Previous Article | Next Article 
Journal of Virology, November 1998, p. 9034-9044, Vol. 72, No. 11
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Importance of Basic Residues in the Nucleocapsid
Sequence for Retrovirus Gag Assembly and Complementation
Rescue
J. Bradford
Bowzard,1
Robert P.
Bennett,1,
Neel K.
Krishna,1,
Sandra M.
Ernst,2
Alan
Rein,2 and
John W.
Wills1,*
Department of Microbiology and Immunology,
The Pennsylvania State University College of Medicine, Hershey,
Pennsylvania 17033,1 and
ABL-Basic
Research Program, NCI-Frederick Cancer Research and Development
Center, Frederick, Maryland 217022
Received 11 May 1998/Accepted 4 August 1998
 |
ABSTRACT |
The Gag proteins of Rous sarcoma virus (RSV) and human
immunodeficiency virus (HIV) contain small interaction (I) domains within their nucleocapsid (NC) sequences. These overlap the zinc finger
motifs and function to provide the proper density to viral particles.
There are two zinc fingers and at least two I domains within these Gag
proteins. To more thoroughly characterize the important sequence
features and properties of I domains, we analyzed Gag proteins that
contain one or no zinc finger motifs. Chimeric proteins containing the
amino-terminal half of RSV Gag and various portions of the carboxy
terminus of murine leukemia virus (MLV) (containing one zinc finger)
Gag had only one I domain, whereas similar chimeras with human foamy
virus (HFV) (containing no zinc fingers) Gag had at least two.
Mutational analysis of the MLV NC sequence and inspection of I domain
sequences within the zinc-fingerless C terminus of HFV Gag suggested
that clusters of basic residues, but not the zinc finger motif residues
themselves, are required for the formation of particles of proper
density. In support of this, a simple string of strongly basic residues
was found to be able to substitute for the RSV I domains. We also
explored the possibility that differences in I domains (e.g., their
number) account for differences in the ability of Gag proteins to be
rescued into particles when they are unable to bind to membranes.
Previously published experiments have shown that such membrane-binding
mutants of RSV and HIV (two I domains) can be rescued but that those of MLV (one I domain) cannot. Complementation rescue experiments with
RSV-MLV chimeras now map this difference to the NC sequence of MLV.
Importantly, the same RSV-MLV chimeras could be rescued by
complementation when the block to budding was after, rather than
before, transport to the membrane. These results suggest that MLV Gag
molecules begin to interact at a much later time after synthesis than
those of RSV and HIV.
 |
INTRODUCTION |
Retroviral Gag proteins are capable
of directing the production of virus-like particles that are similar in
size, shape, and buoyant density to authentic virions. Three small
regions of the Gag polyprotein, termed assembly domains, have been
found to be important for this budding process (see Fig. 1A)
(35). The membrane-binding (M) domain, located within the
matrix (MA) sequence, is required for the targeting and binding of the
Gag protein to the cytoplasmic face of the plasma membrane
(29). The interaction (I) domain, located within the
nucleocapsid (NC) sequence, provides a major region of interaction
between the 1,500 to 2,000 Gag proteins that make up an individual
particle (30) and mediates the production of particles of
the proper density (1, 33). The late (L) domain, located in
different positions in different Gag proteins, is responsible for a
budding event which occurs after the Gag molecules have reached the
membrane but before the nascent particle is released from the cell
(i.e., during the virus-cell separation step) (20, 34). The
primary focus of this report is the mechanism of I domain function.
In addition to I domains, the NC region of most retroviral Gag proteins
contains one or two zinc finger motifs, characterized by the
amino acid sequence CX2CX4HX4C,
which are known to be involved in viral RNA packaging (3).
Unlike zinc fingers, I domains cannot be identified by a particular
sequence motif, but their presence can be confirmed by analyzing the
density of particles produced upon expression of a given gag
allele. Isopycnic sucrose gradient centrifugation has been used to map
the positions of at least two I domains in the NC regions of human
immunodeficiency virus (HIV) and Rous sarcoma virus (RSV) (1,
33). Interestingly, both of these Gag proteins have the same
number of zinc finger motifs as they do identifiable I domains. Equally
interesting is the conspicuous absence of zinc finger motifs in the
putative NC region of spumavirus Gag proteins (11). To date,
no spumavirus NC region has been analyzed for the presence of specific
sequences capable of controlling the density of virus-like particles.
Although there has been a correlation between the number of zinc finger
motifs in the NC portion of Gag and the number of identifiable I
domains, previous experiments demonstrating that substitutions in the
single zinc finger of murine leukemia virus (MLV) do not alter
particle density (13) led us to believe that there is no
functional significance to this relationship. The experiments described
here confirm this hypothesis, identify dual I domains in the human
foamy virus (HFV) Gag protein, and implicate basic residues as the
primary functional components of I domains. They also suggest that I
domains may play a role in the timing and location of the initial Gag
protein multimerization.
 |
MATERIALS AND METHODS |
Previously constructed gag alleles.
The RSV
gag gene was obtained from pATV-8, an infectious molecular
clone of the RSV Prague C genome (28). The MLV
gag and pol genes were from pRR88, a clone of the
integrated Moloney MLV proviral genome in the plasmid pGCcos3neo
(13). The HFV gag gene was obtained from pHSRV13,
an infectious molecular clone constructed and kindly
provided by R. Flugel (18). Several of the plasmids used in
these experiments have been previously described, namely, pSV.Myr1
(referred to here as pSV.R.M1) (36), pSV.T10C.PR
(34), pSV.Bg-Bs (32), pSV.p25 (33),
and pSV.p25.AD3 (33). Standard protocols were used for
all DNA manipulations (25), and all plasmids were propagated
in Escherichia coli DH-1 cells in 2× YT medium containing
25 µg of ampicillin/ml.
Newly constructed gag alleles.
Two plasmids were
constructed to express the MLV Gag protein. The vector pSV.MLV, which
expresses the gag and pol genes of MLV, was
constructed by transferring the complete MLV coding sequence (including
env) from pRR88 into pSV.R.M1 in place of the RSV
gag sequence. The MLV fragment was prepared by digesting
pRR88 with AatII (nucleotide [nt] 362), blunt-ending the
resulting 3' overhang with the Klenow fragment of DNA polymerase I
(Klenow), and then digesting it with BssHII (nt 8211). This
was then ligated with T4 DNA ligase to the large fragment of pSV.R.M1,
which had been digested with SstI (nt 255), treated with
Klenow, and digested with BssHII (nt 2724). A plasmid
expressing MLV Gag and a truncated form of Gag-Pol, pSV.MLV.PR
, was
made by first digesting the parent plasmid, pSV.MLV, with
DraIII (MLV nt 2330, 5602, and 6656) and treating with
Klenow. The 10,078-nt fragment was gel purified and recircularized at a
concentration of 20 µg/ml in the presence of XbaI linkers
(5'-CTAGTCTAGACTAG-3'),
which contain termination codons (underlined) in all three
reading frames.
A second set of expression plasmids was generated to replace the
membrane-binding domain of MLV with that of the Src oncoprotein (21). The plasmid pSV.MLV.PR
was digested with
PstI (MLV nt 738), treated with Klenow, and digested with
EagI (pSV.R.M1 nt 3658). The 4,901-nt fragment was then
gel-purified and ligated to the 5,774-nt fragment of pSV.R.M1 that had
been prepared with MluI, Klenow, and EagI in
succession, to create pSV.M.M1.PR
. pSV.M.M1 was constructed to
express the MLV Gag and Gag-Pol proteins containing the Src
membrane-binding domain in place of the M domain of MLV. For this, the
2,227-nt XhoI-BssHII fragment of pSV.M.M1.PR
was replaced with the 6,553-nt XhoI (nt
1559)-BssHII (nt 8211) fragment from pSV.MLV. An
unmyristylated form of the Src-RSV Gag chimera, R.M(
), was
constructed by mutagenesis of the R.M1 gag allele by using
previously described methods and an oligonucleotide with the sequence
5'-GGATCAAGCATGGAATCCAGCAAAAGC-3'. As a result, the second codon was changed from GGA (glycine) to GAA (glutamic acid)
and the expression plasmid was named pSV.Myr1(
). pSV.MLV.Myr(
), which expresses a myristate-minus form of the Src-MLV chimera, was then
constructed by joining the 7,473-nt fragment from pSV.MLV that had been
prepared with PstI, Klenow, and BssHII with the 6,708-nt fragment derived from pSV.Myr(
) that had been digested with
MluI, Klenow treated, and digested with BssHII.
A third set of plasmids was made to express RSV-MLV chimeras. pSV.BgM
was generated by digesting plasmids pSV.R.M1 and pRR88
with
BglII and
XhoI, respectively. The resulting
sticky ends were
made blunt by using Klenow, and the DNAs were then
digested with
BssHII. The large fragment of pSV.R.M1 and the
6,652-nt fragment
of pRR88 were gel purified and ligated, thereby
recreating the
XhoI site and producing pSV.BgM. Plasmids
which express a myristate-minus
derivative of this chimera,
pSV.BgM.M(

), or an internally deleted
chimera, pSV.T10M.PR

, were
created in a similar fashion, except
that the parental plasmids
used were pSV.Myr(

) and pSV.BgM, or
pSV.T10C.PR

and
pSV.MLV.PR

, respectively. The MLV protease (PR)
active site
mutation D32L found in pRR88.2204 (
12) was subcloned
into
pSV.BgM by digesting each plasmid with
XhoI and treating
it
with Klenow and
BssHII. The desired fragments were gel
purified
and ligated to form pSV.BgM.PR

. To create the point
mutations
(pSV.BgM.C26/29S and pSV.BgM.Y28S), internal deletions
(pSV.BgM.

K8-R11
and pSV.BgM.

R16-R23), and the
carboxy-terminal truncations (pSV.BgM.S402**,
pSV.BgM.A478**,
pSV.BgM.D501**, and pSV.BgM.R521**) of MLV NC,
the respective pRR88
mutants were subcloned into pSV.BgM by the
same procedure as was used
for the protease active-site mutation
(see reference
13 for C26/29S and Y28S and reference
22 for

K8-R11 and

R16-R23; R521** has been
previously referred to as
R44Ter [
22] and S402**,
A478**, and D501** are previously unpublished).
To investigate the sequence requirements for dense particle formation,
two constructs which expressed proteins encoding foreign
amino acids at
the end of p25 were made. pSV.p25.AD3 was digested
with
BssHII, treated with Klenow, and digested with
BglII. Oligonucleotides
with the sequences
5'-GATCGTAAGAAAGGTCGCAAAAAGGTCTAGA-3' and
5'-TCTAGACCTTTTTGCGACCTTTCTTAC-3'
or
5'-GATCACCATCACCATCACCACGTCTAGA-3' and
5'-TCTAGACGTGGTGATGGTGATGGT-3'
were annealed and ligated to
the prepared pSV.p25.AD3 vector to
create pSV.p25.RKK and pSV.p25.H6,
respectively.
To determine whether the HFV Gag protein contains I domains, several
plasmids were constructed to express RSV-HFV chimeras.
These constructs
were made by using PCR to amplify the desired
sequences of HFV from the
plasmid pHSRV13. The oligonucleotides
used in the PCR were designed to
incorporate
BglII and
BssHII
restriction
endonuclease sites (underlined) flanking the HFV sequences.
The
amplified product was digested with the respective enzymes
and then
cloned into the plasmid pSV.G
1P (
7) in place of
the
small fragment generated by double digestion with
BglII
and
BssHII.
Amplifications of fragments for pSV.Bg.1,2,3,
pSV.Bg.1,2, and
pSV.Bg.1 all used
5'-TTGA
AGATCTGATGCTTTCTGGACAAAATTA-3' as the
forward primer and
5'-TACTAG
GCGCGCGTTAACACCCCTTGTTT-3',
5'-TACTAG
GCGCGCTGATTTGGCCTAGGAGTTT-3',
and
5'-TACTAG
GCGCGCGGAAGATTATATCCTCCTTGA-3' as the
respective
reverse primers. Amplifications of fragments for pSV.Bg.2
and
pSV.Bg.2,3 both used
5'-TTGA
AGATCTATCTAGTACTCAGAATCAAAAT-3' as
the
forward primer and
5'-TACTAG
GCGCGCTGATTTGGCCTAGGAGTTT-3' and
5'-GTC
GCGCGCTTAGGATGATCGTTGGTTT CGGTT-3' as
the respective reverse
primers. Finally, amplification of the
fragment for pSV.Bg.3 used
5'-TTGA
AGATCTTCAAACTCCTAGGCCAAAT-3' as the
forward primer and
5'-GTC
GCGCGCTTAGGATGATCGTTGGTTTCGGTT-3' as the
reverse primer.
Transfection and labeling of cells and immunoprecipitation of Gag
proteins.
COS-1 cells were transfected by the
DEAE-dextran/chloroquine method, as previously described
(36). Approximately 48 h after transfection, the cells
were labeled for 2.5 h with either
L-[4,5-3H(N)]leucine (150 µCi, 60 Ci/mmol)
or 50 µCi (>1,000 Ci/mmol) of
L-[35S]methionine (RSV-HFV chimeras). The
cells and growth medium from each labeled culture were separated and
mixed with lysis buffer containing protease inhibitors (36).
The Gag proteins were immunoprecipitated with polyclonal rabbit serum
against whole RSV (32) (reacts with MA, capsid [CA], NC,
and PR) or a combination of
-RSV serum and polyclonal goat serum
against MLV CA. The immunoprecipitated proteins were resolved by
electrophoresis in sodium dodecyl sulfate (SDS)-12% polyacrylamide
gels and detected by fluorography (36).
Isopycnic sucrose gradient analysis.
To determine the
density of the particles produced by our various constructs,
transfected COS-1 cells were labeled for 8 h with either 500 µCi
of L-[4,5-3H(N)]leucine or 100 µCi of
L-[35S]methionine (RSV-HFV chimeras). The
growth medium was collected and centrifuged for 1 min at
15,000 × g to remove cellular debris before being
layered onto a 10 to 50% sucrose gradient. An internal control was
included in each gradient and consisted of either purified, unlabeled
Moloney MLV or labeled COS-cell-produced RSV particles of wild-type
density. The gradients were spun for 16 h at 83,500 × g in a Beckman SW41Ti rotor, and 0.6-ml fractions were
collected from the bottom of each tube. The relative amount of MLV in
each fraction was determined by the incorporation of [
-32P]TTP during synthesis of DNA on a poly(A)
template as described previously (1). The amount of labeled
Gag protein in each fraction was determined by immunoprecipitating with
the appropriate antibody followed by SDS-polyacrylamide gel
electrophoresis (PAGE), fluorography, and densitometry of the
Gag-specific bands.
 |
RESULTS |
When expressed in mammalian cells, the RSV Gag protein directs the
production of virus-like particles. It is still able to produce
particles when its M domain is replaced by that of the Src oncoprotein
(37). However, the RSV Gag derivative Bg-Bs (Fig.
1A), which is truncated after residue 418 in CA, produces low amounts of particles (Fig. 1B) that are light in
density (1.14 g/ml) relative to the wild type (Fig. 1C; see also
reference 32). The low density of this mutant is due
to the lack of I domains within the NC sequence, which are responsible
for proper Gag-Gag interactions (33). Therefore, by fusing
foreign sequences to Bg-Bs and assaying for restoration of normal
density to the particles produced, I domains from other retroviral Gag
proteins can be identified. This gain-of-function approach has been
used to successfully locate two I domains in the NC region of the HIV
Gag protein (1). To gain a better understanding of how I
domains work, we initially set out to map the I domains of MLV and HFV
Gag proteins and to characterize their important sequence features.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 1.
The C terminus of MLV contains at least one I domain.
(A) Diagram of RSV-MLV chimeras. The wild-type RSV Gag (shaded) and MLV
Gag (unshaded) proteins are aligned at the junction site of the
chimeras (made by fusing the XhoI and BglII sites
of the corresponding genes). The assembly domains of RSV are indicated
by black boxes and the zinc fingers in NC by hatched regions. The site
of in-frame suppression of the stop codon separating the MLV
gag and pol genes is marked "is." Sites of
proteolytic cleavage are indicated by vertical lines through the
proteins, and numbers refer to the last amino acid of the released
products. The open box and squiggled line at the N terminus of the
chimeras represent replacement of the first 10 RSV amino acids with
those of pp60v-src and the consequent addition of myristic acid, respectively. The MLV protease active-site
mutation is indicated by a black dot. Chimera R.M1 has been previously
referred to as Myr1 (37). (B) Expression of RSV-MLV
chimeras. The RSV-MLV constructs were transfected into COS-1 cells, and
subsequently labeled for 2.5 h with
L-[4,5-3H(N)]leucine. The Gag proteins from
the medium and lysates of the transfected cells were immunoprecipitated
with a mixture of -RSV and -MLV antibodies, separated by
SDS-PAGE, and visualized by autoradiography. The numbers to the left
are the positions (in kilodaltons) of the molecular mass markers, and
the position of the RSV-MLV hybrid CA cleavage product
p34CA is indicated. (C) Sucrose density gradient analysis.
Cells were transfected and subsequently labeled for 8 h. Medium
was collected, cleared of cellular debris, mixed with purified MLV, and
centrifuged for 16 h at 83,500 × g through a 10 to 50% sucrose gradient. The gradients were fractionated, and the
amount of control or experimental particles in each fraction was
determined by reverse transcriptase assays or immunoprecipitation
followed by densitometry of autoradiograms, respectively. An arrow in
each panel indicates the direction of sedimentation. O.D., optical
density.
|
|
Identification of an MLV I domain.
Several chimeric proteins
were made to identify I domains in the MLV NC region (Fig. 1A). When
amino acid residues 314 to 538 from the MLV Gag protein were fused to
Bg-Bs to form BgM (Fig. 1A), efficient release of protein into the
medium was restored (Fig. 1B). Since this construct contains most of
the adjacent pol gene, including the sequences encoding the
MLV protease, Gag cleavage products were also evident, including the
chimeric capsid species p34CA (Fig. 1B, lanes 2). Protease
activity was not required for budding, however, since BgM.PR
was
released just as efficiently (Fig. 1B, lanes 3).
When particles made from BgM were analyzed in sucrose gradients, they
were found to be of higher density (1.19 g/ml; Fig. 1C) than those from
Bg-Bs (Fig. 1C), indicating that amino acids either in the C terminus
of MLV Gag or in MLV Pol were able to provide I domain activity. The
particles from BgM were of slightly higher density than the control MLV
particles (1.16 to 1.18 g/ml), which is in agreement with previous
results for Env-less particles of RSV (37). To more
specifically map the region of MLV that contains this I domain
activity, we constructed truncations of BgM that ended after MLV amino
acid 401, 477, 500, or 520. Of these constructs, only the largest
(Bg.R521**) produced particles efficiently (Fig. 1B, lanes 4), and
these were of high density (1.19 g/ml; Fig. 1C). Low amounts of
particles (less than 10% of wild type) were obtained from Bg.D501**
and Bg.S402** (Fig. 1B, lanes 5 and 7) but were light in density (Fig.
1C). Bg.A478** did not produce enough particles to test in density
gradients. These data reveal the presence of at least one I domain in
the NC region of MLV Gag whereas similar analyses of RSV and HIV had revealed two (1, 8, 33).
Importance of basic residues for I domain function.
The zinc
fingers of Gag proteins have long been known to be dispensable for
particle assembly and, in the case of MLV, particle density
(13). To ensure that this was true for the RSV-MLV chimeras, we constructed zinc finger point mutations in the context of
full-length BgM (Fig. 2A). In mutant
Bg.C26/29S, the cysteine residues at positions 26 and 29 of MLV NC were
replaced with serine residues, while in mutant Bg.Y28S, the tyrosine
residue at position 28 was replaced with serine. Neither of these
mutations reduced the number of particles released (Fig. 2B, lanes 4 and 5) nor the densities (1.18 g/ml) relative to wild type (Fig. 2C).
This confirms that an intact zinc finger motif is not required for
dense particle formation.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 2.
An intact zinc finger motif is not required for MLV I
domain activity. (A) Diagram of the chimeric BgM protein and various
mutants derived from it. The precise locations of the changes made in
the 60 amino acids of the MLV NC sequence are shown along with the
positions of basic residues (marked with +). Substitutions are
designated with arrows and deletions are boxed. The residues comprising
the zinc finger motif are highlighted in gray. (B) Gag proteins were
labeled and visualized and (C) sucrose gradient analysis was performed
as described in the legend for Fig. 1.
|
|
The only feature of retroviral NC sequences that is more conserved than
the zinc fingers is the presence of numerous basic
amino acids. To
investigate the potential role of basic residues
in the production of
dense particles, two internal regions in
NC were deleted (Fig.
2A). The
first deletion tested, Bg.

K8-R11,
lacked two basic residues and one
acidic residue but had no effect
on particle release (Fig.
2B, lanes 2)
or density (1.18 g/ml;
Fig.
2C). The second deletion, Bg.

R16-R23,
lacked eight amino
acids, including four basic residues, and completely
(limit of
detection, <2% of wild type) blocked particle release (Fig.
2B,
lanes 3). The nature of the assembly defect of this construct
is
not clear, but the lack of proteolytic processing in the cells
(Fig.
2B, lanes 3) suggests that the mutant proteins were either
not arriving
at the plasma membrane or not interacting with the
mutant Gag-Pol
molecules once they arrived to allow protease activation.
Because the
removal of the second set of basic residues had a
detrimental effect on
particle assembly, we were unable to make
a density determination for
this mutant and therefore cannot draw
a conclusion from this result
about the contribution of these
residues to the MLV I domain. However,
unpublished results (
21a)
indicate that MLV Gag proteins
with this deletion form particles
of normal density and this, taken
together with the results from
the C-terminal truncation mutants,
suggests that the MLV I domain
maps somewhere between Gag residues 501 and 520 (residues 24 to
43 of NC).
To test the hypothesis that basic residues alone are sufficient for I
domain function, we investigated artificial sequences
of basic residues
in our gain-of-function assay (Fig.
3).
Since
CA is not required for budding and might actually interfere with
the function of a small basic extension, we used the shorter RSV
Gag
derivative named p25 (
33). p25 contains only 180 Gag
residues
and, like Bg-Bs, contains the M and L assembly domains but
lacks
both I domains. Therefore, unless an I domain is added to its
C
terminus, p25 releases few particles (down 10-fold from wild
type; Fig.
3B, lanes 2), all of which exhibit lighter than normal
density (1.14 g/ml; Fig.
3C). To decide which sequence of basic
residues to use, we
examined the NC regions of RSV, HIV, and MLV.
Within the regions
identified as I domains of these proteins,
the following sequences are
found: PKKRK (RSV), PRKK (HIV), and
PKKP (MLV). We wanted to use a
sequence similar but not identical
to any of these, so we chose
the sequence RKKGRKK (p25.RKK). We
also constructed a p25 chimera
with a stretch of six histidine
residues, which is slightly basic but
does not resemble basic
regions found within NC, at its C terminus
(p25.H6). Both chimeric
proteins expressed well and released particles
(down 10-fold from
wild type; Fig.
3B, lanes 3 and 4). As previously
described (
33),
the addition of residues 418 to 584 from RSV
Gag to the p25 truncation
(p25.AD3) restored normal density to the
produced particles (1.18
g/ml; Fig.
3C). Similarly, p25.RKK (1.18 g/ml), but not p25.H6
(1.13 g/ml), was found to be capable of producing
dense particles
(Fig.
3C). A portion of the extracellular Gag protein
from p25,
p25.H6, and p25.RKK is found in the top fractions of the
gradient.
We have previously shown (
33) that the p25 Gag
proteins that
sediment into the gradient (fractions 11 and 12, Fig.
3C)
are
membrane enclosed and that the proteins at the top of a gradient
containing particles from a

NC construct (which also lacks I
domains) are not particulate (data not shown). As expected, the
upper material fails to shift in the gradients relative to the
internal
control while the material that moves well into the gradient
changes
density in a construct-dependent manner. It should be
noted that the
particles formed by p25.RKK are more heterogeneous
in density than
those formed by the BgM mutations (Fig.
1C and
2C). However, the
heterogeneity of the p25.RKK particles is only
slightly more pronounced
than that of the p25.AD3 particles and
the bulk of the peak is clearly
shifted relative to the peak of
p25 particles. Thus, from this
experiment, it seems that a simple
string of strongly basic
residues is sufficient to provide I domain
function.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Basic residues can substitute for the RSV I domain. (A)
p25 fusion constructs are shown with foreign amino acids denoted by
their single letter code. (B) Gag proteins were labeled and visualized
and (C) sucrose gradient analysis was performed as described in the
legend for Fig. 1.
|
|
Absence of zinc fingers in HFV I domains.
Although the
experimental evidence shows that zinc finger motifs can be disrupted
without inhibiting I domain function (13), there remained an
apparent correlation between the number of I domains present in a given
Gag protein and the number of zinc finger motifs. That is, our
low-resolution mapping of I domains revealed two in RSV Gag and two in
HIV Gag, but only one in MLV Gag. To eliminate the possibility that
some aspect of the zinc finger other than zinc binding was contributing
to I domain function, we decided to examine the HFV Gag protein, which
lacks zinc fingers, for the presence of I domains.
Within the HFV NC sequence are three glycine-rich (GR) regions
containing large numbers of basic residues (previously designated
GR
boxes I, II, and III; see reference
25). Since our
previous
experiments indicate that basic residues are likely to be
important,
we made Bg-Bs/HFV chimeric proteins that contained various
combinations
of these three regions (Fig.
4A). Although each RSV-HFV chimera
expressed well, the amount of protein released into the media
varied
considerably (from 2 to 35% of wild type; Fig.
4B). In
each case,
however, enough extracellular material was available
to perform sucrose
density gradient analysis. When the entire
NC region of HFV (amino
acids 414 to 780) was fused after residue
418 of RSV Gag to form
Bg.1,2,3, dense particles were produced
(1.19 g/ml; Fig.
4C). This was
also true when residues 414 to
581 (Bg.1,2, 1.19 g/ml) or only residues
414 to 540 (Bg.1) were
added to Bg-Bs (Fig.
4C). These results show
that an I domain
is present within amino acids 414 to 540 of HFV Gag.
To determine
whether additional I domains were present in the HFV Gag
sequence
downstream of residue 540, we examined particles from Bg.2
(containing
residues 523 to 581), Bg.3 (residues 574 to 780), and
Bg.2,3 (residues
523 to 780) (Fig.
4C). Although particles from Bg.2
and Bg.3 were
lighter than normal (1.16 g/ml), when the two regions
were combined,
the resultant protein (Bg.2,3) was able to form dense
particles
(1.19 to 1.22 g/ml). This result indicates the presence of an
additional I domain downstream of the one contained in Bg.1. From
these
experiments, we can conclude that HFV NC contains at least
two I
domains in the absence of zinc finger motifs. Although the
regions of
HFV Gag that contain the interaction domains are also
rich in basic
residues, the importance of these residues for HFV
I domain function
requires further investigation.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 4.
The HFV Gag protein contains at least two I domains. (A)
RSV and HFV Gag proteins are illustrated. The vertical dotted lines
separate HFV Gag into regions which are analogous to the cleavage
products of other retroviral Gag proteins. The black vertical bars in
HFV NC indicate the position of the three GR boxes. The numbers below
the chimeric proteins indicate the HFV Gag residues contained in the
constructs and the letters at the end of the molecules are the single
letter codes of any nonviral residues present. (B) Expression of
RSV-HFV chimeras was performed as described in the legend for Fig. 1
except that L-[35S]methionine was used to
label the cells, and the relevant proteins were immunoprecipitated with
-RSV antibody. (C) Sucrose gradient analysis was performed as
described in the legend for Fig. 1 except that the RSV-HFV chimeras
were labeled with L-[35S]methionine and
immunoprecipitated with -RSV antibody, and two constructs (Bg.2,3
and Bg.3) were mixed with labeled RSV Gag-only particles (rather than
authentic MLV) before layering on the gradient.
|
|
Complementation analysis.
Previous experiments with the Gag
protein of RSV have shown that all types of mutants defective for
membrane binding can be rescued into particles by complementation, but
this requires the presence of functional I domains (2, 34,
37). In contrast, the unmyristylated form of the MLV Gag protein
cannot be rescued by functional MLV Gag, even when the single I domain
is intact (27). These observations suggest the possibility
that differences between the I domains of RSV and MLV are responsible
for the different rescue phenotypes. To test this hypothesis, we
examined the ability of a myristate-minus form of the BgM chimera to be
rescued. Because its I domain is derived from MLV, we predicted that
this chimeric protein would not be rescued into particles when its
membrane-binding domain (here derived from Src) was inactivated.
We used the protease-proficient form of BgM.M(
) and a
protease-deficient form of the rescuing molecule. Thus, the appearance
of Gag cleavage products in the medium would be an indicator of rescue.
When BgM.M(

) was expressed, it was unable to release particles on its
own (Fig.
5B, lanes 5) and, as expected
for a non-membrane-targeted
Gag protein (
36,
37), exhibited
reduced processing by the
MLV protease (compare with Fig.
5B, lanes 4).
Upon coexpression
of BgM.M(

) with a protease-deficient,
budding-competent MLV protein,
M.M1.PR

, both full-length products
could be observed in the cell
lysates but only the MLV Gag precursor,
in the absence of any
cleavage products, was evident in the media (Fig.
5B, lane 6).
Similarly, a budding-competent RSV protein,
R.M1.PR

, was unable
to rescue BgM.M(

), and again, only uncleaved
RSV Gag is seen
in the medium (Fig.
5B, lane 7). Thus, it appears
that BgM.M(

)
cannot interact with other Gag proteins to be rescued
into particles
and therefore behaves like the unmyristylated MLV Gag
protein
(
27), consistent with the hypothesis that the
determinant of
rescuability resides in the C terminus of Gag. The
trivial explanation
that the myristate-minus form of BgM (and MLV Gag)
is globally
misfolded and therefore not rescued for reasons unrelated
to MLV
I domain function seems unlikely because mutants having the same
lack of myristate in the context of the RSV-Src chimera can be
rescued
with ease (
37).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 5.
Membrane localization is required for the rescue of
molecules containing the MLV I domain. (A) To assess the involvement of
I domains in complementation rescue, budding-defective RSV-MLV chimeras
were examined. All constructs shown here contain either two RSV I
domains or the single MLV I domain. T10C.PR and T10M.PR , which lack
an L domain, are blocked at a late step during budding, and BgM.M( ),
which lacks myristate, is not targeted to the plasma membrane. Cells
were transfected and labeled as described in the legend for Fig. 1.
Cotransfection is denoted by brackets above the lanes and the
cotransfected DNA above the bracket. (B) Unmyristylated BgM.M( )
cannot be rescued either by molecules containing RSV I domains or by
the MLV I domain. However, BgM, which is targeted to the membrane, is
copackaged with molecules containing either RSV or MLV I domains. (C)
RSV-specific (*R) and MLV-specific (*M) cleavage products are
indicated. (D) A chimera containing the MLV I domain, but no L domain
(T10M), is targeted to the membrane and rescued by either RSV or MLV
Gag.
|
|
We also considered the possibility that BgM Gag molecules can interact
only with themselves to form particles (Fig.
1B and
C) because their
chimeric CA region is misfolded in a way that
perturbs interactions
with other Gag proteins (i.e., those with
normal CA sequences). If this
were true, then the assembly- competent
chimera BgM would not be able
to interact and be copackaged with
protease-minus forms of RSV or MLV
Gag. However, if the folding
of the chimeric CA sequence was irrelevant
and these proteins
are able to interact with BgM and be copackaged into
the same
particle, then the MLV protease provided by BgM should be able
to recognize and cleave the MLV and RSV Gag proteins in
trans.
This was in fact observed as coexpression of the Gag
proteins
resulted in particles that contained BgM and its cleavage
products
as well as cleavage products specific for MLV Gag (*M; Fig.
5C,
lanes 4) or RSV (*R; Fig.
5C, lanes 5). These successful
copackaging
results suggest that there is great plasticity in
Gag-Gag interactions,
even among heterologous Gag sequences. Taken
together, the experiments
described above support the idea that the
difference in ability
of M-domain mutants of RSV and MLV to be rescued
maps to their
I domains. Further, we propose that the difference in
rescue phenotype
is because RSV Gag proteins initiate interactions in a
cytosolic
compartment while MLV Gag interactions occur first at the
plasma
membrane.
If MLV Gag molecules truly interact only at the plasma membrane, then
any MLV Gag protein with a mutant L domain, which would
be targeted to
the membrane but otherwise be budding defective,
should be capable of
being rescued into particles. Since the L
domain of MLV has not been
mapped, we decided to examine a derivative
of BgM that contains a
deletion of the RSV L domain. For this,
we made use of the RSV Gag
mutant T10C.PR

(Fig.
5A), which lacks
amino acids 122 to 336, including the entire L domain, but retains
the M and I domains
(
34). As shown in Fig.
5D (lanes 3), this
molecule is
budding incompetent but is rescuable by full-length
RSV Gag (Fig.
5D,
lanes 5). This well-characterized RSV L-domain
mutation was introduced
into BgM to create chimera T10M.PR

(lanes
4). When expressed by
itself, this recombinant, like T10C.PR

,
was unable to bud from the
cell (Fig.
5D, lanes 4). The presence
of the strong membrane-binding
sequence of Src and the high proteolytic
activity of the PR+ form (data
not shown) suggest that T10M is
targeted to the plasma membrane. When
coexpressed with an assembly-competent
molecule (M.M1.PR

), T10M.PR

was readily rescued into particles
(Fig.
5D, lanes 6), which further
indicates that it is not severely
disrupted by the T10 deletion. This
evidence supports the idea
that interactions among MLV Gag proteins
occur after the molecules
are targeted to, and concentrated on, the
plasma membrane (see
Discussion).
 |
DISCUSSION |
I domains are essential for the production of retroviral particles
of the proper density. The sequence characteristics and mechanism of
action of I domains are, however, largely unknown. The data presented
here show that a simple artificial string of basic residues is
sufficient for I domain function. In addition, we provide evidence that
I domains may play a role in the timing of initial Gag-Gag interactions
and that RSV Gag proteins may interact earlier during assembly than MLV
Gag proteins.
Mechanism of I domain function.
I domains are currently
thought to influence particle density by interacting with RNA and using
it as a scaffold to facilitate the subsequent Gag-Gag protein
interactions mediated by CA (1, 14, 16, 17). This model is
supported by in vitro assembly data from RSV (6) and HIV Gag
(6, 14) that shows formation of multimeric structures
dependent on, and proportional in length to, added RNA. Although the
genomic viral RNA is used during infection, it is not required for in
vitro Gag multimerization (6, 14) or for the production of
dense, Gag-only particles (36). Collectively, these results
suggest that the nonspecific RNA binding activity of NC is involved in
I-domain function. Further evidence that the Cys-His boxes, which are
required for the specific incorporation of viral RNA into the particle
(3), are not part of the I domain comes from studies of
point mutations within the single zinc finger of MLV (13).
The experiments reported here have extended this finding by showing
that particle density is not affected by additional NC mutations in the
context of RSV-MLV chimeras. They have also strengthened the above
model by demonstrating that a simple string of basic residues, which
should interact with RNA but should not exhibit binding specificity for
the viral nucleic acid, can substitute for NC's density-determining
properties. However, while it is clear that basic residues can replace
the RSV I domains, it may be that not just any basic array will
suffice.
Conservation of RNA-mediated assembly.
In addition to
identifying the functional component of I domains, we also sought to
determine the extent to which I domains are maintained between
distantly related retroviruses. Although spumavirus NC sequences do not
contain zinc fingers, they do contain three GR boxes which have been
implicated in nucleic acid binding (38). Since sequence
inspection is not informative for identifying I domains, we used a
gain-of-function approach to identify the presence of at least two I
domain equivalents within HFV Gag. The location of the HFV I domains is
consistent with previous reports indicating that GR box 1 is the
primary determinant of HFV NC nucleic acid binding (38). RNA
binding by GR box 2 or 3 alone is drastically reduced (38)
but, when present together, they cooperate sufficiently to provide I
domain function.
Spumaviruses have been observed to exhibit strong nuclear localization
in infected cells (
10,
15). Although our RSV-HFV
chimeras
were capable of producing dense particles, they did not
exhibit the
strong nuclear localization (data not shown) previously
seen for HFV NC
sequences (
26). We considered the possibility
that the
myristylated amino terminus of our chimeras was a dominant
plasma
membrane-targeting signal and made myristate-minus forms
of our
chimeric spumavirus constructs. Again, however, strong
nuclear
localization was not observed by either immunofluorescence
or cell
fractionation (data not shown). The difference in nuclear
localization
may be the result of using different expression systems
(vaccinia-virus-expressed [
26] versus
COS-cell-expressed chimeras)
or may be related to the fact that, during
infection, nuclear
localization is transient (
26). However,
the relevance of nuclear
localization is questionable since recent
results indicate that
nuclear targeting is not essential for HFV
infectivity (
38).
Regardless of the issue of nuclear
localization, our finding of
sequences in the NC region of HFV that can
provide the interactions
necessary to restore dense particle production
to an RSV mutant
Gag protein suggests that spumaviruses, even in the
absence of
zinc finger domains, may utilize RNA during assembly to
initiate
protein-protein contacts.
Timing of initial Gag-Gag interactions.
Although I domains
play a major role in the formation of proper Gag-Gag interactions, the
location and timing of the initial contacts remain unknown. Because
type B and D retroviruses, such as Mason-Pfizer monkey virus (M-PMV),
assemble electron-dense cores in the cytoplasm of an infected cell
(9), we know that Gag proteins from these viruses are able
to interact prior to membrane transport. However, since a single point
mutation in the matrix region of M-PMV Gag causes core assembly to take
place at the plasma membrane rather than in the cytoplasm
(23), it appears that the membrane-binding and targeting
domain, rather than the I domain, determines the cellular site of
assembly. Although the Gag proteins of C-type retroviruses, such as
RSV, do not become visible until after their localization to the plasma
membrane (4, 5), it is quite possible that they begin to
interact prior to membrane transport but in a manner not visible by
electron microscopy. In fact, complementation analyses showing rescue
of membrane-binding mutants suggest that RSV Gag proteins may interact prior to membrane localization (34, 37). In contrast to RSV, unmyristylated MLV Gag proteins, which also exhibit C-type plasma membrane assembly, are unable to be rescued in vivo (27).
This indicates either that MLV Gag proteins do not interact with each other in the cytoplasm or that any pre-membrane-localization
interactions are not of sufficient strength for rescue to occur.
Although the observations that cytoplasmic MLV and RSV Gag molecules
have different rescue phenotypes were made some time
ago, the molecular
basis of those phenotypes remains unexplained.
Our results map this
difference to the C terminus of Gag. Membrane-binding
mutants having
the RSV C terminus can be rescued (
37) while
those with MLV
C-terminal sequences cannot. Since the inability
to be rescued is a
negative result, a number of trivial explanations
could account for our
observations. As has been previously suggested
for unmyristylated MLV
(
27), the lack of rescue of our RSV-MLV
chimera could be due
to low expression levels, rapid protein degradation
and/or misfolding,
or an inability of the protein to interact
with the rescuing Gag
molecule. Low expression or rapid degradation
of BgM.M(

)
does not appear to be a problem since large amounts
(i.e., similar to
M.M1 levels) of this protein are present in
the cell lysates. Although
BgM.M(

) could be globally misfolded,
this is unlikely because loss of
myristate is not known to severely
disrupt the structure of other Gag
proteins. For example, myristate-minus
Gag proteins of M-PMV are still
able to associate into cytoplasmic
cores (
24) and studies
with myristylation inhibitors have shown
that HIV particles can form
even when only a few of the Gag proteins
are myristylated
(
19). Likewise, even RSV Gag proteins that
have become
dependent on the Src membrane-binding sequence (e.g.,
R.M1) can be
rescued when myristate is absent (
37). Furthermore,
chimeras
containing the large T10C deletion (i.e., T10M) are readily
rescued,
indicating that the BgM chimera is not overly sensitive
to mutations.
This plasticity of Gag is emphasized further by
the fact that BgM can
be packaged with either MLV or RSV Gag,
even though BgM contains a
highly distorted capsid sequence, and
this represents the first
evidence for copackaging of Gag proteins
from different retroviruses.
Experiments demonstrating that copackaging
of MLV and RSV Gag proteins
requires that each protein contain
the same membrane-binding domain
will be presented elsewhere (
2).
Thus, the simplest
interpretation of our results is that the MLV
Gag protein (but not that
of RSV) requires concentration at the
membrane in order for Gag-Gag
interactions to occur.
One of the most striking differences between the C termini of RSV and
MLV is the presence of two readily identified I domains
in the former
and one in the latter. This observation leads us
to hypothesize that
there may be a dosage effect in which two
I domains provide
interactions strong enough to allow Gag proteins
to associate in the
cytoplasm. The presence of a single I domain
would allow interactions
only after concentration at the plasma
membrane. Consistent with this
idea is data showing that the myristate-minus
form of the Gag protein
of spleen necrosis virus (SNV) cannot
be rescued into particles by
wild-type SNV Gag (
31). SNV is
closely related to MLV
(~40% identity) and also has a single Cys-His
box. The ultimate test
of our hypothesis, however, will be to
find mutants of MLV, perhaps
containing a duplicated NC region
with two I domains, that can be
rescued when myristate is removed.
 |
ACKNOWLEDGMENTS |
This research was sponsored by the National Cancer Institute,
DHHS, under contract with ABL (A.R.), by NIH grants to J.B.B. (training
grant CA60395) and J.W.W. (CA47482), and by a grant from the American
Cancer Society to J.W.W. (FRA-427).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Pennsylvania State University College of Medicine, 500 University Dr., P.O. Box 850, Hershey, PA 17033. Phone:
(717) 531-3528. Fax: (717) 531-6522. E-mail: jwills{at}psu.edu.
Present address: Invitrogen Corporation, Carlsbad, CA 92121.
Present address: Department of Molecular Biology, The Scripps
Research Institute, La Jolla, CA 92037.
 |
REFERENCES |
| 1.
|
Bennett, R. P.,
T. D. Nelle, and J. W. Wills.
1993.
Functional chimeras of the Rous sarcoma virus and human immunodeficiency virus Gag proteins.
J. Virol.
67:6487-6498[Abstract/Free Full Text].
|
| 2.
| Bennett, R. P., and J. W. Wills.
Conditions for co-packaging Rous sarcoma virus and murine leukemia
virus Gag proteins during retroviral budding. Submitted for
publication.
|
| 3.
|
Berkowitz, R.,
J. Fisher, and S. P. Goff.
1996.
RNA packaging.
Curr. Top. Microbiol. Immunol.
214:177-218[Medline].
|
| 4.
|
Bernhard, W.
1958.
Electron microscopy of tumor cells and tumor viruses: a review.
Cancer Res.
18:491-509.
|
| 5.
|
Bernhard, W.
1960.
The detection and study of tumor viruses with the electron microscope.
Cancer Res.
20:712-727.
|
| 6.
|
Campbell, S., and V. M. Vogt.
1995.
Self assembly in vitro of purified CA-NC proteins from Rous sarcoma virus and human immunodeficiency virus type 1.
J. Virol.
69:6487-6497[Abstract].
|
| 7.
|
Craven, R. C.,
R. P. Bennett, and J. W. Wills.
1991.
Role of the avian retroviral protease in the activation of reverse transcriptase during virion assembly.
J. Virol.
65:6205-6217[Abstract/Free Full Text].
|
| 8.
|
Craven, R. C.,
A. E. Leure-duPree,
R. A. Weldon, Jr., and J. W. Wills.
1995.
Genetic analysis of the major homology region of the Rous sarcoma virus Gag protein.
J. Virol.
69:4213-4227[Abstract].
|
| 9.
|
Fine, D., and G. Schochetman.
1978.
Type D primate retroviruses: a review.
Cancer Res.
38:3123-3139[Abstract/Free Full Text].
|
| 10.
|
Fleming, W. A., and J. K. Clarke.
1970.
Fluorescence assay of foamy virus.
J. Gen. Virol.
6:277-284[Abstract/Free Full Text].
|
| 11.
|
Flugel, R. M.
1991.
Spumaviruses: a group of complex retroviruses.
J. Acquired Immune Defic. Syndr.
4:739-750.
|
| 12.
|
Fu, W., and A. Rein.
1993.
Maturation of dimeric viral RNA of Moloney murine leukemia virus.
J. Virol.
67:5443-5449[Abstract/Free Full Text].
|
| 13.
|
Gorelick, R. J.,
L. E. Henderson,
J. P. Hanser, and A. Rein.
1988.
Point mutations of Moloney murine leukemia virus that fail to package viral RNA: evidence for specific RNA recognition by a "zinc finger-like" protein sequence.
Proc. Natl. Acad. Sci. USA
85:8420-8424[Abstract/Free Full Text].
|
| 14.
|
Gross, I.,
H. Hohenberg, and H.-G. Krausslich.
1997.
In vitro assembly properties of purified bacterially expressed capsid proteins of human immunodeficiency virus.
Eur. J. Biochem.
249:592-600[Medline].
|
| 15.
|
Hooks, J. J., and C. J. Gibbs.
1975.
The foamy viruses.
Bacteriol. Rev.
39:169-185[Free Full Text].
|
| 16.
|
Jowett, J. B.,
D. J. Hockley,
M. V. Nermut, and I. M. Jones.
1992.
Distinct signals in human immunodeficiency virus type 1 Pr55 necessary for RNA binding and particle formation.
J. Gen. Virol.
73:3079-3086[Abstract/Free Full Text]. (Erratum, 74:943, 1993.)
|
| 17.
|
Krishna, N. K.,
S. Campbell,
V. M. Vogt, and J. W. Wills.
1998.
Genetic determinants of Rous sarcoma virus particle size.
J. Virol.
72:564-577[Abstract/Free Full Text].
|
| 18.
|
Lochelt, M.,
H. Zentgraf, and R. M. Flugel.
1991.
Construction of an infectious DNA clone of the full-length human spumaretrovirus genome and mutagenesis of the bel 1 gene.
Virology
184:43-54[Medline].
|
| 19.
|
Morikawa, Y.,
S. Hinata,
H. Tomoda,
T. Goto,
M. Nakai,
C. Aizawa,
H. Tanaka, and S. Omura.
1995.
Complete inhibition of human immunodeficiency virus Gag myristoylation is necessary for inhibition of particle budding.
J. Biol. Chem.
271:2868-2873[Abstract/Free Full Text].
|
| 20.
|
Parent, L. J.,
R. P. Bennett,
R. C. Craven,
T. D. Nelle,
N. K. Krishna,
J. B. Bowzard,
C. B. Wilson,
B. A. Puffer,
R. C. Montelaro, and J. W. Wills.
1995.
Positionally independent and exchangeable late budding functions of the Rous sarcoma virus and human immunodeficiency virus Gag proteins.
J. Virol.
69:5455-5460[Abstract].
|
| 21.
|
Pellman, D.,
E. A. Garber,
F. R. Cross, and H. Hanafusa.
1985.
An N-terminal peptide from p60src can direct myristylation and plasma membrane localization when fused to heterologous proteins.
Nature (London)
314:374-377[Medline].
|
| 21a.
| Rein, A. Unpublished results.
|
| 22.
|
Rein, A.,
D. P. Harvin,
J. Mirro,
S. M. Ernst, and R. J. Gorelick.
1994.
Evidence that a central domain of nucleocapsid protein is required for RNA packaging in murine leukemia virus.
J. Virol.
68:6125-6129.
|
| 23.
|
Rhee, S. S., and E. Hunter.
1990.
A single amino acid substitution within the matrix protein of a type D retrovirus converts its morphogenesis to that of a type C retrovirus.
Cell
63:77-86[Medline].
|
| 24.
|
Rhee, S. S., and E. Hunter.
1987.
Myristylation is required for intracellular transport but not for assembly of D-type retrovirus capsids.
J. Virol.
61:1045-1053[Abstract/Free Full Text].
|
| 25.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 26.
|
Schliephake, A. W., and A. Rethwilm.
1994.
Nuclear localization of foamy virus Gag precursor protein.
J. Virol.
68:4946-4954[Abstract/Free Full Text].
|
| 27.
|
Schultz, A. M., and A. Rein.
1989.
Unmyristylated Moloney murine leukemia virus Pr65gag is excluded from virus assembly and maturation events.
J. Virol.
63:2370-2373[Abstract/Free Full Text].
|
| 28.
|
Schwartz, D. E.,
R. Tizard, and W. Gilbert.
1983.
Nucleotide sequence of Rous sarcoma virus.
Cell
32:853-869[Medline].
|
| 29.
|
Verderame, M. F.,
T. D. Nelle, and J. W. Wills.
1996.
The membrane-binding domain of the Rous sarcoma virus Gag protein.
J. Virol.
70:2664-2668[Abstract].
|
| 30.
|
Vogt, V. M.,
R. Eisenman, and H. Diggleman.
1975.
Generation of avian myeloblastosis virus structural proteins by proteolytic cleavage of a precursor polypeptide.
J. Mol. Biol.
96:471-493[Medline].
|
| 31.
|
Weaver, T. A., and A. T. Panganiban.
1990.
N myristoylation of the spleen necrosis virus matrix protein is required for correct association of the Gag polyprotein with intracellular membranes and for particle formation.
J. Virol.
64:3995-4001[Abstract/Free Full Text].
|
| 32.
|
Weldon, R. A., Jr.,
C. R. Erdie,
M. G. Oliver, and J. W. Wills.
1990.
Incorporation of chimeric Gag protein into retroviral particles.
J. Virol.
64:4169-4179[Abstract/Free Full Text].
|
| 33.
|
Weldon, R. A., Jr., and J. W. Wills.
1993.
Characterization of a small (25-kilodalton) derivative of the Rous sarcoma virus Gag protein competent for particle release.
J. Virol.
67:5550-5561[Abstract/Free Full Text].
|
| 34.
|
Wills, J. W.,
C. E. Cameron,
C. B. Wilson,
Y. Xiang,
R. P. Bennett, and J. Leis.
1994.
An assembly domain of the Rous sarcoma virus Gag protein required late in budding.
J. Virol.
68:6605-6618[Abstract/Free Full Text].
|
| 35.
|
Wills, J. W., and R. C. Craven.
1991.
Form, function, and use of retroviral Gag proteins.
AIDS
5:639-654[Medline].
|
| 36.
|
Wills, J. W.,
R. C. Craven, and J. A. Achacoso.
1989.
Creation and expression of myristylated forms of Rous sarcoma virus Gag protein in mammalian cells.
J. Virol.
63:4331-4343[Abstract/Free Full Text].
|
| 37.
|
Wills, J. W.,
R. C. Craven,
R. A. Weldon, Jr.,
T. D. Nelle, and C. R. Erdie.
1991.
Suppression of retroviral MA deletions by the amino-terminal membrane-binding domain of p60src.
J. Virol.
65:3804-3812[Abstract/Free Full Text].
|
| 38.
|
Yu, S. F.,
K. Edelmann,
R. K. Strong,
A. Moebes,
A. Rethwilm, and M. L. Linial.
1996.
The carboxy terminus of the human foamy virus Gag protein contains separable nucleic acid binding and nuclear transport domains.
J. Virol.
70:8255-8262[Abstract].
|
Journal of Virology, November 1998, p. 9034-9044, Vol. 72, No. 11
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Hogue, I. B., Hoppe, A., Ono, A.
(2009). Quantitative Fluorescence Resonance Energy Transfer Microscopy Analysis of the Human Immunodeficiency Virus Type 1 Gag-Gag Interaction: Relative Contributions of the CA and NC Domains and Membrane Binding. J. Virol.
83: 7322-7336
[Abstract]
[Full Text]
-
Didierlaurent, L., Houzet, L., Morichaud, Z., Darlix, J.-L., Mougel, M.
(2008). The conserved N-terminal basic residues and zinc-finger motifs of HIV-1 nucleocapsid restrict the viral cDNA synthesis during virus formation and maturation. Nucleic Acids Res
36: 4745-4753
[Abstract]
[Full Text]
-
Larsen, L. S. Z., Beliakova-Bethell, N., Bilanchone, V., Zhang, M., Lamsa, A., DaSilva, R., Hatfield, G. W., Nagashima, K., Sandmeyer, S.
(2008). Ty3 Nucleocapsid Controls Localization of Particle Assembly. J. Virol.
82: 2501-2514
[Abstract]
[Full Text]
-
Popov, S., Popova, E., Inoue, M., Gottlinger, H. G.
(2008). Human Immunodeficiency Virus Type 1 Gag Engages the Bro1 Domain of ALIX/AIP1 through the Nucleocapsid. J. Virol.
82: 1389-1398
[Abstract]
[Full Text]
-
Li, H., Dou, J., Ding, L., Spearman, P.
(2007). Myristoylation Is Required for Human Immunodeficiency Virus Type 1 Gag-Gag Multimerization in Mammalian Cells. J. Virol.
81: 12899-12910
[Abstract]
[Full Text]
-
Burnett, A., Spearman, P.
(2007). APOBEC3G Multimers Are Recruited to the Plasma Membrane for Packaging into Human Immunodeficiency Virus Type 1 Virus-Like Particles in an RNA-Dependent Process Requiring the NC Basic Linker. J. Virol.
81: 5000-5013
[Abstract]
[Full Text]
-
Mannigel, I., Stange, A., Zentgraf, H., Lindemann, D.
(2007). Correct Capsid Assembly Mediated by a Conserved YXXLGL Motif in Prototype Foamy Virus Gag Is Essential for Infectivity and Reverse Transcription of the Viral Genome. J. Virol.
81: 3317-3326
[Abstract]
[Full Text]
-
Lingappa, J. R., Dooher, J. E., Newman, M. A., Kiser, P. K., Klein, K. C.
(2006). Basic Residues in the Nucleocapsid Domain of Gag Are Required for Interaction of HIV-1 Gag with ABCE1 (HP68), a Cellular Protein Important for HIV-1 Capsid Assembly. J. Biol. Chem.
281: 3773-3784
[Abstract]
[Full Text]
-
Alfadhli, A., Dhenub, T. C., Still, A., Barklis, E.
(2005). Analysis of Human Immunodeficiency Virus Type 1 Gag Dimerization-Induced Assembly. J. Virol.
79: 14498-14506
[Abstract]
[Full Text]
-
Ono, A., Waheed, A. A., Joshi, A., Freed, E. O.
(2005). Association of Human Immunodeficiency Virus Type 1 Gag with Membrane Does Not Require Highly Basic Sequences in the Nucleocapsid: Use of a Novel Gag Multimerization Assay. J. Virol.
79: 14131-14140
[Abstract]
[Full Text]
-
Ako-Adjei, D., Johnson, M. C., Vogt, V. M.
(2005). The Retroviral Capsid Domain Dictates Virion Size, Morphology, and Coassembly of Gag into Virus-Like Particles. J. Virol.
79: 13463-13472
[Abstract]
[Full Text]
-
Mark-Danieli, M., Laham, N., Kenan-Eichler, M., Castiel, A., Melamed, D., Landau, M., Bouvier, N. M., Evans, M. J., Bacharach, E.
(2005). Single Point Mutations in the Zinc Finger Motifs of the Human Immunodeficiency Virus Type 1 Nucleocapsid Alter RNA Binding Specificities of the Gag Protein and Enhance Packaging and Infectivity. J. Virol.
79: 7756-7767
[Abstract]
[Full Text]
-
Jern, P., Sperber, G. O., Ahlsen, G., Blomberg, J.
(2005). Sequence Variability, Gene Structure, and Expression of Full-Length Human Endogenous Retrovirus H. J. Virol.
79: 6325-6337
[Abstract]
[Full Text]
-
Lux, A., Beil, C., Majety, M., Barron, S., Gallione, C. J., Kuhn, H.-M., Berg, J. N., Kioschis, P., Marchuk, D. A., Hafner, M.
(2005). Human Retroviral gag- and gag-pol-like Proteins Interact with the Transforming Growth Factor-{beta} Receptor Activin Receptor-like Kinase 1. J. Biol. Chem.
280: 8482-8493
[Abstract]
[Full Text]
-
Muriaux, D., Costes, S., Nagashima, K., Mirro, J., Cho, E., Lockett, S., Rein, A.
(2004). Role of Murine Leukemia Virus Nucleocapsid Protein in Virus Assembly. J. Virol.
78: 12378-12385
[Abstract]
[Full Text]
-
Spidel, J. L., Craven, R. C., Wilson, C. B., Patnaik, A., Wang, H., Mansky, L. M., Wills, J. W.
(2004). Lysines Close to the Rous Sarcoma Virus Late Domain Critical for Budding. J. Virol.
78: 10606-10616
[Abstract]
[Full Text]
-
Lee, E.-G., Linial, M. L.
(2004). Basic Residues of the Retroviral Nucleocapsid Play Different Roles in Gag-Gag and Gag-{Psi} RNA Interactions. J. Virol.
78: 8486-8495
[Abstract]
[Full Text]
-
Derdowski, A., Ding, L., Spearman, P.
(2004). A Novel Fluorescence Resonance Energy Transfer Assay Demonstrates that the Human Immunodeficiency Virus Type 1 Pr55Gag I Domain Mediates Gag-Gag Interactions. J. Virol.
78: 1230-1242
[Abstract]
[Full Text]
-
Wang, S.-W., Noonan, K., Aldovini, A.
(2004). Nucleocapsid-RNA Interactions Are Essential to Structural Stability but Not to Assembly of Retroviruses. J. Virol.
78: 716-723
[Abstract]
[Full Text]
-
Ma, Y. M., Vogt, V. M.
(2004). Nucleic Acid Binding-Induced Gag Dimerization in the Assembly of Rous Sarcoma Virus Particles In Vitro. J. Virol.
78: 52-60
[Abstract]
[Full Text]
-
Andrawiss, M., Takeuchi, Y., Hewlett, L., Collins, M.
(2003). Murine Leukemia Virus Particle Assembly Quantitated by Fluorescence Microscopy: Role of Gag-Gag Interactions and Membrane Association. J. Virol.
77: 11651-11660
[Abstract]
[Full Text]
-
Larson, D. R., Ma, Y. M., Vogt, V. M., Webb, W. W.
(2003). Direct measurement of Gag-Gag interaction during retrovirus assembly with FRET and fluorescence correlation spectroscopy. JCB
162: 1233-1244
[Abstract]
[Full Text]
-
Ott, D. E., Coren, L. V., Chertova, E. N., Gagliardi, T. D., Nagashima, K., Sowder, R. C. II, Poon, D. T. K., Gorelick, R. J.
(2003). Elimination of Protease Activity Restores Efficient Virion Production to a Human Immunodeficiency Virus Type 1 Nucleocapsid Deletion Mutant. J. Virol.
77: 5547-5556
[Abstract]
[Full Text]
-
Lee, E.-g., Alidina, A., May, C., Linial, M. L.
(2003). Importance of Basic Residues in Binding of Rous Sarcoma Virus Nucleocapsid to the RNA Packaging Signal. J. Virol.
77: 2010-2020
[Abstract]
[Full Text]
-
Pettit, S. C., Gulnik, S., Everitt, L., Kaplan, A. H.
(2002). The Dimer Interfaces of Protease and Extra-Protease Domains Influence the Activation of Protease and the Specificity of GagPol Cleavage. J. Virol.
77: 366-374
[Abstract]
[Full Text]
-
Fu, W., Hu, W.-S.
(2002). Functional Replacement of Nucleocapsid Flanking Regions by Heterologous Counterparts with Divergent Primary Sequences: Effects of Chimeric Nucleocapsid on the Retroviral Replication Cycle. J. Virol.
77: 754-761
[Abstract]
[Full Text]
-
Wang, S.-W., Aldovini, A.
(2002). RNA Incorporation Is Critical for Retroviral Particle Integrity after Cell Membrane Assembly of Gag Complexes. J. Virol.
76: 11853-11865
[Abstract]
[Full Text]
-
Muriaux, D., Mirro, J., Nagashima, K., Harvin, D., Rein, A.
(2002). Murine Leukemia Virus Nucleocapsid Mutant Particles Lacking Viral RNA Encapsidate Ribosomes. J. Virol.
76: 11405-11413
[Abstract]
[Full Text]
-
Ma, Y. M., Vogt, V. M.
(2002). Rous Sarcoma Virus Gag Protein-Oligonucleotide Interaction Suggests a Critical Role for Protein Dimer Formation in Assembly. J. Virol.
76: 5452-5462
[Abstract]
[Full Text]
-
Khorchid, A., Halwani, R., Wainberg, M. A., Kleiman, L.
(2002). Role of RNA in Facilitating Gag/Gag-Pol Interaction. J. Virol.
76: 4131-4137
[Abstract]
[Full Text]
-
Scheifele, L. Z., Garbitt, R. A., Rhoads, J. D., Parent, L. J.
(2002). Nuclear entry and CRM1-dependent nuclear export of the Rous sarcoma virus Gag polyprotein. Proc. Natl. Acad. Sci. USA
99: 3944-3949
[Abstract]
[Full Text]
-
Nakayashiki, H., Matsuo, H., Chuma, I., Ikeda, K., Betsuyaku, S., Kusaba, M., Tosa, Y., Mayama, S.
(2001). Pyret, a Ty3/Gypsy retrotransposon in Magnaporthe grisea contains an extra domain between the nucleocapsid and protease domains. Nucleic Acids Res
29: 4106-4113
[Abstract]
[Full Text]
-
Shigemoto, K., Brennan, J., Walls, E., Watson, C. J., Stott, D., Rigby, P. W. J., Reith, A. D.
(2001). Identification and characterisation of a developmentally regulated mammalian gene that utilises -1 programmed ribosomal frameshifting. Nucleic Acids Res
29: 4079-4088
[Abstract]
[Full Text]
-
Eastman, S. W., Linial, M. L.
(2001). Identification of a Conserved Residue of Foamy Virus Gag Required for Intracellular Capsid Assembly. J. Virol.
75: 6857-6864
[Abstract]
[Full Text]
-
Krishna, N. K., Wills, J. W.
(2001). Insertion of Capsid Proteins from Nonenveloped Viruses into the Retroviral Budding Pathway. J. Virol.
75: 6527-6536
[Abstract]
[Full Text]
-
Tobaly-Tapiero, J., Bittoun, P., Giron, M.-L., Neves, M., Koken, M., Saïb, A., de Thé, H.
(2001). Human Foamy Virus Capsid Formation Requires an Interaction Domain in the N Terminus of Gag. J. Virol.
75: 4367-4375
[Abstract]
[Full Text]
-
Muriaux, D., Mirro, J., Harvin, D., Rein, A.
(2001). RNA is a structural element in retrovirus particles. Proc. Natl. Acad. Sci. USA
98: 5246-5251
[Abstract]
[Full Text]
-
Gonsky, J., Bacharach, E., Goff, S. P.
(2001). Identification of Residues of the Moloney Murine Leukemia Virus Nucleocapsid Critical for Viral DNA Synthesis In Vivo. J. Virol.
75: 2616-2626
[Abstract]
[Full Text]
-
Yu, F., Joshi, S. M., Ma, Y. M., Kingston, R. L., Simon, M. N., Vogt, V. M.
(2001). Characterization of Rous Sarcoma Virus Gag Particles Assembled In Vitro. J. Virol.
75: 2753-2764
[Abstract]
[Full Text]
-
Yovandich, J. L., Chertova, E. N., Kane, B. P., Gagliardi, T. D., Bess, J. W. Jr., Sowder, R. C. II, Henderson, L. E., Gorelick, R. J.
(2001). Alteration of Zinc-Binding Residues of Simian Immunodeficiency Virus p8NC Results in Subtle Differences in Gag Processing and Virion Maturation Associated with Degradative Loss of Mutant NC. J. Virol.
75: 115-124
[Abstract]
[Full Text]
-
Bowzard, J. B., Visalli, R. J., Wilson, C. B., Loomis, J. S., Callahan, E. M., Courtney, R. J., Wills, J. W.
(2000). Membrane Targeting Properties of a Herpesvirus Tegument Protein-Retrovirus Gag Chimera. J. Virol.
74: 8692-8699
[Abstract]
[Full Text]
-
Sandefur, S., Smith, R. M., Varthakavi, V., Spearman, P.
(2000). Mapping and Characterization of the N-Terminal I Domain of Human Immunodeficiency Virus Type 1 Pr55Gag. J. Virol.
74: 7238-7249
[Abstract]
[Full Text]
-
Cimarelli, A., Luban, J.
(2000). Human Immunodeficiency Virus Type 1 Virion Density Is Not Determined by Nucleocapsid Basic Residues. J. Virol.
74: 6734-6740
[Abstract]
[Full Text]
-
Ono, A., Demirov, D., Freed, E. O.
(2000). Relationship between Human Immunodeficiency Virus Type 1 Gag Multimerization and Membrane Binding. J. Virol.
74: 5142-5150
[Abstract]
[Full Text]
-
Cimarelli, A., Sandin, S., Höglund, S., Luban, J.
(2000). Basic Residues in Human Immunodeficiency Virus Type 1 Nucleocapsid Promote Virion Assembly via Interaction with RNA. J. Virol.
74: 3046-3057
[Abstract]
[Full Text]
-
Buchschacher, G. L. Jr., Yu, L., Murai, F., Friedmann, T., Miyanohara, A.
(1999). Association of Murine Leukemia Virus Pol with Virions, Independent of Gag-Pol Expression. J. Virol.
73: 9632-9637
[Abstract]
[Full Text]
-
Lee, E.-g., Yeo, A., Kraemer, B., Wickens, M., Linial, M. L.
(1999). The Gag Domains Required for Avian Retroviral RNA Encapsidation Determined by Using Two Independent Assays. J. Virol.
73: 6282-6292
[Abstract]
[Full Text]
-
Lee, Y.-M., Liu, B., Yu, X.-F.
(1999). Formation of Virus Assembly Intermediate Complexes in the Cytoplasm by Wild-Type and Assembly-Defective Mutant Human Immunodeficiency Virus Type 1 and Their Association with Membranes. J. Virol.
73: 5654-5662
[Abstract]
[Full Text]
-
Dettenhofer, M., Yu, X.-F.
(1999). Proline Residues in Human Immunodeficiency Virus Type 1 p6Gag Exert a Cell Type-Dependent Effect on Viral Replication and Virion Incorporation of Pol Proteins. J. Virol.
73: 4696-4704
[Abstract]
[Full Text]
-
Cen, S., Huang, Y., Khorchid, A., Darlix, J.-L., Wainberg, M. A., Kleiman, L.
(1999). The Role of Pr55gag in the Annealing of tRNA3Lys to Human Immunodeficiency Virus Type 1 Genomic RNA. J. Virol.
73: 4485-4488
[Abstract]
[Full Text]
-
Liu, B., Dai, R., Tian, C.-J., Dawson, L., Gorelick, R., Yu, X.-F.
(1999). Interaction of the Human Immunodeficiency Virus Type 1 Nucleocapsid with Actin. J. Virol.
73: 2901-2908
[Abstract]
[Full Text]
-
Bennett, R. P., Wills, J. W.
(1999). Conditions for Copackaging Rous Sarcoma Virus and Murine Leukemia Virus Gag Proteins during Retroviral Budding. J. Virol.
73: 2045-2051
[Abstract]
[Full Text]