Previous Article | Next Article 
Journal of Virology, November 1998, p. 8782-8788, Vol. 72, No. 11
Department of Life Science, Pohang University
of Science and Technology, Hyoja-Dong, Pohang, Kyungbuk 790-784, Korea
Received 22 May 1998/Accepted 11 August 1998
Translation initiation of hepatitis C virus (HCV) RNA occurs by
internal entry of a ribosome into the 5' nontranslated region in a
cap-independent manner. The HCV RNA sequence from about nucleotide 40 up to the N terminus of the coding sequence of the core protein is
required for efficient internal initiation of translation, though the
precise border of the HCV internal ribosomal entry site (IRES) has yet
to be determined. Several cellular proteins have been proposed to
direct HCV IRES-dependent translation by binding to the HCV IRES. Here
we report on a novel cellular protein that specifically interacts with
the 3' border of the HCV IRES in the core-coding sequence. This protein
with an apparent molecular mass of 68 kDa turned out to be
heterogeneous nuclear ribonucleoprotein L (hnRNP L). The binding of
hnRNP L to the HCV IRES correlates with the translational efficiencies
of corresponding mRNAs. This finding suggests that hnRNP L may play an
important role in the translation of HCV mRNA through the IRES element.
Internal ribosome binding to mRNAs
without 5'-end scanning of the mRNA, which occurs in most cellular
mRNAs (18), was first discovered for picornavirus mRNAs
(13, 25). Internal ribosome binding requires a
cis-acting element on the mRNA termed the internal ribosomal entry site (IRES) (14) and cellular factors that
interact specifically with the IRES. Several cellular proteins that
direct IRES-dependent translation have been identified (10, 15,
17, 20). Besides picornaviruses, some members of the virus family Flaviviridae also contain IRESs. Hepatitis C
virus (HCV) (32, 34), bovine viral diarrhea virus
(27), and classical swine fever virus (29) belong
to this group.
HCV RNA contains a long 5' nontranslated region (5'NTR) (341 nucleotides [nt] long in most strains) harboring three to five noninitiating AUG triplets (9, 16). The 5'NTR and part of the core protein-coding region of HCV mRNA contain an IRES element. In
other words, HCV RNA stretching from about nt 40 (7, 34) to
the N-terminal coding sequence of the core (11, 12, 19, 28)
is required for efficient initiation of translation, but the precise
borders of this HCV IRES have as yet to be mapped. A complex secondary
structure has been proposed for the HCV IRES (4).
cis-acting structural elements, such as a helical structure and a pseudoknot-like structure, were suggested to be essential for
IRES function (33, 35).
Several cellular proteins were proposed to be involved in HCV
IRES-dependent translation. Polypyrimidine tract-binding protein (PTB)
has been reported to bind to multiple sites of the HCV IRES, but the
role of PTB in translation is still not clear (1, 17). Binding of La antigen to the initiation codon of the HCV IRES was
reported to enhance HCV IRES-dependent translation (2). A
25-kDa cellular protein of unknown identity was also shown to bind
specifically to the HCV IRES, and its binding affinity was correlated
with efficiency of translation initiation (6).
Here we report on a cellular protein that specifically interacts with
the 3' border of the HCV IRES spanning part of the core-coding sequence. This protein, with an apparent molecular mass of 68 kDa,
turned out to be heterogeneous nuclear ribonucleoprotein L (hnRNP L).
Interestingly, hnRNP L has been shown to interact with PTB in a yeast
two-hybrid system and by coprecipitation (8). The binding of
hnRNP L to the HCV IRES correlated well with the translational
efficiencies of corresponding mRNAs. This result suggests that hnRNP L
may play a key role in the translation of HCV mRNA through the IRES
element.
Constructions of plasmids.
The HCV cDNA clones pCV, pKI5,
pKIDel1, and pN10 have been previously described by Tsukiyama-Kohara et
al. (32). To construct pH(280-E2') and pH(331-E2'), the
pSK(
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Heterogeneous Nuclear Ribonucleoprotein L Interacts
with the 3' Border of the Internal Ribosomal Entry Site of
Hepatitis C Virus
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
) vector was treated with KpnI plus T4 polymerase plus
PstI and the pCV vector was treated with StuI and
PstI or AccI plus Klenow fragment plus
PstI, respectively. pH(280-E2') and pH(331-E2') were treated
with AatII plus PstI and T4 polymerase to
construct plasmids pH(280-402) and pH(331-402), respectively. For the
construction of pH(18-402)CAT, PCR was performed with the following
primers: primer 1, CGGGGTACCGGCGACACTCCACCATAG; primer 2, CGCGGATCCCTGTGGGCGGCGGTTG; primer 3, CGCGGATCCACAACCATGAGCTTGGC; and primer 4, GCTCTAGATTATCACTTATTCAGGCGTAGC.
) vector, KpnI- and
BamHI-digested PCR product 1, and BamHI- and
XbaI-digested PCR product 2 were ligated to generate plasmid pH(18-402)CAT. To amplify corresponding HCV cDNAs, the following primers were used in PCR: primer 5, CGCGGATCCCATGATGCACGGTCTACG; primer 6, CGCGGATCCAGGATTTGTGCT; primer 7, CGCGGATCCGGTTTTTCTTTGAGGTTTAG; and primer 8, CGCGGTACCATGAGCACAAATCCTAAAC.
Purification of hnRNP L.
Escherichia coli BL21(DE3)
pLysS was used to produce hnRNP L from plasmid pRSET-hnRNP L. IPTG
(isopropyl-
-D-thiogalactopyranoside) was added to a
final concentration of 1 mM to the cells at an optical density at 600 nm of 0.25. After further incubating the cells expressing hnRNP L for
5 h at 25°C, the cells were harvested, resuspended in lysis
buffer (20 mM Na-phosphate [pH 7.6], 300 mM NaCl, 0.5 mM
phenylmethylsulfonyl fluoride, 1 mM -mercaptoethanol, 10% glycerol)
and sonicated. After lysis, the cell extracts were loaded onto a
Ni-nitrilotriacetic acid (NTA) agarose column (Qiagen) equilibrated
with lysis buffer. The columns were then washed with 5 volumes of lysis
buffer containing 70 mM imidazole. The hnRNP L was eluted with 200 mM
imidazole. Peak fractions were pooled and loaded onto a
poly(U)-Sepharose column. After the resin was washed with lysis buffer
containing 0.4 M NaCl, the hnRNP L was eluted with 1.5 M NaCl.
In vitro transcription and in vitro translation. Plasmid DNAs were purified by the polyethylene glycol precipitation method (31) and then linearized with appropriate restriction enzymes. Linearized DNAs were extracted with phenol-chloroform and ethanol precipitated. The RNAs were transcribed from the linearized DNAs with T7 RNA polymerase (Boehringer Mannheim) for 90 min at 37°C as recommended by the manufacturer. Radioactive RNA probes and biotinylated RNAs were synthesized under similar reaction conditions with [32P]UTP (NEN) or biotin-labeled UTP (Pharmacia Biotech Inc.).
In vitro translations were performed in 12.5-µl reaction mixtures containing 40 nM mRNA in the presence of [35S]methionine (NEN) as described by Rose et al. (30). Cytoplasmic S-10 extract of HeLa S3 cells was prepared as described by Oh et al. (23). Translation reactions were carried out at 30°C for 1 h and analyzed by sodium dodecyl sulfate (SDS)-15% polyacrylamide gel electrophoresis (PAGE). The intensities of the autoradiographic images produced by 35S were enhanced by fluorography with salicylic acid. Gels were dried and exposed to Kodak XAR-5 or Agfa Curix RP1 film for 12 to 18 h.UV cross-linking.
32P-labeled RNA probes were
synthesized by in vitro transcription and isolated by push column
chromatography (Stratagene). RNAs (2 × 106 cpm) were
incubated with 40 µg of HeLa cell cytoplasmic extract or with 0.3 µg of purified hnRNP L which had been dialyzed into the translation
buffer (16 mM HEPES [pH 7.5], 36 mM KCl, 169 mM potassium acetate,
1.2 mM magnesium acetate, 1.6 mM dithiothreitol [DTT], 2.8 mM
-mercaptoethanol). RNA-protein binding was carried out in a 30-µl
reaction mixture containing 0.5 mM DTT, 5 mM HEPES (pH 7.6), 75 mM KCl,
2 mM MgCl2, 0.1 mM EDTA, 4% glycerol, 20 U of RNasin, and
3 µg of tRNA. After 20 min of incubation at 30°C, the samples were
irradiated with UV light on ice for 30 min with a UV-Stratalinker
(Stratagene). Unbound RNAs were digested with 5 µl of RNase cocktail
(2 µl of RNase A [10 mg/ml], 2 µl of RNase T1 [100
U/ml], 1 µl of RNase V1 [700 U/ml]) at 37°C for 30 min and then analyzed by SDS-12% PAGE.
RNA affinity resin-binding assay: precipitation of proteins with biotinylated RNAs. Biotinylated RNAs (1 µg) were incubated with 35S-labeled protein translated in vitro or with HeLa cell cytoplasmic extract (40 µg) in KHN buffer (150 mM KCl, 20 mM HEPES [pH 7.5], 0.03% Nonidet P-40, 0.2 mM DTT) for 1 h at 25°C. The mixture was then transferred into 1 ml of KHN buffer containing streptavidin acrylamide beads (Pierce) and incubated at 4°C for 1 h. The beads were collected by centrifugation, washed three times with 1 ml of KHN buffer, resuspended in sample buffer, and boiled for 4 min. The supernatant containing the RNA-bound protein was analyzed by SDS-PAGE.
RNA gel mobility shift assay. 32P-labeled RNAs corresponding to HCV RNAs from nt 228 to 331 and 342 to 402 {[32P]RNA(228-331) and [32P]RNA(342-402), respectively} were used as probes in a gel mobility shift assay. The RNAs (104 cpm) were incubated with purified hnRNP L or bovine serum albumin (BSA). RNA-protein interaction was allowed at 30°C for 20 min in RNA-binding buffer (5 mM HEPES [pH 7.6], 70 mM KCl, 2 mM MgCl2, 0.1 mM EDTA, 0.5 mM DTT, 0.7 µg of tRNA). Electrophoresis sample buffer was added, and the samples were loaded onto 5% nondenaturing polyacrylamide gels (pH 8.6) (23). Gels were dried and exposed to X-ray film for autoradiography. For the experiment combining the gel mobility shift assay and immunoblot analysis, cold HCV RNA (nt 18 to 331 or 18 to 402) was incubated with HeLa cell extract (20 µg) in the same binding buffer containing tRNA (10 µg) and then resolved in a 5% nondenaturing gel. Proteins were transferred to a nitrocellulose membrane (Amersham), and immunoblot analysis was performed with monoclonal antibody against human hnRNP L.
Immunoblot analysis. After RNA-bound proteins were resolved in an SDS-12% polyacrylamide gel or a 5% native gel, the proteins were transferred to nitrocellulose membranes (Amersham). The membranes were incubated overnight at 4°C in blocking solution (20 mM Tris-HCl [pH 7.4]), 150 mM NaCl, 0.5% Tween 20, 5% skim milk) to block nonspecific binding of the antibody. The primary antibody (a monoclonal antibody against hnRNP L, 4D11) was added to the blocking solution, and incubation proceeded for 1 h. The antibody had been generously provided by G. Dreyfuss, University of Pennsylvania School of Medicine, Philadelphia. A horseradish peroxidase-linked anti-mouse immunoglobulin G was used as the secondary antibody. Membrane-bound antibodies were detected by enhanced chemiluminescence (Amersham).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Identification of cellular proteins interacting with the HCV IRES. To identify cellular factor(s) interacting with the HCV IRES, UV cross-linking was performed with HeLa cell cytoplasmic extracts as protein sources and the probes [32P]RNA(18-331) and [32P]RNA(18-402). Three proteins with apparent molecular masses of 52, 68, and 100 kDa were found to bind to the HCV probe [32P]RNA(18-402), which encompasses most of the HCV 5'NTR and N-terminal coding sequence of the core protein (Fig. 1, lane 1). On the other hand, only two proteins of 52 and 100 kDa were observed as prominent bands when [32P]RNA(18-331) was used (note that the intensity of the 68-kDa protein band was weakened dramatically upon deletion of nt 332 to 402 [Fig. 1, lane 2]). This indicates that the region of nt 332 to 402 is essential for a strong interaction of the 68-kDa protein with the HCV IRES. The 52-kDa protein may be the La protein, which has been reported to interact specifically with the HCV IRES (2). The identity of the 100-kDa protein remains unknown. We decided to further characterize the 68-kDa protein, since it binds to the region determined to be the 3' border of the HCV IRES (12, 19, 28).
|
HnRNP L binds to the HCV IRES. Recently, we have shown that hnRNP L interacts with PTB, a protein that binds to the encephalomyocarditis virus and HCV IRESs (8). We therefore investigated whether the 68-kDa protein, which interacts with the HCV IRES, is identical to hnRNP L, since PTB, which interacts with hnRNP L, was shown to bind to the HCV 5'NTR (1) and since the apparent molecular mass of hnRNP L is also 68 kDa.
RNA affinity resin-binding assays were carried out with biotinylated HCV RNAs and HeLa cell extract (Fig. 2A). After incubation of HeLa cell extract with the biotinylated RNAs, the RNA-protein complexes were precipitated with streptavidin acrylamide beads. The presence of hnRNP L in the RNA-protein complexes was determined by Western blot analysis with monoclonal anti-hnRNP L antibody (4D11) (Fig. 2A). The RNA containing the complete HCV IRES (nt 18 to 402) bound to hnRNP L much more strongly than HCV RNA lacking the core-coding sequence (nt 18 to 331) (compare lane 2 with lane 3 in Fig. 2A). This result suggests not only that hnRNP L binds to the HCV IRES but also that the RNA segment of HCV spanning nt 332 to 402 is required for the tight binding between the HCV IRES and hnRNP L. The binding pattern of cellular hnRNP L to HCV RNA was similar to that of the 68-kDa protein evident in the UV-cross-linking data (compare Fig. 2A with Fig. 1). Interestingly, at least two hnRNP L-related proteins were recognized by the hnRNP L antibody (Fig. 2A, lanes 2 and 3). This result is probably due to posttranslational modification of hnRNP L, which was suggested by Pinol-Roma et al. (26) based on two-dimensional gel electrophoresis results.
|
Determination of the hnRNP L-binding site within the HCV IRES. In order to investigate the interaction of hnRNP L with the HCV IRES in more detail, we expressed hnRNP L in E. coli and then purified it using Ni-NTA (Fig. 3, lane 4) and poly(U)-Sepharose (Fig. 3, lane 5) column chromatographies. The identity of the purified hnRNP L was confirmed by Western blot analysis with monoclonal antibody against hnRNP L (data not shown).
|
|
Strength of hnRNP L binding to HCV IRES correlates with translation efficiency of an mRNA. The effect of the core-coding sequence on HCV mRNA translation was examined by serial deletions of the core-coding sequence. The CAT-coding sequence was fused in frame with the truncated core sequence to serve as a reporter gene. Translational efficiencies of the transcripts were examined in HeLa cell extract and in RRL in which newly synthesized proteins were labeled with [35S]methionine. There are equal numbers of methionine residues in each polypeptide. The translational efficiencies of the hybrid genes gradually increased with the expansion of the core sequence both in HeLa extract with a monocistronic configuration (compare lanes 1, 2, 3, and 4 in Fig. 5A) and in RRL with a dicistronic configuration (compare lanes 1, 2, 3, and 4 in Fig. 5B). Binding affinity of hnRNP L to HCV RNA gradually increased along with the length of the core-coding sequence (compare the 68-kDa protein bands in lanes 1 to 5 in Fig. 5C). Translational efficiencies (Fig. 5A and B) and the intensities of the hnRNP L bands (Fig. 5C) of the corresponding mRNAs matched well, as seen in Fig. 5D. These data therefore indicate that hnRNP L, which binds around the 3' border of the HCV IRES, might enhance HCV mRNA translation.
|
C,
C-terminally truncated core. (B) Translation of dicistronic mRNAs in
RRL. Capped dicistronic mRNAs were translated in RRL. Translation
products were resolved by SDS-15% PAGE. Schematic diagrams of the
mRNAs are shown at the top of the panel. CAT| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Translation of HCV RNA is initiated by internal entry of the ribosome into the HCV IRES. Several cellular proteins that interact specifically with the HCV IRES RNA have been identified (1, 2, 6). PTB, which is required for picornavirus IRES function (17, 22), has been reported to bind to multiple sites on the HCV IRES (1). Ali and Siddiqui (1) observed inhibition of HCV mRNA translation after depletion of PTB and proteins associated with it using an antibody against PTB. They predicted the presence of a PTB-associated protein essential for HCV IRES function, since translation of HCV mRNA could not be restored by addition of purified PTB to the PTB-immunodepleted translation mixture (1). Here we report that hnRNP L binds specifically to the 3' border region of the HCV IRES (nt 342 to 402) and that binding correlates with the translational efficiency of HCV mRNA. Interestingly, we discovered the hnRNP L-PTB interaction using yeast two-hybrid screening (8). This finding suggests that hnRNP L may be one of the cellular factors facilitating translation of HCV mRNA, possibly in cooperation with PTB.
Core-coding sequence up to nt 33 or more was required for efficient binding of hnRNP L and translation. This result is consistent with the 3' boundary of the HCV IRES reported by Reynolds et al. (28). Expansion of the core sequence up to nt 61 increased translation and hnRNP L binding further (compare lane 3 with lane 4 in Fig. 5A and B, and lane 4 with lane 5 in Fig. 5C). These findings may indicate that the core sequence segment of nt 34 to 61 contributes at least in part, if not essentially, to the translation of HCV RNA, probably by enhancing the binding of hnRNP L. The requirement of the core-coding sequence for HCV IRES function was also demonstrated in the construction of a hybrid poliovirus containing the HCV IRES element (19). HCV IRES functioning was minimal when only 24 nt of core-coding sequence was included in the hybrid virus. On the other hand, HCV IRES function was dramatically increased when 369 nt of core-coding sequence was included. This indicates that some core-coding sequence is required for optimal IRES function.
Role of hnRNPs in the translation of mRNAs. hnRNPs are, by definition, nuclear proteins that interact with heterogeneous nuclear RNAs (hnRNAs). Several functions have been suggested for hnRNPs. They mostly relate to RNA functions such as pre-mRNA processing, mRNA translocation from the nucleus to the cytoplasm, and translation (5). The last two functions are attributed to a group of hnRNPs that shuttle between the nucleus and the cytoplasm. Several hnRNPs were reported to play roles in translation. PTB (hnRNP I) was shown to enhance IRES-dependent translation of encephalomyocarditis virus and foot-and-mouth disease virus mRNAs (17, 22). hnRNP E2, which is also known as PCBP2, was required for the efficient translation of poliovirus RNA in HeLa cells (3). On the other hand, hnRNP K and E1 inhibit translation of erythroid 15-lipoxygenase mRNA by binding to the 3'NTR of the mRNA (24). Therefore, it is not surprising to discover other hnRNPs which take part in translation.
In order to participate in HCV IRES-dependent translation, hnRNP L should be present in the cytoplasm at least to some extent. However, hnRNP L was reported to be localized mainly in the nucleus (26). Interestingly, hnRNP L was found in the cytoplasm as well as the nucleus when transcription of cellular mRNA was blocked by poliovirus infection or treatment with actinomycin D (data not shown). These findings suggest that hnRNP L may shuttle between the nucleus and the cytoplasm in a transcription-sensitive manner similar to that of some other hnRNP proteins (for example, hnRNP A1, E, and I [21]). Therefore, hnRNP L may facilitate translation of some mRNAs while it stays in the cytoplasm.How can hnRNP L facilitate translation of HCV mRNA? With the limited information of hnRNP L we have, we cannot conclusively infer the molecular mechanism of the translational activation by hnRNP L. However, we can speculate about the role of hnRNP L in translation. First, binding of hnRNP L to HCV mRNA may put the structure of the HCV mRNA into a proper conformation accessible to the translational machinery. The putative conformational change might be induced by interactions among mRNA, PTB, and hnRNP L (note that hnRNP L-PTB, PTB-PTB, PTB-RNA, and hnRNP L-RNA interactions are all possible [8]). Second, hnRNP L that is bound near the initiation codon of HCV mRNA may recruit canonical translational initiation factors or the ribosome through direct interaction. In both cases, hnRNP L might be removed from the mRNA once the translational machinery gets onto the initiation codon. Intriguingly, La protein, which has RNA helicase activity, has been shown to interact with the initiation codon of HCV mRNA and facilitate translation (2). Translational activation of HCV mRNA by La protein might happen by a cleaning up of the prebound initiation factor(s), including hnRNP L, from the mRNA in order to initiate translation after ribosome binding to the mRNA.
| |
ACKNOWLEDGMENTS |
|---|
We are indebted to G. Dreyfuss, University of Pennsylvania School of Medicine, Philadelphia, for kindly providing us with a monoclonal antibody against hnRNP L, 4D11.
This study was supported in part by grants from the G7 program, the Ministry of Science and Technology, KOESEF BSRI-97-4434, LG Chem., KOESEF, through the SRC for cell differentiation, and the POSTECH/BSRI special fund.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Life Science, Pohang University of Science and Technology, San31 Hyoja-Dong, Pohang, Kyungbuk 790-784, Korea. Phone: 82-562-279-2298. Fax: 82-562-279-2199. E-mail: sungkey{at}postech.ac.kr
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. | Ali, N., and A. Siddiqui. 1995. Interaction of polypyrimidine tract-binding protein with the 5' noncoding region of the hepatitis C virus RNA genome and its functional requirement in internal initiation of translation. J. Virol. 69:6367-6375[Abstract]. |
| 2. | Ali, N., and A. Siddiqui. 1997. The La antigen binds 5' noncoding region of the hepatitis C virus RNA in the context of the initiator AUG codon and stimulates internal ribosome entry site-mediated translation. Proc. Natl. Acad. Sci. USA 18:2249-2254. |
| 3. | Blyn, L. B., J. S. Towner, B. L. Semler, and E. Ehrenfeld. 1997. Requirement of poly(rC) binding protein 2 for translation of poliovirus RNA. J. Virol. 71:6243-6246[Abstract]. |
| 4. |
Brown, E. A.,
H. Zhang,
L. H. Ping, and S. M. Lemon.
1992.
Secondary structure of the 5' nontranslated regions of hepatitis C virus and pestivirus genomic RNAs.
Nucleic Acids Res.
20:5041-5045 |
| 5. | Dreyfuss, G., M. J. Matunis, S. Pinol-Roma, and C. G. Burd. 1993. HnRNP proteins and the biogenesis of mRNA. Annu. Rev. Biochem. 62:289-321[Medline]. |
| 6. | Fukushi, S., C. Kurihara, N. Ishiyama, F. B. Hoshino, A. Oya, and K. Katayama. 1997. The sequence element of the internal ribosome entry site and a 25-kilodalton cellular protein contribute to efficient internal initiation of translation of hepatitis C virus RNA. J. Virol. 71:1662-1666[Abstract]. |
| 7. | Fukushi, S., K. Katayama, C. Kurihara, N. Ishiyama, F. B. Hoshino, T. Ando, and A. Oya. 1994. Complete 5' noncoding region is necessary for the efficient internal initiation of hepatitis C virus RNA. Biochem. Biophys. Res. Commun. 199:425-432[Medline]. |
| 8. | Hahm, B., O. H. Cho, J.-E. Kim, Y. K. Kim, J. H. Kim, Y. L. Oh, and S. K. Jang. 1998. Polypyrimidine tract-binding protein interacts with hnRNP L. FEBS Lett. 425:401-406[Medline]. |
| 9. |
Han, J. H.,
V. Shyamala,
K. H. Richman,
M. J. Brauer,
B. Irvine,
M. S. Urdea,
P. Tekamp-Olson,
G. Kuo,
Q.-L. Choo, and M. Houghton.
1991.
Characterization of the terminal regions of hepatitis C viral RNA: identification of conserved sequences in the 5' untranslated region and poly(A) tails at 3' end.
Proc. Natl. Acad. Sci. USA
88:1711-1715 |
| 10. |
Hellen, C. U. T.,
T. V. Pestova,
M. Litterst, and E. Wimmer.
1994.
The cellular polypeptide p57 (pyrimidine tract-binding protein) binds to multiple sites in the poliovirus 5' nontranslated region.
J. Virol.
68:941-950 |
| 11. | Honda, M., E. A. Brown, and S. M. Lemon. 1996. Stability of a stem-loop involving the initiator AUG controls the efficiency of internal initiation of translation on hepatitis C virus RNA. RNA 2:955-968[Abstract]. |
| 12. | Honda, M., L. H. Ping, R. C. Rijnbrand, E. Amphlett, B. Clarke, D. Rowlands, and S. M. Lemon. 1996. Structural requirements for initiation of translation by internal ribosome entry within genome-length hepatitis C virus RNA. Virology 222:31-42[Medline]. |
| 13. |
Jang, S. K.,
H. G. Kräusslich,
M. J. H. Nicklin,
G. M. Duke,
A. C. Palmenberg, and E. Wimmer.
1988.
A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation.
J. Virol.
62:2636-2643 |
| 14. |
Jang, S. K.,
M. V. Davies,
R. J. Kaufman, and E. Wimmer.
1989.
Initiation of protein synthesis by internal entry of ribosomes into the 5' nontranslated region of encephalomyocarditis virus RNA in vivo.
J. Virol.
63:1651-1660 |
| 15. |
Jang, S. K., and E. Wimmer.
1990.
Cap-independent translation of encephalomyocarditis virus RNA: structural elements of the internal ribosomal entry site and involvement of a cellular 57-kD RNA-binding protein.
Genes Dev.
4:1560-1572 |
| 16. |
Kato, N.,
M. Hijikata,
Y. Ootsuyama,
M. Nakagawa,
S. Ohkoshi,
T. Suguyama, and K. Shimotohno.
1990.
Molecular cloning of the human hepatitis C virus genome from Japanese patients with non-A non-B hepatitis.
Proc. Natl. Acad. Sci. USA
87:9524-9528 |
| 17. | Kaminski, A., S. L. Hunt, J. G. Patton, and R. J. Jackson. 1995. Direct evidence that polypyrimidine tract binding protein is essential for internal initiation of translation of encephalomyocarditis virus RNA. RNA 1:924-938[Abstract]. |
| 18. |
Kozak, M.
1989.
The scanning model for translation: an update.
J. Cell Biol.
108:229-241 |
| 19. |
Lu, H.-H., and E. Wimmer.
1996.
Poliovirus chimeras replicating under the translational control of genetic elements of hepatitis C virus reveal unusual properties of the internal ribosomal entry site of hepatitis C virus.
Proc. Natl. Acad. Sci. USA
93:1412-1417 |
| 20. |
Meerovitch, K.,
Y. V. Svitkin,
H. S. Lee,
F. Lejbkowicz,
D. J. Kenan,
E. K. L. Chan,
V. I. Agol,
J. D. Keene, and N. Sonenberg.
1993.
La autoantigen enhances and corrects aberrant translation of poliovirus RNA in reticulocyte lysate.
J. Virol.
67:3798-3807 |
| 21. | Michael, W. M., H. Siomi, M. Choi, S. Pinol-Roma, S. Nakielny, Q. Liu, and G. Dreyfuss. 1995. Cold Spring Harbor Symp. Quant. Biol. 60:663-668. |
| 22. | Niepmann, M. 1996. Porcine polypyrimidine tract-binding protein stimulates translation initiation at the internal ribosome entry site of foot-and-mouth-disease virus. FEBS Lett. 388:39-42[Medline]. |
| 23. | Oh, Y. L., B. Hahm, Y. K. Kim, H. K. Lee, J. W. Lee, O.-K. Song, K. Tsukiyama-Kohara, M. Kohara, A. Nomoto, and S. K. Jang. 1998. Determination of functional domains in polypyrimidine tract-binding protein. Biochem. J. 331:169-175. |
| 24. | Ostareck, D. H., A. Ostareck-Lederer, M. Wilm, B. J. Thiele, M. Mann, and M. W. Hentze. 1997. mRNA silencing in erythroid differentiation: hnRNP K and hnRNP E1 regulate 15-lipoxygenase translation from the 3' end. Cell 16:597-606. |
| 25. | Pelletier, J., and N. Sonenberg. 1988. Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature 334:320-325[Medline]. |
| 26. |
Pinol-Roma, S.,
M. S. Swanson,
J. G. Gall, and G. Dreyfuss.
1989.
A novel heterogeneous nuclear RNP protein with a unique distribution on nascent transcripts.
J. Cell Biol.
109:2575-2587 |
| 27. | Poole, T. L., C. Wang, R. A. Popp, L. N. Potgieter, A. Siddiqui, and M. S. Collett. 1995. Pestivirus translation initiation occurs by internal ribosome entry. Virology 206:750-754[Medline]. |
| 28. | Reynolds, J. E., A. Kaminski, H. J. Kettinen, K. Grace, B. E. Clarke, A. R. Carroll, D. J. Rowlands, and R. J. Jackson. 1995. Unique features of internal initiation of hepatitis C virus RNA translation. EMBO J. 14:6010-6020[Medline]. |
| 29. | Rijnbrand, R., T. van der Straaten, P. A. van Rijn, W. J. Spaan, and P. J. Bredenbeek. 1997. Internal entry of ribosomes is directed by the 5' noncoding region of classical swine fever virus and is dependent on the presence of an RNA pseudoknot upstream of the initiation codon. J. Virol. 71:451-457[Abstract]. |
| 30. |
Rose, J. K.,
H. Trachsel,
K. Leong, and D. Baltimore.
1978.
Inhibition of translation by poliovirus: inactivation of a specific initiation factor.
Proc. Natl. Acad. Sci. USA
75:2732-2736 |
| 31. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 32. |
Tsukiyama-Kohara, K.,
N. Lizuka,
M. Kohara, and A. Nomoto.
1992.
Internal ribosome entry site within hepatitis C virus RNA.
J. Virol.
66:1476-1483 |
| 33. | Wang, C., S. Y. Le, N. Ali, and A. Siddiqui. 1995. An RNA pseudoknot is an essential structural element of the internal ribosome entry site located within the hepatitis C virus 5' noncoding region. RNA 1:526-537[Abstract]. |
| 34. |
Wang, C.,
P. Sarnow, and A. Siddiqui.
1993.
Translation of human hepatitis C virus RNA in cultured cells is mediated by an internal ribosome-binding mechanism.
J. Virol.
67:3338-3344 |
| 35. |
Wang, C.,
P. Sarnow, and A. Siddiqui.
1994.
A conserved helical element is essential for internal initiation of translation of hepatitis C virus RNA.
J. Virol.
68:7301-7307 |
Journal of Virology, November 1998, p. 8782-8788, Vol. 72, No. 11
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Fox, J. T., Stover, P. J.
(2009). Mechanism of the Internal Ribosome Entry Site-mediated Translation of Serine Hydroxymethyltransferase 1. J. Biol. Chem.
284: 31085-31096
[Abstract] [Full Text] -
Takeshita, M., Ishida, Y.-i., Akamatsu, E., Ohmori, Y., Sudoh, M., Uto, H., Tsubouchi, H., Kataoka, H.
(2009). Proanthocyanidin from Blueberry Leaves Suppresses Expression of Subgenomic Hepatitis C Virus RNA. J. Biol. Chem.
284: 21165-21176
[Abstract] [Full Text] -
Majumder, M., Yaman, I., Gaccioli, F., Zeenko, V. V., Wang, C., Caprara, M. G., Venema, R. C., Komar, A. A., Snider, M. D., Hatzoglou, M.
(2009). The hnRNA-Binding Proteins hnRNP L and PTB Are Required for Efficient Translation of the Cat-1 Arginine/Lysine Transporter mRNA during Amino Acid Starvation. Mol. Cell. Biol.
29: 2899-2912
[Abstract] [Full Text] -
Rossbach, O., Hung, L.-H., Schreiner, S., Grishina, I., Heiner, M., Hui, J., Bindereif, A.
(2009). Auto- and Cross-Regulation of the hnRNP L Proteins by Alternative Splicing. Mol. Cell. Biol.
29: 1442-1451
[Abstract] [Full Text] -
Topp, J. D., Jackson, J., Melton, A. A., Lynch, K. W.
(2008). A cell-based screen for splicing regulators identifies hnRNP LL as a distinct signal-induced repressor of CD45 variable exon 4. RNA
14: 2038-2049
[Abstract] [Full Text] -
Hamilton, B. J., Wang, X.-W., Collins, J., Bloch, D., Bergeron, A., Henry, B., Terry, B. M., Zan, M., Mouland, A. J., Rigby, W. F. C.
(2008). Separate cis-trans Pathways Post-transcriptionally Regulate Murine CD154 (CD40 Ligand) Expression: A NOVEL FUNCTION FOR CA REPEATS IN THE 3'-UNTRANSLATED REGION. J. Biol. Chem.
283: 25606-25616
[Abstract] [Full Text] -
Zhang, Z., Harris, D., Pandey, V. N.
(2008). The FUSE Binding Protein Is a Cellular Factor Required for Efficient Replication of Hepatitis C Virus. J. Virol.
82: 5761-5773
[Abstract] [Full Text] -
Hung, L.-H., Heiner, M., Hui, J., Schreiner, S., Benes, V., Bindereif, A.
(2008). Diverse roles of hnRNP L in mammalian mRNA processing: A combined microarray and RNAi analysis. RNA
14: 284-296
[Abstract] [Full Text] -
Kaneko, S., Rozenblatt-Rosen, O., Meyerson, M., Manley, J. L.
(2007). The multifunctional protein p54nrb/PSF recruits the exonuclease XRN2 to facilitate pre-mRNA 3' processing and transcription termination. Genes Dev.
21: 1779-1789
[Abstract] [Full Text] -
Cheli, Y., Kunicki, T. J.
(2006). hnRNP L regulates differences in expression of mouse integrin {alpha}2beta1. Blood
107: 4391-4398
[Abstract] [Full Text] -
Quinkert, D., Bartenschlager, R., Lohmann, V.
(2005). Quantitative Analysis of the Hepatitis C Virus Replication Complex. J. Virol.
79: 13594-13605
[Abstract] [Full Text] -
Pudi, R., Ramamurthy, S. S., Das, S.
(2005). A Peptide Derived from RNA Recognition Motif 2 of Human La Protein Binds to Hepatitis C Virus Internal Ribosome Entry Site, Prevents Ribosomal Assembly, and Inhibits Internal Initiation of Translation. J. Virol.
79: 9842-9853
[Abstract] [Full Text] -
Guang, S., Felthauser, A. M., Mertz, J. E.
(2005). Binding of hnRNP L to the Pre-mRNA Processing Enhancer of the Herpes Simplex Virus Thymidine Kinase Gene Enhances both Polyadenylation and Nucleocytoplasmic Export of Intronless mRNAs. Mol. Cell. Biol.
25: 6303-6313
[Abstract] [Full Text] -
Kalliampakou, K. I., Kalamvoki, M., Mavromara, P.
(2005). Hepatitis C virus (HCV) NS5A protein downregulates HCV IRES-dependent translation. J. Gen. Virol.
86: 1015-1025
[Abstract] [Full Text] -
Brunner, J. E., Nguyen, J. H. C., Roehl, H. H., Ho, T. V., Swiderek, K. M., Semler, B. L.
(2005). Functional Interaction of Heterogeneous Nuclear Ribonucleoprotein C with Poliovirus RNA Synthesis Initiation Complexes. J. Virol.
79: 3254-3266
[Abstract] [Full Text] -
Li, D., Lott, W. B., Martyn, J., Haqshenas, G., Gowans, E. J.
(2004). Differential Effects on the Hepatitis C Virus (HCV) Internal Ribosome Entry Site by Vitamin B12 and the HCV Core Protein. J. Virol.
78: 12075-12081
[Abstract] [Full Text] -
Kim, J. H., Paek, K. Y., Ha, S. H., Cho, S., Choi, K., Kim, C. S., Ryu, S. H., Jang, S. K.
(2004). A Cellular RNA-Binding Protein Enhances Internal Ribosomal Entry Site-Dependent Translation through an Interaction Downstream of the Hepatitis C Virus Polyprotein Initiation Codon. Mol. Cell. Biol.
24: 7878-7890
[Abstract] [Full Text] -
Choi, K., Kim, J. H., Li, X., Paek, K. Y., Ha, S. H., Ryu, S. H., Wimmer, E., Jang, S. K.
(2004). Identification of cellular proteins enhancing activities of internal ribosomal entry sites by competition with oligodeoxynucleotides. Nucleic Acids Res
32: 1308-1317
[Abstract] [Full Text] -
You, S., Stump, D. D., Branch, A. D., Rice, C. M.
(2004). A cis-Acting Replication Element in the Sequence Encoding the NS5B RNA-Dependent RNA Polymerase Is Required for Hepatitis C Virus RNA Replication. J. Virol.
78: 1352-1366
[Abstract] [Full Text] -
HUI, J., REITHER, G., BINDEREIF, A.
(2003). Novel functional role of CA repeats and hnRNP L in RNA stability. RNA
9: 931-936
[Abstract] [Full Text] -
Imbert, I., Dimitrova, M., Kien, F., Kieny, M. P., Schuster, C.
(2003). Hepatitis C virus IRES efficiency is unaffected by the genomic RNA 3'NTR even in the presence of viral structural or non-structural proteins. J. Gen. Virol.
84: 1549-1557
[Abstract] [Full Text] -
KIM, Y. K., LEE, S. H., KIM, C. S., SEOL, S. K., JANG, S. K.
(2003). Long-range RNA-RNA interaction between the 5' nontranslated region and the core-coding sequences of hepatitis C virus modulates the IRES-dependent translation. RNA
9: 599-606
[Abstract] [Full Text] -
Pudi, R., Abhiman, S., Srinivasan, N., Das, S.
(2003). Hepatitis C Virus Internal Ribosome Entry Site-mediated Translation Is Stimulated by Specific Interaction of Independent Regions of Human La Autoantigen. J. Biol. Chem.
278: 12231-12240
[Abstract] [Full Text] -
Soderberg, M., Raffalli-Mathieu, F., Lang, M. A.
(2002). Inflammation Modulates the Interaction of Heterogeneous Nuclear Ribonucleoprotein (hnRNP) I/Polypyrimidine Tract Binding Protein and hnRNP L with the 3'Untranslated Region of the Murine Inducible Nitric-Oxide Synthase mRNA. Mol. Pharmacol.
62: 423-431
[Abstract] [Full Text] -
Kuninger, D. T., Izumi, T., Papaconstantinou, J., Mitra, S.
(2002). Human AP-endonuclease 1 and hnRNP-L interact with a nCaRE-like repressor element in the AP-endonuclease 1 promoter. Nucleic Acids Res
30: 823-829
[Abstract] [Full Text] -
Kim, Y. K., Back, S. H., Rho, J., Lee, S. H., Jang, S. K.
(2001). La autoantigen enhances translation of BiP mRNA. Nucleic Acids Res
29: 5009-5016
[Abstract] [Full Text] -
Odreman-Macchioli, F., Baralle, F. E., Buratti, E.
(2001). Mutational Analysis of the Different Bulge Regions of Hepatitis C Virus Domain II and Their Influence on Internal Ribosome Entry Site Translational Ability. J. Biol. Chem.
276: 41648-41655
[Abstract] [Full Text] -
Hellen, C. U.T., Sarnow, P.
(2001). Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev.
15: 1593-1612
[Full Text] -
Martínez-Salas, E., Ramos, R., Lafuente, E., López de Quinto, S.
(2001). Functional interactions in internal translation initiation directed by viral and cellular IRES elements. J. Gen. Virol.
82: 973-984
[Full Text] -
Gutiérrez-Escolano, A. L., Brito, Z. U., del Angel, R. M., Jiang, X.
(2000). Interaction of Cellular Proteins with the 5' End of Norwalk Virus Genomic RNA. J. Virol.
74: 8558-8562
[Abstract] [Full Text] -
Lerat, H., Shimizu, Y. K., Lemon, S. M.
(2000). Cell Type-Specific Enhancement of Hepatitis C Virus Internal Ribosome Entry Site-Directed Translation due to 5' Nontranslated Region Substitutions Selected during Passage of Virus in Lymphoblastoid Cells. J. Virol.
74: 7024-7031
[Abstract] [Full Text] -
Bartenschlager, R., Lohmann, V.
(2000). Replication of hepatitis C virus. J. Gen. Virol.
81: 1631-1648
[Full Text] -
Odreman-Macchioli, F. E., Tisminetzky, S. G., Zotti, M., Baralle, F. E., Buratti, E.
(2000). Influence of correct secondary and tertiary RNA folding on the binding of cellular factors to the HCV IRES. Nucleic Acids Res
28: 875-885
[Abstract] [Full Text] -
Loflin, P., Chen, C.-Y. A., Shyu, A.-B.
(1999). Unraveling a cytoplasmic role for hnRNP D in the in vivo mRNA destabilization directed by the AU-rich element. Genes Dev.
13: 1884-1897
[Abstract] [Full Text] -
Spangberg, K, Schwartz, S
(1999). Poly(C)-binding protein interacts with the hepatitis C virus 5' untranslated region. J. Gen. Virol.
80: 1371-1376
[Abstract] -
Anwar, A., Ali, N., Tanveer, R., Siddiqui, A.
(2000). Demonstration of Functional Requirement of Polypyrimidine Tract-binding Protein by SELEX RNA during Hepatitis C Virus Internal Ribosome Entry Site-mediated Translation Initiation. J. Biol. Chem.
275: 34231-34235
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»