecipitation, cell lysates were incubated in cold
radioimmunoprecipitation assay buffer (0.01 M Tris-HCl [pH 8.0],
0.1% SDS, 1% Nonidet P-40, 1% deoxycholate, 0.15 M NaCl) with 1 mM
phenylmethylsulfonyl fluoride and aprotinin at 100 kallikrein U/ml
(Sigma, St. Louis, Mo.) for 15 min on ice and cleared of cell debris by
centrifugation for 30 min at 20,000 × g. They were
incubated (1 h, 4°C) with 15 to 20 µl of antibody (30 min, 4°C)
and with 100 µl of protein A-Sepharose CL4B beads (10 mg; Sigma) in a
buffer consisting of 0.1 M Tris-HCl (pH 8.0), 0.15 M NaCl, and 0.5%
Nonidet P-40. Beads were washed extensively with ice-cold
radioimmunoprecipitation assay buffer, and bound proteins were eluted
by boiling (5 min) in 100 µl of denaturing solution (150 mM Tris-HCl
[pH 7.0], 5.7% SDS, 14% 2-mercaptoethanol, 17% sucrose, 0.04%
bromothymol blue). Proteins were resolved by SDS-polyacrylamide gel
electrophoresis (PAGE) on 7 or 8.5% polyacrylamide gels and visualized
by autoradiography as previously described (10, 42, 64). In
some experiments, cells were resuspended directly in denaturing
solution, boiled for 5 min, and analyzed by SDS-PAGE.
Immunocomplex PK assay.
Immunoprecipitates of cell extracts
normalized for protein concentration by the bicinchoninic acid protein
assay kit (Pierce, Rockford, Ill.) were washed with TS buffer
containing 20 mM Tris-HCl (pH 7.4) and 0.15 M NaCl, suspended in 50 µl of kinase reaction buffer consisting of 20 mM Tris-HCl (pH 7.4), 5 mM MgCl2, 2 mM MnCl2 and 10 µCi of
[
-32P]ATP (3,000 Ci/mmol; Dupont, NEN), and incubated
at 30°C for 15 min. The beads were washed once with 1 ml of TS
buffer, resuspended in 100 µl of denaturing solution, and boiled for
5 min. The proteins were resolved by SDS-PAGE on 7% polyacrylamide
gels as previously described (10, 11, 41, 50, 64).
Western blot assay. Cell extracts or immunoprecipitates were subjected to SDS-PAGE on 7% polyacrylamide gels. Proteins were electrotransferred onto nitrocellulose membranes, and immunoblotting was performed by incubation for 1 h each at room temperature with the respective antibodies, followed by protein A-peroxidase (Sigma). Detection was done with ECL reagents (Amersham, Chicago, Ill.) as previously described (64).
Immunofluorescence staining.
Vero cells were grown on
coverslips for 1 to 2 days, until they reached 70% confluency, and
infected with HSV-2 or ICP10
PK at an MOI of 100 PFU/cell. They were
fixed with 3% PFA for 20 min, and then the remaining fixative was
quenched with 50 mM NH4Cl for 10 min and the cells were
permeabilized with 0.1% Triton X-100 for 4 min (30, 66).
Cells were washed with PBS (pH 7.4), exposed to 10% normal goat serum
for 30 min, and stained with the primary antibody in 10% goat serum
for 20 min. The coverslips were rinsed three times (5 min each time)
and incubated with a fluorescein-conjugated secondary antibody in 10%
goat serum for 30 min. After extensive washing in PBS and one short
wash in water, the coverslips were mounted in Mowiol containing 2.5%
(wt/vol) 1,4-diazabicyclo-[2.2.2]octane on glass slides and examined
with a Zeiss fluorescence microscope (30, 66).
RR assay. RR activity was assayed as previously described (12, 63). Extracts from 12-h-infected cells or mock-infected cells were resuspended in HD buffer (100 mM HEPES buffer [pH 7.6], 2 mM dithiothreitol) at 2 × 107 cell equivalents/ml, incubated on ice for 15 min, disrupted by sonication (30 to 60 s at the maximum setting of an Ultrasonics 220F Sonifier), and clarified of cell debris by centrifugation (100,000 × g; 1 h, 4°C). The HSV RR activity was precipitated with crystalline ammonium sulfate at 45% saturation (0.258 g/ml). Following dialysis and centrifugation (16,000 × g, 30 min), the partially purified enzyme preparations were incubated (37°C, 10 min) with equal volumes of a 2× standard reaction mixture containing 400 mM HEPES buffer (pH 8.0), 20 mM dithiothreitol, and 0.2 mM [3H]CDP (17.8 Ci/mmol; Amersham). The reaction was terminated by addition of 100 mM hydroxyurea with 10 mM EDTA (pH 8.0) and boiling for 3 min. Crotalus atrox venom (Sigma) was added (0.5 mg/ml in 12 mM Tris-HCl [pH 9.0]-4 mM MgCl2-1 mM deoxycytidine), and the mixture was incubated for 30 min at 37°C, boiled for 3 min, and applied to a 0.5-ml Dowex-1 borate column (Sigma). The column was washed with 2.5 ml of H2O, and 0.5-ml eluate fractions were mixed with Biofluor (NEN) for scintillation counting. RR activity is expressed as units per milligram, where 1 U represents the conversion of 1 nmol of [3H]CDP to dCDP/h/mg of protein.
Northern blot hybridization.
The guanidinium
isothiocyanate-cesium chloride gradient method was used to isolate and
purify RNA from Vero cells infected with HSV-2, ICP10
PK, or HSV-2(R)
(MOI, 200 PFU/cell). Northern blot hybridization was done as previously
described (22). Hybridization was for 16 h at 42°C
with a 32P-labeled ICP4 or ICP0 DNA probe in a solution
containing 50% formamide, 5× SSPE (1× SSPE is 0.18 M NaCl, 10 mM
NaH2PO4, and 1 mM EDTA [pH 7.7]), 2×
Denhardt's solution, 0.1% SDS, and 250-µg/ml salmon sperm DNA. The
ICP4 probe was a 1.9-kb BamHI DNA fragment derived from
pXhoI-C (22). The ICP0 probe was a 1.7-kb NruI fragment derived from pGH15 (47). The human GAPDH
probe was a 40-mer oligonucleotide purchased from Oncogene Science
(catalog no. ON407). Probes were [
-32P]dCTP labeled by
the random priming method using an oligonucleotide kit (Pharmacia,
Uppsala, Sweden) in accordance with the manufacturer's instructions.
Blots were washed twice in 2× SSC-0.1% SDS and twice in 0.1×
SSC-0.01% SDS for 10 min each time at ambient temperature and then
washed once in 0.1× SSC-0.1% at 50°C and visualized by autoradiography.
| |
RESULTS |
|---|
|
|
|---|
Characterization of the ICP10
PK and HSV-2(R) viruses.
The
AU25 and AU26 probes, which recognize sequences within the ICP10
promoter and its RR coding region, respectively (Fig. 1), were used to confirm the construction
of the ICP10
PK mutant and its revertant [HSV-2(R)]. DNA (5 µg)
from HSV-2, ICP10
PK, or HSV-2(R) was digested with BamHI,
separated on a 1% agarose gel, and used for hybridization. Bands of
7.6 kb (representing the BamHI E fragment) were observed for
DNAs from HSV-2 (Fig. 2, lanes 2 and 5)
and HSV-2(R) (Fig. 2, lanes 3 and 6) hybridized with AU26 and AU25,
respectively. The AU26-hybridizing band seen for ICP10
PK DNA was 2.2 kb (Fig. 2, lane 1), and the AU25-hybridizing band was 4.4 kb (Fig. 2,
lane 4), as predicted from deletion of the PK coding region.
|
|
Expression of the ICP10 protein with a deletion in the PK domain
(p95).
We have previously shown (41) that the size of
the ICP10 protein with a deletion in its PK domain is 95 kDa (p95). To
determine whether the ICP10
PK virus expresses p95, Vero cells were
infected with 100 PFU/cell and labeled with
[35S]methionine (100 µCi/ml) from 6 to 16 h p.i.
Cells similarly infected with HSV-2 or HSV-2(R) served as controls.
Cell extracts were precipitated with ICP10 antibody, and the proteins
were resolved by SDS-PAGE on 7% polyacrylamide gels. A 140-kDa protein
was precipitated from cells infected with HSV-2 (Fig.
3A, lane 1) or HSV-2(R) (Fig. 3A, lane
3), while a 95-kDa protein (p95) was precipitated from cells infected
with ICP10
PK (Fig. 3A, lane 2). A 38-kDa protein, consistent with
RR2, was equally coprecipitated from cells infected with all three
viruses, indicating that p95 can complex with RR2. Preimmune serum was
negative (Fig. 3A, lane 4).
|
p95 lacks kinase activity.
Studies of RR and PK expression
vectors have shown that the PK activity is associated with the 57- to
60-kDa amino-terminal domain of RR1 and is independent of its 90- to
95-kDa carboxy-terminal domain (10, 41). To determine
whether this is also true within the context of the virus,
extracts of cells infected for 16 h with HSV-2, ICP10
PK, or
HSV-2(R) (MOI, 200 PFU/cell) were immunoprecipitated with ICP10
antibody and subjected to immunocomplex PK assays. The resolved
proteins were transferred to a nitrocellulose membrane and
immunoblotted with ICP10 antibody to determine the protein levels in
the immunoprecipitates. A phosphorylated 140-kDa protein consistent
with ICP10 was observed in HSV-2 (Fig. 3B, lane 1)- or HSV-2(R) (Fig.
3B, lane 3)-infected cells, but p95 was no phosphorylated (Fig. 3B,
lane 2). This is not due to low levels of protein in the precipitates,
since the levels of p95 detected by immunoblotting of the precipitates
from ICP10
PK-infected cells with ICP10 antibody (Fig. 3C, lane 2)
were similar to those of ICP10 in HSV-2 (Fig. 3C, lane 1) and HSV-2(R)
(Fig. 3C, lane 3) precipitates. A phosphorylated 38-kDa protein,
consistent with RR2, was also seen in the ICP10 precipitates from HSV-2
(Fig. 3B, lane 1) and HSV-2(R) (Fig. 3B, lane 3)-infected cells, but it
was not seen in those from ICP10
PK-infected cells (Fig. 3B, lane 2).
Preimmune serum was negative (Fig. 3B, C, and lanes 4). These data are
consistent with previous reports that ICP10 PK phosphorylates both
viral and cellular substrates (2, 6, 10, 47, 50) and
indicate that the PK coding region is required for kinase activity,
also within the context of virus infection.
The ICP10
PK virus has RR activity.
Although p95
coprecipitates with RR2 (Fig. 3A, lane 2), the question arises of
whether the loss of the ICP10 PK domain affects RR activity. To address
this question, RR assays were performed on extracts from cells infected
with ICP10
PK, HSV-2, or HSV-2(R) (MOI, 20 PFU/cell) for 12 h as
previously described (12, 63). As shown in Table
1, the RR activity of the ICP10
PK
virus (8.4 U) was similar to those of HSV-2 and HSV-2(R) (10.2 and 8.8 U, respectively), supporting the conclusion that the PK and RR
activities can be functionally dissociated (10, 32, 37, 42).
|
The ICP10
PK virus is defective for growth in culture.
In a
first series of experiments, we examined the growth of the ICP10
PK
virus in dividing (10% serum) and nondividing (0.5% serum) Vero cells
infected with 2 PFU/cell. Adsorption was for 2 h (0 h on the
growth curve), and virus titers were determined at 2 to 36 h after
adsorption. Cells similarly infected with HSV-2 or HSV-2(R) served as
controls. As shown in Fig. 4A, HSV-2 grew equally well in dividing and nondividing cells. Virus replication began
at 2 h after adsorption. The burst size was 1,000 PFU/cell at
36 h after adsorption. A similar growth pattern was evidenced by
HSV-2(R) (Fig. 4C). By contrast, onset of ICP10
PK replication was
not seen until 15 h after adsorption in both exponentially growing
and serum-starved cells (Fig. 4B). In dividing cells, the rate of virus
growth between 15 and 36 h and the virus titers at 36 h after
adsorption were similar to those seen for HSV-2 (burst size, 1,000 PFU/cell). However, virus titers were significantly (1,000-fold) lower
in serum-starved cells (burst size, 1 PFU/cell at 36 h).
|
PK virus in dividing
cells was somewhat improved by infection under these conditions in that
virus replication began at 10 to 12 h after adsorption, compared
to 15 h at a low MOI. However, virus titers in serum-starved cells
were still approximately 1,000-fold lower than in dividing cells (burst
sizes, 1 and 980 PFU/cell, respectively). The growth defect does not
appear to be cell type determined, as similar results were obtained
with HeLa, L, BHK (data not shown), and 293 (Fig.
5A) cells.
|
PK grows as well as
HSV-2 and HSV-2(R) in cells which supply ICP10 PK activity in
trans, such as JHLa1 (41, 64). 293 and JHLa1
cells were infected with the ICP10
PK virus at 200 PFU/cell in EMEM
containing 1% FCS, a condition which does not support efficient virus
growth. In JHLa1 cells, replication was first seen at 2 h after
adsorption, and the burst size at 20 h was 2,500 PFU/cell. This
compares to growth onset at 10 h after adsorption in 293 cells and
a burst size of 8 PFU/cell at 20 h after adsorption (Fig. 5A). By
contrast, HSV-2 grew equally well in JHLa1 and 293 cells. Replication
began at 2 h, and the burst sizes at 20 h after adsorption
were 2,800 and 2,750 PFU/cell in JHLa1 and 293 cells, respectively
(Fig. 5B). Similar results were obtained for HSV-2(R), with replication beginning at 2 h after adsorption and burst sizes of 2,570 and 2,610 PFU/cell in JHLa1 and 293 cells, respectively (Fig. 5C). We
interpret these findings to indicate that ICP10
PK evidences two
growth defects: (i) delayed growth onset, which is seen in both
dividing and nondividing cells, and (ii) impaired replication, which is
seen only in nondividing cells. An induced or activated cellular
function(s) compensates for the missing viral protein in dividing cells
but not in serum-starved cells.
ICP10
PK has altered plaque morphology and compromised plaquing
ability.
To analyze the plaque-forming ability of the ICP10
PK
virus, we used Vero and Vero-ICP10 cells grown in 10 or 0.5% serum. ICP10
PK plaque-forming ability was severely compromised in
serum-starved Vero cells but not in dividing cells, in which it was
similar to that of HSV-2. Plaque-forming ability was also normal in
Vero-ICP10 cells, which supply ICP10 PK activity (Table
2). The size of the ICP10
PK plaques
was similar to that of HSV-2 or HSV-2(R) plaques. However, in both
dividing and nondividing Vero cells, the ICP10
PK plaques differed
from those of HSV-2 or HSV-2(R) in that they were hazy, apparently
reflecting incomplete cell lysis (Fig. 4B, inset). The extent of cell
lysis differed somewhat from one experiment to the next, but it was
never as complete as that seen for HSV-2 (Fig. 4A, inset) or HSV-2(R)
(Fig. 4C, inset). The morphology of the ICP10
PK plaques in
Vero-ICP10 cells was similar to that of HSV-2 and HSV-2(R) plaques
(data not shown).
|
ICP10
PK has wild-type adsorption-and-penetration kinetics and is
not defective in capsid transport to the nucleus.
One possible
interpretation for the growth and plaquing patterns evidenced by the
ICP10
PK virus is that it is defective in the ability to adsorb to
and penetrate target cells. To address this question, we exposed Vero
cells in six-well plates to 5 or 200 PFU of HSV-2, ICP10
PK, or
HSV-2(R) for 0, 10, 30, 60, 90, and 120 min at 4°C. At this time, the
plates were extensively washed with PBS and overlaid with EMEM-10%
FCS and 0.3% IgG. The plates were reincubated at 37°C for 48 h
and then scored for the number of plaques. Under these conditions, each
plaque represents the progeny of 1 adsorbed PFU. As shown in Fig.
6A, the number of HSV-2 plaques increased
as a function of exposure time, reaching maximal levels at 20 to 30 min
and plateauing thereafter. Similar patterns were seen for ICP10
PK
and HSV-2(R) and at both MOIs, suggesting that ICP10
PK is not
defective for adsorption and penetration.
|
PK is that PK activity is required for the transport of capsids
from the cell periphery to the nucleus. To address this possibility,
Vero cells were exposed to HSV-2 or ICP10
PK at 100 PFU/cell and
virus adsorption was allowed to occur at 4°C for 2 h. At this
time (0 h), the cultures were transferred to 37°C. They were stained
with capsid antibody at 0, 2, 3, and 4 h thereafter. For both
HSV-2 and ICP10
PK, staining was not seen at 0 h, indicating
that capsids present in surface-bound intact viruses are not recognized
by the antibody (Fig. 6B, panels 1 and 2). Presumably, this reflects
antigen inaccessibility due to epitope masking in the intact virus
particles by envelope and/or tegument components. By 2 h after
adsorption, isolated labeled spots were seen at the nuclear membrane,
with a similar distribution in HSV-2 (Fig. 6B, panel 3)- and ICP10
PK
(Fig. 6B, panel 4)-infected cells. Their number appeared to increase
with time, such that by 4 h they had coalesced into rings
localizing around the nuclear membrane. The distribution and intensity
of the labeled spots, and the number of staining cells, were similar in
HSV-2 (Fig. 6B, panel 5)- and ICP10
PK (Fig. 6B, panel 6)-infected
cells. Similar results were obtained for HSV-2(R) (data not shown).
While we do not exclude the possibility that the number of capsids
represented by a fluorescent spot differs for ICP10
PK and HSV-2, the
data suggest that capsid transport to the nucleus is not significantly different for the two viruses. The transport of tegument proteins was
not studied.
p95 expression in ICP10
PK-infected cells and its intracellular
localization.
These studies sought to examine whether the kinetics
of p95 expression in ICP10
PK-infected cells and its intracellular
localization are similar to those of ICP10. Vero cells were infected
with HSV-2, HSV-2(R), or ICP10
PK for 6, 8, 12, or 18 h (in 10%
serum) and stained by an indirect immunofluorescence assay with ICP10
antibody. The results are shown in Fig.
7. Approximately 70% of the HSV-2- and
HSV-2(R)-infected cells stained with the ICP10 antibody at 6 h
p.i., and the proportion reached 100% at 8 h p.i., as previously reported for HSV-2-infected cells (10). Staining was
localized in the cytoplasm and the perinuclear region and had a diffuse distribution pattern. By contrast, cells infected with ICP10
PK for
6 h did not stain with the ICP10 antibody. Staining was first seen
at 8 h p.i. and in only 5 to 10% of the infected cells. It was in
the perinuclear space and in restricted cytoplasmic granules. Diffuse
cytoplasmic staining was not observed at this time (Fig. 7). The
proportion of staining cells increased with time p.i., reaching levels
of 15 to 20% and 85 to 100% at 12 and 18 h p.i., respectively.
These findings indicate that the expression of p95 is delayed relative
to that of ICP10 and, at least during the first 12 h p.i., appears
to be partially sequestered within granular structures in the
cytoplasm. The delay in p95 expression and its sequestration in
granular structures were also seen in cells infected with ICP10
PK in
the presence of 1% FCS (data not shown).
|
Onset of protein synthesis is delayed in ICP10
PK-infected
cells.
Delayed onset of p95 expression and ICP10
PK replication
may reflect the failure to initiate the protein synthesis cascade. To
examine the validity of this interpretation, Vero cells were mock
infected (with PBS) or infected with HSV-2, ICP10
PK, or HSV-2(R)
(MOI, 200 PFU/cell) in medium containing 10% FCS. At 2, 7, or 11 h p.i., the cultures were pulse labeled with
[35S]methionine for 60 min. Proteins in the cell extracts
obtained at that time were resolved by SDS-PAGE. As previously
described (51, 68, 76), protein profiles in cells infected
with HSV-2 for 3 h included IE species ICP4, ICP0, ICP22, and
ICP27, as well as ICP10 (Fig. 8A, lane
2). Host protein synthesis was significantly decreased relative to that
of mock-infected cells (Fig. 8A, lane 1), as exemplified by host cell
protein H (Fig. 8A, lane 2). Additional viral proteins were seen in
cells infected with HSV-2 for 8 h (Fig. 8A, lane 3) or 12 h
(Fig. 8B, lane 4). Similar protein profiles were seen in cells infected
with HSV-2(R), as shown in Fig. 8A (lane 8) for 3-h-infected cells.
|
PK for
3 h (Fig. 8A, lane 5) was not significantly different from that in
mock-infected cells (Fig. 8A, lane 1). ICP4 (identity confirmed by
immunoblotting [Fig. 8C, lane 3]), ICP22, and ICP27 were not seen in
ICP10
PK-infected cells, and the levels of ICP0 (identity confirmed
by immunoblotting [Fig. 8C, lane 1]) were fourfold lower than in
cells infected with HSV-2 or HSV-2(R) [3,130, 3,099 and 782 densitometric integration U for HSV-2, HSV-2(R), and ICP10
PK,
respectively]. The levels of p95 (identity confirmed by immunoblotting
[Fig. 8C, lane 2]) were also lower (sevenfold) than the ICP10 levels
in HSV-2- or HSV-2(R)-infected cells [3,567, 3,630, and 480 densitometric integration U for HSV-2, HSV-2(R), and ICP10
PK,
respectively]. At 8 h p.i., with ICP10
PK, the levels of ICP0
and p95 were higher, and bands consistent with ICP4, ICP22, and ICP27
were also seen (Fig. 8A, lane 6). Protein profiles in cells infected
with ICP10
PK for 12 h (Fig. 8A, lane 7) were similar to those
seen in HSV-2-infected cells at 8 h p.i. (Fig. 8A, lane 3). This
is consistent with the growth kinetics in cells infected at a high MOI
in that virus replication under these conditions begins at 10 to
12 h after adsorption both in 10 and 1% FCS (Fig. 4 and 5). In
JHLa1 cells, expression of the major IE genes (those for ICP4, ICP22,
ICP27, and ICP0) was seen as early as 3 h p.i. with ICP10
PK
(Fig. 8B, lane 1), and their levels were comparable to those seen in
HSV-2-infected cells (Fig. 8B, lane 2).
ICP10 PK is required for expression of ICP4, ICP27, and ICP22.
To further examine the synthesis of IE proteins in ICP10
PK-infected
cells, we used a cycloheximide block, a condition which allows
expression of IE but not other viral genes (29, 69). Cells
were infected with ICP10
PK, HSV-2, or HSV-2(R) at 200 PFU/cell in
the presence of 50-µg/ml cycloheximide (6 h) and labeled with [35S]methionine for 3 h in medium containing
10-µg/ml actinomycin D. Proteins consistent with ICP4, ICP10, ICP0,
ICP22, and ICP27 were seen in cells infected with HSV-2 (Fig.
9A, lane 2) or HSV-2(R) (Fig. 9A, lane 3)
under these conditions. ICP4, ICP22, and ICP27 were not seen in cells
similarly infected with ICP10
PK (Fig. 9A, lane 4). A 110-kDa protein
which is recognized by anti-ICP0 antibody (Fig. 9B, lane 1) was seen in
the ICP10
PK-infected cells (Fig. 9A, lane 4), but its levels were
twofold lower than in HSV-2 (Fig. 9A, lane 2)- or HSV-2(R) (Fig. 9A,
lane 3)-infected cells (1,760 and 3,520 densitometric integration U for
ICP10
PK- and HSV-2-infected cells, respectively). p95 was also seen
in ICP10
PK-infected cells (Fig. 9A, lane 4, and B, lane 2), but its
levels were fivefold lower than those of ICP10 in HSV-2-infected cells
(413 and 2,200 densitometric integration U for p95 and ICP10,
respectively). The data support the conclusion that ICP10 PK is
required for optimal IE gene expression. Significantly, host protein
synthesis was not shut off in ICP10
PK-infected cells (Fig. 9A, lane
4), although the infection was at the same MOI as for HSV-2 or
HSV-2(R). This may reflect the role of ICP10 PK in the phosphorylation
of vhs (55), which is responsible for host
shutoff (54).
|
IE gene transcription is delayed in ICP10
PK-infected cells.
Northern hybridization was used to examine whether the defect in IE
gene expression in ICP10
PK-infected cells is at the level of
transcription. RNA was obtained from Vero cells infected with HSV-2,
ICP10
PK, or HSV-2(R) (in 10% serum), and ICP4 and ICP0 DNAs were
used as probes. GAPDH served as a control transcript. The
relative abundance of ICP4 and ICP0 mRNAs was estimated by first
normalizing to the value of GAPDH mRNA in each sample. The kinetics of ICP4 expression in HSV-2-infected cells were similar to
those previously described for HSV-1-infected cells (27). Optimal levels were seen at 3 h p.i. (Fig.
10B, lane 2), and the transcript was no
longer detectable at 8 h p.i. (Fig. 10B, lane 4). By contrast, in
cells infected with ICP10
PK, ICP4 mRNA was not seen at 3 and 4 h p.i. (Fig. 10A, lanes 2 and 3). It was first seen at 8 h p.i.
(Fig. 10A, lane 4), at which time its levels were similar to those seen
in HSV-2-infected cells at 3 h p.i. (Fig. 10B, lane 2). The ICP4
transcript was still seen at 12 h p.i. (Fig. 10A, lane 5),
indicating that the eventual expression of ICP4 correlates with the
rise of virus growth late in infection. The transcript was no longer
detected at 20 h p.i. with ICP10
PK (Fig. 10A, lane 7). Similar
results were obtained for ICP27 (data not shown). ICP0 mRNA was seen at
3 h p.i. with ICP10
PK (Fig. 10C, lane 2), but its relative
abundance (expressed as ICP0/GAPDH mRNA) was threefold lower
than in cells similarly infected with HSV-2 (Fig. 10C, lane 1) or
HSV-2(R) (Fig. 10C, lane 3) (ICP0/GAPDH ratios of 0.32, 1.0, and 0.95, respectively). We interpret these data to indicate that ICP10
PK is required for early transcription of the IE genes.
|
| |
DISCUSSION |
|---|
|
|
|---|
Studies of deletion and temperature-sensitive mutants showed that RR1 is required for virus growth in nondividing cells in culture (25, 26, 63), as well as for optimal neurovirulence (7, 31) and latency reactivation (33, 58) in infected animals. However, these studies did not differentiate between the respective contributions of the PK and RR domains of the multifunctional RR1 proteins. In nondividing cells, the RR domain presumably functions to supply the RR activity which is necessary for virus growth (25, 26, 63). The PK activity is not required for ribonucleotide reduction (15), and it can be dissociated from the RR activity (10, 15, 32, 37, 42). Because the PK domain likely evolved from a cellular gene and was conserved through many evolutionary cycles (62), it seems reasonable to conclude that the PK activity is critical for virus growth. The studies described in this report were designed to test this hypothesis. The following comments seem pertinent with respect to our findings.
The virus used in these studies (ICP10
PK) is an HSV-2 mutant with a
deletion in the RR1 PK domain. It expresses a 95-kDa protein (p95) that
lacks PK activity but retains the ability to complex with RR2, giving
rise to an RR activity similar to that of the wild-type virus. This is
consistent with our previous finding that ICP10 residues which complex
with RR2 are at the C terminus (amino acids 1096 to 1144)
(12). ICP10
PK is unlikely to have defects other than a
PK-deficient ICP10, since a revertant virus [HSV-2(R)] was generated
by recombination of ICP10
PK DNA with the wild-type BamHI
E/T fragment that encompasses the ICP10 coding sequences, but not with
the BamHI E/T fragment with the sequences which code for
ICP10 PK deleted. Because VP16 activates the expression of IE genes
(8, 53) as well as that of RR1 (18, 70, 77, 78),
we considered the possibility that growth defects evidenced by
ICP10
PK may be due to a mutated VP16 gene. However, this is unlikely, since the wild-type phenotype was not restored in a rescue
experiment with VP16-encoding DNA, and the levels of VP16 were similar
in ICP10
PK- and HSV-2-infected cells (data not shown). Nonetheless,
we do not exclude the possibility that VP16 is involved in the timely
expression of IE genes in cells infected with ICP10
PK, because VP16
is phosphorylated on serine residues (48) and it may be a
substrate for ICP10 PK.
Single-step growth curve analyses indicated that ICP10
PK has two,
apparently distinct, growth defects. First, onset of virus replication
was significantly delayed (10 to 15 h) in both dividing and
nondividing cells. Second, in nondividing cells, virus titers were
approximately 1,000-fold lower than in dividing cells, and plaquing
ability was severely compromised. Similar defects were observed in
various cell lines, indicating that they are not determined by the cell
type. They were not evidenced by the restored virus [HSV-2(R)] or in
cells that constitutively express ICP10 (JHLa1 or Vero-ICP10),
indicating that they are due to the lack of a functional ICP10 PK.
The delayed onset of virus growth is consistent with previous
conclusions that the IE component of RR1 regulation is required for
early expression of PK activity (18, 70, 77, 78, 81). Presumably, growth onset at 10 to 15 h p.i. reflects compensation for the missing ICP10 PK by a cellular function which may be induced or
activated by virion structural proteins. Such an interpretation is
consistent with the finding that replication begins 3 to 5 h
earlier, when the cells are infected at a high (200 PFU/cell), rather
than a low (2 PFU/cell), MOI. Virion proteins that could induce or
activate such a cellular function include VP16, which was previously
shown to activate cellular promoters such as beta interferon
(38) and Gal4 (79), and the promoter-independent promiscuous transactivator ICP0 (20, 39), which was recently shown to be a virion protein (80). Inasmuch as ICP10
PK
growth began at the same time in dividing and nondividing cells, the putative compensatory function presumably does not require de novo
protein synthesis and may involve the activation of a PK cascade. It is
noteworthy that a mutant defective in both the PK and RR activities did
not replicate, even in dividing cells, suggesting that the RR domain
may be involved in induction or activation of the PK compensatory
function (data not shown). Implicit in such an interpretation is the
conclusion that, in dividing cells, sufficient levels of RR activity
are produced early in infection with ICP10
PK to induce or activate
the PK compensatory function. Ongoing studies were designed to examine
the validity of this interpretation.
What is the function of ICP10 PK in the early onset of virus growth?
Our data suggest that ICP10
PK is not defective in adsorption and
penetration or in the transport of incoming capsids to the nucleus.
However, IE gene expression is selectively delayed. Thus, ICP4, which
is required for synthesis of early and late viral proteins (17,
19, 47), was first seen in cells infected with ICP10
PK at
8 h p.i., compared to 3 h p.i. for HSV-2 and HSV-2(R). ICP4
mRNA was not seen until 8 h p.i., and neither ICP4 mRNA nor
protein was seen with a cycloheximide block, a condition that allowed
IE gene expression in cells infected with HSV-2 or HSV-2(R). Cells
infected with ICP10
PK for less than 8 h or in the presence of
cycloheximide were also negative for ICP27, which often functions
together with ICP4 to initiate early gene expression (60),
and ICP22, which is required for late gene expression (40, 57,
61). ICP0 was expressed early after infection with ICP10
PK (3 h) and in the presence of cycloheximide, but its levels were
significantly lower than those in HSV-2- or HSV-2(R)-infected cells.
p95 was also expressed early after infection with ICP10
PK and in the
presence of cycloheximide, but is levels were lower than those of ICP10
in cells similarly infected with HSV-2 or HSV-2(R), suggesting that the
PK domain is involved in ICP10 self-regulation. p95 expression in the
absence of ICP4 is consistent with previous findings that basal
expression from the RR1 promoter requires AP-1 transcription factors
and is independent of ICP4 (18, 77, 78, 81).
Shutoff of host protein synthesis was delayed in ICP10
PK-infected
cells, also in the presence of cycloheximide, and this is consistent
with the incomplete lysis of the infected cells and the hazy appearance
of the ICP10
PK plaques. Because vhs phosphorylation affects its ability to induce mRNA degradation (55),
impaired host shutoff may reflect the role of ICP10 PK in
vhs phosphorylation. Indeed, vhs is not
phosphorylated by another HSV PK species (UL13) (49), and a
phosphorylated 57- to 59-kDa species consistent with vhs was
not seen in ICP10
PK-infected cells (data not shown). If
vhs is phosphorylated by ICP10 PK, ICP10
PK grown in JHLa1 cells may contain a vhs-encoded protein which is relatively
more activated (has higher mRNA degradation activity) than the
vhs-encoded protein of ICP10
PK propagated in Vero cells.
Ongoing studies were designed to test this interpretation.
The exact role of ICP10 PK in IE gene expression is unknown. It is
unlikely that it functions as a transactivator of IE gene expression,
because transactivating activity was not observed in transient
transfection assays with pICP4-cat constructs (unpublished data).
Because ICP10 is located in the virion tegument (65), its PK
domain could be involved in the transport of incoming VP16 to the
nucleus, for example, by maintaining tegument integrity. In addition,
ICP10 PK could phosphorylate and consequently activate VP16, thereby
determining early onset of IE gene expression. Implicit in the
interpretation that ICP10 PK functions at the level of VP16 is the
conclusion that VP16 is not required for early expression of ICP0,
which is seen as early as 3 h p.i. with ICP10
PK. However, previous studies showed that VP16 is required for expression of ICP0
but not ICP4 (1). Also, inasmuch as the kinetics of
synthesis of the IE proteins and their levels were restored to
wild-type patterns in ICP10
PK-infected cells, which provide ICP10 PK
activity in trans, it is unlikely that ICP10 PK is required
for transport of tegument proteins to the nucleus. Nonetheless, ongoing
studies were designed to test this hypothesis.
Delayed onset of ICP10
PK growth could be due to the inhibition of IE
gene expression by PK-defective ICP10. This implies that in the
wild-type virus, ICP10 PK downregulates a protein which inhibits early
onset of IE gene expression. A function that represses accumulation of
ICP4 transcripts was recently described in mouse neurons latently
infected with HSV-1, but it was attributed to the latency-associated
transcript (LAT) locus (9). It may also be that the PK
domain is not involved in IE gene expression but, rather, that in its
absence, the RR domain causes transdominant inhibition of IE gene
expression and virus growth. If this were the case, a virus with
deletions in both the PK and RR domains should grow as well as HSV-2 in
10% FCS. However, a mutant with a deletion in ICP10 failed to
replicate under these conditions (data not shown), suggesting that the
RR domain does not have transdominant downregulatory activity. Finally,
ICP10 PK could phosphorylate, and thereby activate, one or more factors
involved in IE gene transcription. For example, carboxy-terminal domain (CTD) kinase(s), a component(s) of transcription factor IIH, is activated by phosphorylation (23, 28) and, in turn,
phosphorylates the CTD of the large subunit of polymerase II. If their
phosphorylation is altered by the direct or indirect contribution of
virion-associated PKs, polymerase II might be redirected from cellular
to viral IE promoters (56). This possibility has been
excluded for HSV-1 virions. They contain only one
trans-phosphorylating kinase activity (UL13), and it does
not phosphorylate CTD kinases (57). However, ICP10 PK is
structurally and functionally different from ICP6 PK (14, 16,
46). ICP10 is located within the tegument fractions of HSV-2
virions and has trans-phosphorylating activity
(65). It is therefore in a position to be involved in
alterations of the phosphorylation of CTD kinases. Implicit in this
interpretation is the conclusion that ICP10 PK functions in the
nucleus. While the available data indicate that ICP10 is localized in
the cytoplasm and on the surfaces of cells infected with HSV-2 for at
least 6 h (10), we recently found nuclear staining with
monoclonal antibodies to epitopes within the ICP10 PK (but not RR)
domain in cells infected with HSV-2 for 1 to 3 h, i.e., before the
onset of viral DNA synthesis (4a).
The finding that p95 is localized primarily within restricted
cytoplasmic compartments in cells infected with ICP10
PK for 8 to
12 h suggests that, in addition to its role in the early onset of
virus growth, the PK domain is involved in RR1 intracellular localization. RR1 sequestration may render it unavailable for complexation with RR2 and the generation of appropriate levels of RR
activity, thereby explaining the reduced virus titers in nondividing
cells.
What is the role of ICP10 PK in virus pathogenesis? In vivo, ICP10 PK might be required for virus replication at the site of infection and, thereby, efficient latency establishment, and/or for reactivation from latency. It has been proposed that in addition to IE genes, early genes involved in viral DNA synthesis must be turned on by the reactivating stimuli resulting in limited DNA replication. This, in turn, stimulates a viral function that upregulates IE gene expression, leading to the lytic cascade and the production of infectious virus (35). However, reactivating stimuli upregulate AP-1 transcription factors (21, 34, 72), and RR1 is the only viral promoter that contains AP-1 cis response elements (77, 78, 81). Because the ICP10 promoter responds to AP-1 with basal expression which is independent of VP16, ICP0, or ICP4 (18, 77, 78, 81), we propose that ICP10 is an early response to latency-reactivating stimuli. An AP-1 amplification loop is further provided by the ability of ICP10 PK to activate the ras signaling pathway (30, 64). RR1 is uniquely compatible with a virus-reactivating function because it provides both the PK activity which is necessary for IE gene expression and the RR activity which further upregulates IE gene expression by inducing viral DNA synthesis in nondividing neuronal cells (25, 26). ICP0, the expression of which is thus increased, cooperates with AP-1 to further activate expression from the ICP10 promoter (18, 77, 78, 81). It also upregulates other HSV IE genes. The outcome is initiation of the lytic cascade and the production of infectious virus. Indeed, recent studies indicate that the HSV-2 LATs, generally assumed to be the only viral transcripts involved in latency reactivation, are inefficient and weak determinants of HSV-2 reactivation, at least as reflected by the quantity of the major LATs in the ganglia (74). Furthermore, studies of the mouse trigeminal model indicate that during reactivation, early viral transcripts, notably, RR1 and TK, are detected before IE transcripts (71). Consistent with these interpretations, HSV-2 was not reactivated from latently infected ganglia explanted in the presence of an antisense oligonucleotide that inhibits ICP10 expression (65a). Ongoing studies were designed to examine the role of ICP10 PK in latency reactivation.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Virology/Immunology Laboratories, University of Maryland School of Medicine, 10 S. Pine St., Baltimore, MD 21201. Phone: (410) 706-3895. Fax: (410) 706-2513. E-mail: laurelia{at}umaryland.edu.
Present address: Department of Microbiology, School of Medicine.
University of Pennsylvania, Philadelphia, Pa.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Ace, C. I.,
T. A. McKee,
M. Ryan,
J. M. Cameron, and C. M. Preston.
1989.
Construction and characterization of a herpes simplex virus type 1 mutant unable to transinduce immediate-early gene expression.
J. Virol.
63:2260-2269 |
| 2. | Ali, M. A., S. S. Prakash, and R. J. Jariwalla. 1992. Localization of the antigenic sites and intrinsic protein kinase domain within a 300 amino acid segment of the ribonucleotide reductase large subunit from herpes simplex virus type 2. Virology 187:360-367[Medline]. |
| 3. |
Anderson, K. P.,
R. J. Frink,
G. B. Devi,
B. H. Gaylord, and E. K. Wagner.
1981.
Detailed characterization of the mRNA mapping in the HindIII fragment K region of the herpes simplex virus type 1 genome.
J. Virol.
37:1011-1027 |
| 4. | Aurelian, L., P. Terzano, C. C. Smith, T. D. Chung, A. Shamsuddin, S. Costa, and C. Orlandi. 1989. Amino-terminal epitope of herpes simplex virus type 2 ICP10 protein as a molecular diagnostic marker for cervical intraepithelial neoplasia. Cancer Cells 7:187-191. |
| 4a. | Aurelian, L., et al. Unpublished data. |
| 5. | Aurelian, L. 1992. Herpes simplex viruses, p. 473-494. In S. Specter, and G. Lancz (ed.), Clinical virology manual, 2nd ed. Elsevier Science Publishers, New York, N.Y. |
| 6. | Bacchetti, S., M. J. Evelegh, B. Muirhead, C. S. Sartari, and D. Huszar. 1984. Immunological characterization of herpes simplex virus type 1 and 2 polypeptide(s) involved in viral ribonucleotide reductase activity. J. Gen. Virol. 49:591-593. |
| 7. | Cameron, J. M., I. McDougall, H. W. Marsden, V. G. Preston, D. M. Ryan, and S. H. Subak-Sharpe. 1988. Ribonucleotide reductase encoded by herpes simplex virus is a determinant of the pathogenicity of the virus in mice and a valid antiviral target. J. Virol. 69:2607-2612. |
| 8. | Campbell, M. E. M., J. W. Palfreyman, and C. M. Preston. 1984. Identification of herpes simplex virus DNA sequences which encode a trans-acting polypeptide responsible for stimulation of immediate early transcription. J. Mol. Biol. 180:1-19[Medline]. |
| 9. | Chen, S. H., M. F. Kramer, P. A. Schaffer, and D. M. Coen. 1997. A viral function represses accumulation of transcripts from productive-cycle genes in mouse ganglia latently infected with herpes simplex virus. J. Virol. 71:5878-5884[Abstract]. |
| 10. |
Chung, T. D.,
J. P. Wymer,
C. C. Smith,
M. Kulka, and L. Aurelian.
1989.
Protein kinase activity associated with the large subunit of the herpes simplex virus type 2 ribonucleotide reductase (ICP10).
J. Virol.
63:3389-3398 |
| 11. | Chung, T. D., J. P. Wymer, M. Kulka, C. C. Smith, and L. Aurelian. 1990. Myristylation and polylysine-mediated activation of the protein kinase domain of the large subunit of herpes simplex virus type 2 ribonucleotide reductase (ICP10). Virology 179:168-178[Medline]. |
| 12. |
Chung, T. D.,
J. H. Luo,
J. P. Wymer,
C. C. Smith, and L. Aurelian.
1991.
Leucine repeats in the large subunit of herpes simplex virus type 2 ribonucleotide reductase (RR; ICP10) are involved in RR activity and subunit complex formation.
J. Gen. Virol.
72:1139-1144 |
| 13. |
Cohen, G. H.
1972.
Ribonucleotide reductase activity of synchronized KB cells infected with herpes simplex virus.
J. Virol.
9:408-418 |
| 14. |
Conner, J.,
J. Cooper,
J. Furlong, and J. B. Clements.
1992.
An autophosphorylating but not transphosphorylating activity is associated with the unique N terminus of the herpes simplex virus type 1 ribonucleotide reductase large subunit.
J. Virol.
66:7511-7516 |
| 15. |
Conner, J.,
J. Macfarlene,
H. Lankinen, and H. Marsden.
1992.
The unique N-terminus of the herpes simplex virus type 1 large subunit is not required for ribonucleotide reductase activity.
J. Gen. Virol.
73:103-112 |
| 16. | Cooper, J., J. Conner, and J. B. Clements. 1995. Characterization of the novel protein kinase activity present in the R1 subunit of herpes simplex virus ribonucleotide reductase. J. Virol. 69:4979-4985[Abstract]. |
| 17. |
DeLuca, N. A., and P. A. Schaffer.
1985.
Activation of immediate-early, early, and late promoters by temperature-sensitive and wild-type forms of herpes simplex virus type 1 protein ICP4.
Mol. Cell. Biol.
5:1997-2008 |
| 18. |
Desai, P.,
R. Ramakrishnan,
Z. W. Lin,
B. Osak,
J. C. Glorioso, and M. Levine.
1993.
The RR1 gene of herpes simplex virus type 1 is uniquely trans activated by ICP0 during infection.
J. Virol.
67:6125-6135 |
| 19. |
Dixon, R. A. F., and P. A. Schaffer.
1980.
Fine-structure mapping and functional analysis of temperature-sensitive mutants in the gene encoding the herpes simplex virus type 1 immediate early protein VP175.
J. Virol.
36:189-203 |
| 20. | Everett, R. E., C. M. Preston, and N. W. Stow. 1991. Functional and genetic analysis of the role of Vmw110 in herpes simplex virus replication, p. 49-76. In E. K. Wagner (ed.), Herpesvirus transcription. CRC Press, Inc., Boca Raton, Fla. |
| 21. |
Fawl, R. L., and B. Roizman.
1993.
Induction of reactivation of herpes simplex virus in murine sensory ganglia in vivo by cadmium.
J. Virol.
67:7025-7031 |
| 22. | Feng, C. P., M. Kulka, C. C. Smith, and L. Aurelian. 1996. Herpes simplex virus-mediated activation of human immunodeficiency virus is inhibited by oligonucleotide methylphosphonates that target immediate-early mRNAs 1 and 3. Antisense Nucleic Acid Drug Dev. 6:25-35[Medline]. |
| 23. | Fisher, R. P., P. Jin, H. M. Chamberlin, and D. O. Morgan. 1995. Alternative mechanisms of CAK assembly require an assembly factor or an activating kinase. Cell 83:47-57[Medline]. |
| 24. |
Frame, M. C.,
H. S. Marsden, and B. M. Dutia.
1985.
The ribonucleotide reductase induced by herpes simplex virus type 1 involves minimally a complex of two polypeptides (136K and 38K).
J. Gen. Virol.
66:1581-1587 |
| 25. |
Goldstein, D. J., and S. K. Weller.
1988.
Herpes simplex virus type 1-induced ribonucleotide reductase activity is dispensable for virus growth and DNA synthesis: isolation and characterization of an ICP6 lacZ insertion mutant.
J. Virol.
62:196-205 |
| 26. | Goldstein, D. J., and S. K. Weller. 1988. Factor(s) present in the herpes simplex virus type-1 infected cells can compensate for the loss of the large subunit of the viral ribonucleotide reductase: characterization of an ICP6 deletion mutant. Virology 166:41-51[Medline]. |
| 27. |
Harris-Hamilton, E., and S. L. Bachenheimer.
1985.
Accumulation of herpes simplex virus type 1 RNAs of different kinetic classes in the cytoplasm of infected cells.
J. Virol.
53:144-151 |
| 28. |
Hermann, C. H.,
M. O. Gold, and A. P. Rice.
1995.
Viral transactivators specifically target distinct cellular protein kinases that phosphorylate the RNA polymerase II C-terminal domain.
Nucleic Acids Res.
24:501-504 |
| 29. |
Honess, R. W., and B. Roizman.
1974.
Regulation of herpesvirus macromolecular synthesis. I. Cascade regulation of the synthesis of three groups of viral proteins.
J. Virol.
14:8-19 |
| 30. | Hunter, J. C. R., C. C. Smith, D. Bose, M. Kulka, R. Broderick, and L. Aurelian. 1995. Intracellular internalization and signaling pathways triggered by the large subunit of HSV-2 ribonucleotide reductase (ICP10). Virology 210:345-360[Medline]. |
| 31. | Idowu, A. D., E. B. Fraser-Smith, K. L. Paffenberger, and R. C. Herman. 1992. Deletion of herpes simplex virus type 1 ribonucleotide reductase gene alters virulence and latency in vitro. Antiviral Res. 17:145-156[Medline]. |
| 32. | Ingemarson, R., and H. Lankinen. 1987. The herpes simplex virus type 1 ribonucleotide reductase is a tight complex of the type alpha 2 and beta 2 composed of 40K and 140K proteins, of which the latter shows multiple forms due to proteolysis. Virology 156:417-422[Medline]. |
| 33. | Jacobson, J. G., D. A. Leib, D. J. Goldstein, C. L. Bogard, P. A. Schaffer, S. K. Weller, and D. M. Coen. 1989. A herpes simplex virus ribonucleotide reductase deletion mutant is defective for productive acute and reactivatable latent infections of mice and for replication in mouse cells. Virology 173:276-283[Medline]. |
| 34. |
Jin, P., and N. R. Ringertz.
1990.
Cadmium induces transcription of proto-oncogenes c-jun and c-myc in rat L6 myoblasts.
J. Biol. Chem.
265:14061-14064 |
| 35. |
Kosz-Vnenchak, M.,
J. Jacobson,
D. M. Coen, and D. M. Knipe.
1993.
Evidence for a novel regulatory pathway for herpes simplex virus gene expression in trigeminal ganglion neurons.
J. Virol.
67:5383-5393 |
| 36. |
Langelier, Y., and G. Buttin.
1981.
Characterization of ribonucleotide reductase induction in BHK-21/C13 Syrian hamster cell line upon infection by herpes simplex virus.
J. Gen. Virol.
57:21-31 |
| 37. |
Lankinen, H.,
E. Telford,
D. MacDonald, and H. Marsden.
1989.
The unique N-terminal domain of the large subunit of herpes simplex virus ribonucleotide reductase is preferentially sensitive to proteolysis.
J. Gen. Virol.
70:3159-3169 |
| 38. | LeBlanc, J. F., and J. Hiscott. 1992. Differential response of human interferon-beta promoter elements to trans-activation by HSV VP16 and IRF-1. Virology 186:760-763[Medline]. |
| 39. | Lees-Miller, S. P., M. C. Long, M. A. Kilvert, V. Lam, S. A. Rice, and C. A. Spencer. 1996. Attenuation of DNA-dependent protein kinase activity and its catalytic subunit by the herpes simplex virus type 1 transactivator ICP0. J. Virol. 70:7471-7477[Abstract]. |
| 40. | Leopardi, R., and B. Riozman. 1996. Functional interaction and colocalization of the herpes simplex virus 1 major regulatory protein with EAP, a nucleolar-ribosomal protein. Proc. Natl. Acad. Sci. USA 93:4562-4576. |
| 41. |
Luo, J., and L. Aurelian.
1992.
The transmembrane helical segment but not the invariant lysine is required for the kinase activity of the large subunit of herpes simplex virus type 2 ribonucleotide reductase (ICP10).
J. Biol. Chem.
267:9645-9653 |
| 42. |
Luo, J. H.,
C. C. Smith,
M. Kulka, and L. Aurelian.
1991.
A truncated protein kinase domain of the large subunit of herpes simplex virus type 2 ribonucleotide reductase (ICP10) expressed in Escherichia coli.
J. Biol. Chem.
266:20976-20983 |
| 43. |
Marsden, H. S.,
I. K. Crombie, and J. H. Subak-Sharpe.
1976.
Control of protein synthesis in herpesvirus-infected cells: analysis of the polypeptides induced by wild type and sixteen temperature sensitive mutants of strain 17.
J. Gen. Virol.
31:347-372 |
| 44. |
McCarthy, A. M.,
L. McMahan, and P. A. Schaffer.
1989.
Herpes simplex virus type 1 ICP27 deletion mutants exhibit altered patterns of transcription and are DNA deficient.
J. Virol.
63:18-27 |
| 45. | McLauchlan, J., and J. B. Clements. 1983. DNA sequence homology between two co-linear loci on the HSV genome which have different transforming abilities. EMBO J. 2:1953-1961[Medline]. |
| 46. |
Nelson, J. W.,
J. Zhu,
C. C. Smith,
M. Kulka, and L. Aurelian.
1996.
ATP and SH3 binding sites in the protein kinase of the large subunit of herpes simplex virus type 2 of ribonucleotide reductase (ICP10).
J. Biol. Chem.
271:17021-17027 |
| 47. |
O'Hare, P., and G. S. Hayward.
1985.
Evidence for a direct role for both the 175,000- and 110,000-molecular-weight immediate-early proteins of herpes simplex virus in the transactivation of delayed-early promoters.
J. Virol.
53:751-760 |
| 48. | O'Reilly, D., O. Hanscombe, and P. O'Hare. 1997. A single serine residue at position 375 of VP16 is critical for complex assembly with Oct-1 and HCF and is a target of phosphorylation by casein kinase II. EMBO J. 16:2420-2430[Medline]. |
| 49. | Overton, H., D. McMillan, L. Hope, and P. Wong-Kai-In. 1994. Production of host shutoff-defective mutants of herpes simplex virus type 1 by inactivation of the UL13 gene. Virology 202:97-106[Medline]. |
| 50. | Peng, T., J. R. C. Hunter, and J. W. Nelson. 1996. The novel protein kinase of the RR1 subunit of herpes simplex virus has autophosphorylation and transphosphorylation activity that differs in its ATP requirements for HSV-1 and HSV-2. Virology 216:184-196[Medline]. |
| 51. |
Pereira, L.,
M. H. Wolff,
M. Fenwick, and B. Roizman.
1977.
Regulation of herpesvirus macromolecular synthesis. V. Properties of polypeptides made in HSV-1 and HSV-2 infected cells.
Virology
77:733-749[Medline].
|
| 52. | Pignatti, P. F., E. Cassai, G. Meneguzzi, N. Chencinger, and G. Milanesi. 1979. Herpes simplex virus DNA isolation from infected cells with a novel procedure. Virology 93:260-264[Medline]. |
| 53. |
Post, L. E.,
S. Mackem, and B. Roizman.
1981.
Regulation of genes of herpes simplex virus: expression of chimeric genes produced by fusion of thymidine kinase with gene promoters.
Cell
24:555-565[Medline].
|
| 54. |
Read, G. S., and N. Frenkel.
1983.
Herpes simplex virus mutants defective in the virion-associated shutoff of host polypeptide synthesis and exhibiting abnormal synthesis of (immediate early) viral polypeptides.
J. Virol.
46:498-512 |
| 55. |
Read, G. S.,
B. M. Karr, and K. Knight.
1993.
Isolation of a herpes simplex virus type 1 mutant with a deletion in the virion host shutoff gene and identification of multiple forms of the vhs (UL41) polypeptide.
J. Virol.
67:7149-7160 |
| 56. |
Rice, S. A.,
M. C. Long,
V. Lam, and C. A. Spencer.
1994.
RNA polymerase II is aberrantly phosphorylated and localized to viral replication compartments following herpes simplex virus infection.
J. Virol.
68:988-1001 |
| 57. | Rice, S. A., M. C. Long, V. Lam, P. A. Schaffer, and C. Spencer. 1995. Herpes simplex virus immediate-early protein ICP22 is required for viral modification of host RNA polymerase II and establishment of the normal viral transcription program. J. Virol. 69:5550-5559[Abstract]. |
| 58. |
Russell, J.,
N. D. Stow,
E. C. Stow, and C. M. Preston.
1987.
Herpes simplex virus genes involved in latency in vitro.
J. Gen. Virol.
68:3009-3018 |
| 59. |
Sacks, W. R., and P. A. Schaffer.
1987.
Deletion mutants in the gene encoding the herpes simplex virus type 1 immediate-early protein ICP0 exhibit impaired growth in cell culture.
J. Virol.
61:829-839 |
| 60. | Samaniego, L. A., A. L. Webb, and N. A. DeLuca. 1995. Functional interactions between herpes simplex virus immediate-early proteins during infection: gene expression as a consequence of ICP27 and different domains of ICP4. J. Virol. 69:5705-5715[Abstract]. |
| 61. |
Smith, C. C.,
L. Aurelian,
M. P. Reddy,
P. S. Miller, and P. O. P. Ts'o.
1986.
Antiviral effect of an oligo(nucleoside methylphosphonate) complementary to the splice junction of herpes simplex virus type 1 immediate early pre-mRNAs 4 and 5.
Proc. Natl. Acad. Sci. USA
83:2787-2791 |
| 62. | Smith, C. C., J. P. Wymer, J. H. Luo, and L. Aurelian. 1991. Genomic sequences homologous to the protein kinase region of the bifunctional herpes simplex virus type 2 protein ICP10. Virus Genes 5(3):215-226[Medline]. |
| 63. |
Smith, C. C.,
M. Kulka,
J. P. Wymer,
T. D. Chung, and L. Aurelian.
1992.
Expression of the large subunit of herpes simplex virus type 2 ribonucleotide reductase (ICP10) is required for virus growth and neoplastic transformation.
J. Gen. Virol.
73:1417-1428 |
| 64. | Smith, C. C., J. H. Luo, J. C. R. Hunter, J. V. Ordonez, and L. Aurelian. 1994. The transmembrane domain of the large subunit of HSV-2 ribonucleotide reductase (ICP10) is required for the transformation-related signaling pathways that involve ras activation. Virology 200:598-612[Medline]. |
| 65. | Smith, C. C., and L. Aurelian. 1997. The large subunit of herpes simplex virus type 2 ribonucleotide reductase (ICP10) is associated with the virion tegument and has PK activity. Virology 234:235-242[Medline]. |
| 65a. | Smith, C. C., et al. Unpublished data. |
| 66. |
Sodeik, B.,
M. W. Ebersold, and A. Helenius.
1997.
Microtubule-mediated transport of incoming herpes simplex virus 1 capsids to the nucleus.
J. Cell Biol.
136:1007-1021 |
| 67. | Strnad, B., and L. Aurelian. 1978. Proteins of herpesvirus type 2. III. Isolation and immunologic characterization of a large molecular weight viral protein. Virology 87:401-415[Medline]. |
| 68. | Strnad, B. C., and L. Aurelian. 1976. Proteins of herpesvirus type 2. I. Virion, non-virion and antigenic polypeptides in infected cells. Virology 69:438-452[Medline]. |
| 69. | Strnad, B. C., and L. Aurelian. 1976. Proteins of herpesvirus type 2. II. Studies demonstrating a correlation between a tumor-associated antigen (AG-4) and a virion protein. Virology 73:244-258[Medline]. |
| 70. | Sze, P., and R. C. Herman. 1992. The herpes simplex virus type 1 ICP6 gene is regulated by a "leaky" early promoter. Virus Res. 2:141-152. |
| 71. | Tal-Singer, R., T. M. Lasner, W. Podrzucki, A. Skokotas, J. J. Laeary, S. L. Berger, and N. W. Fraser. 1997. Gene expression during reactivation of herpes simplex virus type 1 from latency in the peripheral nervous system is different from that during lytic infection of tissue cultures. J. Virol. 71:5268-5276[Abstract]. |
| 72. |
Valyi-Nagy, T.,
S. Deshmane,
A. Dillner, and N. W. Fraser.
1991.
Induction of cellular transcription factors in trigeminal ganglia of mice by corneal scarification, herpes simplex virus type 1 infection, and explantation of trigeminal ganglia.
J. Virol.
65:4142-4152 |
| 73. | Wagner, E. 1983. Transcription patterns in HSV infections, p. 239-276. In G. Klein (ed.), Advances in viral oncology. Raven Press, New York, N.Y. |
| 74. | Wang, K., L. Pesnicak, and S. E. Straus. 1997. Mutations in the 5' end of the herpes simplex virus type 2 latency-associated transcript (LAT) promoter affect LAT expression in vivo but not the rate of spontaneous reactivation of genital herpes. J. Virol. 71:7903-7910[Abstract]. |
| 75. |
Watson, R. J.,
C. M. Preston, and J. B. Clements.
1979.
Separation and characterization of herpes simplex virus type 1 immediate-early mRNA's.
J. Virol.
31:42-52 |
| 76. |
Wilcox, K. W.,
A. Kohn,
E. Sklyanskaya, and B. Roizman.
1980.
Herpes simplex virus phosphoproteins. I. Phosphate cycles on and off some viral polypeptides and can alter their affinity for DNA.
J. Virol.
33:167-182 |
| 77. |
Wymer, J. P.,
T. D. Chung,
Y.-N. Chang,
G. S. Hayward, and L. Aurelian.
1989.
Identification of immediate-early-type cis-response elements in the promoter for the ribonucleotide reductase large subunit from herpes simplex virus type 2.
J. Virol.
63:2773-2784 |
| 78. | Wymer, J. P., C. M. J. Aprhys, T. C. Chung, T. P. Feng, M. Kulka, and L. Aurelian. 1992. Immediate early and functional AP-1 cis-response elements are involved in the transcriptional regulation of the large subunit of herpes simplex virus type 2 ribonucleotide reductase (ICP10). Virus Res. 23:253-270[Medline]. |
| 79. | Yankulov, K., J. Blau, T. Purton, S. Roberts, and D. L. Bentley. 1994. Transcriptional elongation by RNA polymerase II is stimulated by transactivators. Cell 77:749-759[Medline]. |
| 80. |
Yao, F., and R. J. Courtney.
1992.
Association of ICP0 but not ICP27 with purified virions of herpes simplex virus type 1.
J. Virol.
66:2709-2716 |
| 81. | Zhu, J., and L. Aurelian. 1997. AP-1 cis-response elements are involved in basal expression and Vmw110 transactivation of the large subunit of herpes simplex virus type 2 ribonucleotide reductase (ICP0). Virology 231:301-312[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»