Previous Article | Next Article 
Journal of Virology, November 1998, p. 8782-8788, Vol. 72, No. 11
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Heterogeneous Nuclear Ribonucleoprotein L Interacts
with the 3' Border of the Internal Ribosomal Entry Site of
Hepatitis C Virus
Bumsuk
Hahm,
Yoon Ki
Kim,
Jong Heon
Kim,
Tae Yoon
Kim, and
Sung Key
Jang*
Department of Life Science, Pohang University
of Science and Technology, Hyoja-Dong, Pohang, Kyungbuk 790-784, Korea
Received 22 May 1998/Accepted 11 August 1998
 |
ABSTRACT |
Translation initiation of hepatitis C virus (HCV) RNA occurs by
internal entry of a ribosome into the 5' nontranslated region in a
cap-independent manner. The HCV RNA sequence from about nucleotide 40 up to the N terminus of the coding sequence of the core protein is
required for efficient internal initiation of translation, though the
precise border of the HCV internal ribosomal entry site (IRES) has yet
to be determined. Several cellular proteins have been proposed to
direct HCV IRES-dependent translation by binding to the HCV IRES. Here
we report on a novel cellular protein that specifically interacts with
the 3' border of the HCV IRES in the core-coding sequence. This protein
with an apparent molecular mass of 68 kDa turned out to be
heterogeneous nuclear ribonucleoprotein L (hnRNP L). The binding of
hnRNP L to the HCV IRES correlates with the translational efficiencies
of corresponding mRNAs. This finding suggests that hnRNP L may play an
important role in the translation of HCV mRNA through the IRES element.
 |
INTRODUCTION |
Internal ribosome binding to mRNAs
without 5'-end scanning of the mRNA, which occurs in most cellular
mRNAs (18), was first discovered for picornavirus mRNAs
(13, 25). Internal ribosome binding requires a
cis-acting element on the mRNA termed the internal ribosomal entry site (IRES) (14) and cellular factors that
interact specifically with the IRES. Several cellular proteins that
direct IRES-dependent translation have been identified (10, 15,
17, 20). Besides picornaviruses, some members of the virus family Flaviviridae also contain IRESs. Hepatitis C
virus (HCV) (32, 34), bovine viral diarrhea virus
(27), and classical swine fever virus (29) belong
to this group.
HCV RNA contains a long 5' nontranslated region (5'NTR) (341 nucleotides [nt] long in most strains) harboring three to five noninitiating AUG triplets (9, 16). The 5'NTR and part of the core protein-coding region of HCV mRNA contain an IRES element. In
other words, HCV RNA stretching from about nt 40 (7, 34) to
the N-terminal coding sequence of the core (11, 12, 19, 28)
is required for efficient initiation of translation, but the precise
borders of this HCV IRES have as yet to be mapped. A complex secondary
structure has been proposed for the HCV IRES (4).
cis-acting structural elements, such as a helical structure and a pseudoknot-like structure, were suggested to be essential for
IRES function (33, 35).
Several cellular proteins were proposed to be involved in HCV
IRES-dependent translation. Polypyrimidine tract-binding protein (PTB)
has been reported to bind to multiple sites of the HCV IRES, but the
role of PTB in translation is still not clear (1, 17). Binding of La antigen to the initiation codon of the HCV IRES was
reported to enhance HCV IRES-dependent translation (2). A
25-kDa cellular protein of unknown identity was also shown to bind
specifically to the HCV IRES, and its binding affinity was correlated
with efficiency of translation initiation (6).
Here we report on a cellular protein that specifically interacts with
the 3' border of the HCV IRES spanning part of the core-coding sequence. This protein, with an apparent molecular mass of 68 kDa,
turned out to be heterogeneous nuclear ribonucleoprotein L (hnRNP L).
Interestingly, hnRNP L has been shown to interact with PTB in a yeast
two-hybrid system and by coprecipitation (8). The binding of
hnRNP L to the HCV IRES correlated well with the translational
efficiencies of corresponding mRNAs. This result suggests that hnRNP L
may play a key role in the translation of HCV mRNA through the IRES
element.
 |
MATERIALS AND METHODS |
Constructions of plasmids.
The HCV cDNA clones pCV, pKI5,
pKIDel1, and pN10 have been previously described by Tsukiyama-Kohara et
al. (32). To construct pH(280-E2') and pH(331-E2'), the
pSK(
) vector was treated with KpnI plus T4 polymerase plus
PstI and the pCV vector was treated with StuI and
PstI or AccI plus Klenow fragment plus
PstI, respectively. pH(280-E2') and pH(331-E2') were treated
with AatII plus PstI and T4 polymerase to
construct plasmids pH(280-402) and pH(331-402), respectively. For the
construction of pH(18-402)CAT, PCR was performed with the following
primers: primer 1, CGGGGTACCGGCGACACTCCACCATAG; primer 2, CGCGGATCCCTGTGGGCGGCGGTTG; primer 3, CGCGGATCCACAACCATGAGCTTGGC; and primer 4, GCTCTAGATTATCACTTATTCAGGCGTAGC.
Primers 1 and 2 and pKI5 were used to amplify nt 18 to 402 of the HCV
cDNA (PCR product 1). Primers 3 and 4 and pSK/Bip/CAT, kindly provided
by P. Sarnow, were used to amplify the chloramphenicol acetyltransferase (CAT) gene (PCR product 2). The KpnI- and
XbaI-digested pSK(
) vector, KpnI- and
BamHI-digested PCR product 1, and BamHI- and
XbaI-digested PCR product 2 were ligated to generate plasmid pH(18-402)CAT. To amplify corresponding HCV cDNAs, the following primers were used in PCR: primer 5, CGCGGATCCCATGATGCACGGTCTACG; primer 6, CGCGGATCCAGGATTTGTGCT; primer 7, CGCGGATCCGGTTTTTCTTTGAGGTTTAG; and primer 8, CGCGGTACCATGAGCACAAATCCTAAAC.
To construct plasmids pH(18-344)CAT, pH(18-356)CAT, and
pH(18-374)CAT, PCR was carried out with primers 1 and 5, primers 1
and 6, and primers 1 and 7, respectively. The PCR products were
treated
with
KpnI and
BamHI, and the vector pH(18-402)CAT
was
treated with
KpnI and
BamHI to generate
plasmids pH(18-344)CAT,
pH(18-356)CAT, and pH(18-374)CAT. To construct
pH(342-402), PCR
was carried out with primers 4 and 8, the amplified
PCR product
was treated with
KpnI and
XbaI, and
the vector pH(18-402)CAT was
treated with
KpnI and
XbaI. For the construction of dicistronic
clones containing
a CAT gene with a truncated C terminus followed
by HCV IRES and a
full-length CAT gene, a fragment of a C-terminally
truncated CAT gene
was inserted into the unique
KpnI site upstream
of each
monocistronic clone. pSK-hnRNP L and pRSET-hnRNP L were
used for
the in vitro transcription and purification of hnRNP
L, respectively
(
8).
Purification of hnRNP L.
Escherichia coli BL21(DE3)
pLysS was used to produce hnRNP L from plasmid pRSET-hnRNP L. IPTG
(isopropyl-
-D-thiogalactopyranoside) was added to a
final concentration of 1 mM to the cells at an optical density at 600 nm of 0.25. After further incubating the cells expressing hnRNP L for
5 h at 25°C, the cells were harvested, resuspended in lysis
buffer (20 mM Na-phosphate [pH 7.6], 300 mM NaCl, 0.5 mM
phenylmethylsulfonyl fluoride, 1 mM
-mercaptoethanol, 10% glycerol)
and sonicated. After lysis, the cell extracts were loaded onto a
Ni-nitrilotriacetic acid (NTA) agarose column (Qiagen) equilibrated
with lysis buffer. The columns were then washed with 5 volumes of lysis
buffer containing 70 mM imidazole. The hnRNP L was eluted with 200 mM
imidazole. Peak fractions were pooled and loaded onto a
poly(U)-Sepharose column. After the resin was washed with lysis buffer
containing 0.4 M NaCl, the hnRNP L was eluted with 1.5 M NaCl.
In vitro transcription and in vitro translation.
Plasmid
DNAs were purified by the polyethylene glycol precipitation method
(31) and then linearized with appropriate restriction enzymes. Linearized DNAs were extracted with phenol-chloroform and
ethanol precipitated. The RNAs were transcribed from the linearized DNAs with T7 RNA polymerase (Boehringer Mannheim) for 90 min at 37°C
as recommended by the manufacturer. Radioactive RNA probes and
biotinylated RNAs were synthesized under similar reaction conditions
with [32P]UTP (NEN) or biotin-labeled UTP (Pharmacia
Biotech Inc.).
In vitro translations were performed in 12.5-µl reaction mixtures
containing 40 nM mRNA in the presence of [
35S]methionine
(NEN) as described by Rose et al. (
30). Cytoplasmic
S-10
extract of HeLa S3 cells was prepared as described by Oh
et al.
(
23). Translation reactions were carried out at 30°C
for
1 h and analyzed by sodium dodecyl sulfate (SDS)-15%
polyacrylamide
gel electrophoresis (PAGE). The intensities of the
autoradiographic
images produced by
35S were enhanced by
fluorography with salicylic acid. Gels were
dried and exposed to Kodak
XAR-5 or Agfa Curix RP1 film for 12
to 18 h.
UV cross-linking.
32P-labeled RNA probes were
synthesized by in vitro transcription and isolated by push column
chromatography (Stratagene). RNAs (2 × 106 cpm) were
incubated with 40 µg of HeLa cell cytoplasmic extract or with 0.3 µg of purified hnRNP L which had been dialyzed into the translation
buffer (16 mM HEPES [pH 7.5], 36 mM KCl, 169 mM potassium acetate,
1.2 mM magnesium acetate, 1.6 mM dithiothreitol [DTT], 2.8 mM
-mercaptoethanol). RNA-protein binding was carried out in a 30-µl
reaction mixture containing 0.5 mM DTT, 5 mM HEPES (pH 7.6), 75 mM KCl,
2 mM MgCl2, 0.1 mM EDTA, 4% glycerol, 20 U of RNasin, and
3 µg of tRNA. After 20 min of incubation at 30°C, the samples were
irradiated with UV light on ice for 30 min with a UV-Stratalinker
(Stratagene). Unbound RNAs were digested with 5 µl of RNase cocktail
(2 µl of RNase A [10 mg/ml], 2 µl of RNase T1 [100
U/ml], 1 µl of RNase V1 [700 U/ml]) at 37°C for 30 min and then analyzed by SDS-12% PAGE.
RNA affinity resin-binding assay: precipitation of proteins with
biotinylated RNAs.
Biotinylated RNAs (1 µg) were incubated with
35S-labeled protein translated in vitro or with HeLa cell
cytoplasmic extract (40 µg) in KHN buffer (150 mM KCl, 20 mM HEPES
[pH 7.5], 0.03% Nonidet P-40, 0.2 mM DTT) for 1 h at 25°C.
The mixture was then transferred into 1 ml of KHN buffer containing
streptavidin acrylamide beads (Pierce) and incubated at 4°C for
1 h. The beads were collected by centrifugation, washed three
times with 1 ml of KHN buffer, resuspended in sample buffer, and boiled
for 4 min. The supernatant containing the RNA-bound protein was
analyzed by SDS-PAGE.
RNA gel mobility shift assay.
32P-labeled RNAs
corresponding to HCV RNAs from nt 228 to 331 and 342 to 402 {[32P]RNA(228-331) and
[32P]RNA(342-402), respectively} were used as
probes in a gel mobility shift assay. The RNAs (104 cpm)
were incubated with purified hnRNP L or bovine serum albumin (BSA).
RNA-protein interaction was allowed at 30°C for 20 min in RNA-binding
buffer (5 mM HEPES [pH 7.6], 70 mM KCl, 2 mM MgCl2, 0.1 mM EDTA, 0.5 mM DTT, 0.7 µg of tRNA). Electrophoresis sample buffer
was added, and the samples were loaded onto 5% nondenaturing polyacrylamide gels (pH 8.6) (23). Gels were dried and
exposed to X-ray film for autoradiography. For the experiment combining the gel mobility shift assay and immunoblot analysis, cold HCV RNA (nt
18 to 331 or 18 to 402) was incubated with HeLa cell extract (20 µg)
in the same binding buffer containing tRNA (10 µg) and then resolved
in a 5% nondenaturing gel. Proteins were transferred to a
nitrocellulose membrane (Amersham), and immunoblot analysis was
performed with monoclonal antibody against human hnRNP L.
Immunoblot analysis.
After RNA-bound proteins were resolved
in an SDS-12% polyacrylamide gel or a 5% native gel, the proteins
were transferred to nitrocellulose membranes (Amersham). The membranes
were incubated overnight at 4°C in blocking solution (20 mM Tris-HCl
[pH 7.4]), 150 mM NaCl, 0.5% Tween 20, 5% skim milk) to block
nonspecific binding of the antibody. The primary antibody (a monoclonal
antibody against hnRNP L, 4D11) was added to the blocking solution, and incubation proceeded for 1 h. The antibody had been generously provided by G. Dreyfuss, University of Pennsylvania School of Medicine,
Philadelphia. A horseradish peroxidase-linked anti-mouse immunoglobulin
G was used as the secondary antibody. Membrane-bound antibodies were
detected by enhanced chemiluminescence (Amersham).
 |
RESULTS |
Identification of cellular proteins interacting with the HCV
IRES.
To identify cellular factor(s) interacting with the HCV
IRES, UV cross-linking was performed with HeLa cell cytoplasmic
extracts as protein sources and the probes
[32P]RNA(18-331) and
[32P]RNA(18-402). Three proteins with apparent
molecular masses of 52, 68, and 100 kDa were found to bind to the
HCV probe [32P]RNA(18-402), which encompasses
most of the HCV 5'NTR and N-terminal coding sequence of the core
protein (Fig. 1, lane 1). On the other hand, only two proteins of 52 and 100 kDa were observed as prominent bands when [32P]RNA(18-331) was used (note that the
intensity of the 68-kDa protein band was weakened dramatically upon
deletion of nt 332 to 402 [Fig. 1, lane 2]). This indicates
that the region of nt 332 to 402 is essential for a strong interaction
of the 68-kDa protein with the HCV IRES. The 52-kDa protein may be the
La protein, which has been reported to interact specifically with
the HCV IRES (2). The identity of the 100-kDa protein
remains unknown. We decided to further characterize the 68-kDa protein,
since it binds to the region determined to be the 3' border of the HCV IRES (12, 19, 28).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 1.
Diagram of probes and detection of cellular proteins
interacting with HCV IRES. RNA probes
[32P]RNA(18-402) (lane 1) and
[32P]RNA(18-331) (lane 2) were cross-linked to HeLa
cell cytoplasmic extracts, after which the proteins were analyzed by
SDS-12% PAGE. Molecular masses (in thousands) are noted to the right
of the gel.
|
|
HnRNP L binds to the HCV IRES.
Recently, we have shown that
hnRNP L interacts with PTB, a protein that binds to the
encephalomyocarditis virus and HCV IRESs (8). We therefore
investigated whether the 68-kDa protein, which interacts with the HCV
IRES, is identical to hnRNP L, since PTB, which interacts with hnRNP L,
was shown to bind to the HCV 5'NTR (1) and since the
apparent molecular mass of hnRNP L is also 68 kDa.
RNA affinity resin-binding assays were carried out with biotinylated
HCV RNAs and HeLa cell extract (Fig.
2A).
After incubation
of HeLa cell extract with the biotinylated RNAs, the
RNA-protein
complexes were precipitated with streptavidin acrylamide
beads.
The presence of hnRNP L in the RNA-protein complexes was
determined
by Western blot analysis with monoclonal anti-hnRNP L
antibody
(4D11) (Fig.
2A). The RNA containing the complete HCV IRES (nt
18 to 402) bound to hnRNP L much more strongly than HCV RNA lacking
the
core-coding sequence (nt 18 to 331) (compare lane 2 with lane
3 in Fig.
2A). This result suggests not only that hnRNP L binds
to the HCV IRES
but also that the RNA segment of HCV spanning
nt 332 to 402 is required
for the tight binding between the HCV
IRES and hnRNP L. The
binding pattern of cellular hnRNP L to HCV
RNA was similar to
that of the 68-kDa protein evident in the UV-cross-linking
data (compare Fig.
2A with Fig.
1). Interestingly, at least two
hnRNP L-related proteins were recognized by the hnRNP L antibody
(Fig.
2A, lanes 2 and 3). This result is probably due to posttranslational
modification of hnRNP L, which was suggested by Pinol-Roma et
al.
(
26) based on two-dimensional gel electrophoresis results.

View larger version (31K):
[in this window]
[in a new window]

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 2.
Assignment of the 68-kDa protein band to hnRNP L. (A)
Coprecipitation and Western blot analysis. HeLa cell extract was
incubated without RNA (lane 1) or with the biotinylated HCV
RNA(18-402) (lane 2) and HCV RNA(18-331) (lane 3). The bound
proteins were then precipitated with streptavidin acrylamide beads.
After being resolved in an SDS-12% polyacrylamide gel, hnRNP L was
visualized by Western blot analysis with anti-hnRNP L monoclonal
antibody. (B) Combination of RNA mobility shift and Western blot
analyses. Aliquots of HeLa cell extract (20 µg) were incubated
without RNA (lane 1) or with 100 ng of RNA(18-331) (lane 2), 100 ng of RNA(18-402) (lane 3), 300 ng of RNA(18-331) (lane 4),
or 300 ng of RNA(18-402) (lane 5). The samples were
electrophoresed in a 5% nondenaturing gel, after which the proteins
were blotted onto a nitrocellulose membrane and probed by Western
blotting with anti-hnRNP L monoclonal antibody. Free hnRNP L and
RNA-bound hnRNP L are marked "Free" and "Bound," respectively.
(C) Coprecipitation of 35S-labeled proteins. The in
vitro-translated proteins luciferase and hnRNP L are in lanes 1 and
2, respectively. These 35S-labeled proteins were
incubated with biotinylated RNA(18-402) (lanes 3 and 4) and
RNA(18-331) (lane 5), after which the RNA-bound proteins were
precipitated with streptavidin acrylamide beads. After the samples were
washed with binding buffer, the RNA-bound proteins were resolved in an
SDS-12% polyacrylamide gel. The protein bands were detected by
autoradiography.
|
|
To further confirm the interaction between hnRNP L and HCV IRES, a
combination experiment with the RNA gel mobility shift
assay and
Western blot analysis was carried out (Fig.
2B). After
incubation of
HeLa cell extracts with RNAs corresponding to different
parts
of HCV IRES, the samples were electrophoresed on a nondenaturing
gel. The positions of hnRNP L in the gel were visualized by Western
blot analysis with monoclonal anti-hnRNP L antibody (4D11). The
free
hnRNP L was detected near the well of the gel, because the
pI of hnRNP
L is 7.4 to 7.7 (
5) and the pH of the running buffer
was
8.3. RNA-hnRNP L complexes migrated faster due to the highly
negatively
charged RNA in spite of the larger size of the RNA-protein
complex
(note that the band labeled "Bound" migrated faster than
the band
labeled "Free" in lane 5 of Fig.
2B). HCV RNA(18-402),
which contains the full length of IRES, formed a much larger
amount
of RNA-protein complex with hnRNP L than HCV RNA(18-331),
which
lacks the core-coding sequence (compare lane 4 with lane 5 in
Fig.
2B). This indicates that hnRNP L in HeLa cells can bind to
the HCV
IRES in the presence of other elements of the translational
machinery
and that the core-coding sequence of HCV plays an important
role in the
binding of hnRNP L.
The interaction between the HCV IRES and hnRNP L was also confirmed by
testing the binding between in vitro-translated hnRNP
L and the HCV
RNAs (Fig.
2C).
35S-labeled hnRNP L and luciferase were
synthesized in a rabbit
reticulocyte lysate (RRL) system as shown in
Fig.
2C. These proteins
were then incubated with the biotinylated HCV
RNA(18-402) or RNA(18-331).
The RNA-protein complexes were
then precipitated with streptavidin
acrylamide beads and resolved by
SDS-PAGE.
35S-labeled hnRNP L bound strongly to
RNA(18-402) (Fig.
2C, lane
4) and weakly to RNA(18-331) (Fig.
2C, lane 5). Under the same
conditions,
35S-labeled
luciferase bound neither to RNA(18-402) (Fig.
2C, lane
3) nor to
RNA(18-331) (data not shown). This result also indicates
that hnRNP L interacts with the HCV IRES and that the core-coding
sequence is important for that hnRNP L interaction.
Determination of the hnRNP L-binding site within the HCV IRES.
In order to investigate the interaction of hnRNP L with the HCV
IRES in more detail, we expressed hnRNP L in E. coli and then purified it using Ni-NTA (Fig.
3, lane 4) and poly(U)-Sepharose (Fig. 3,
lane 5) column chromatographies. The identity of the purified hnRNP L
was confirmed by Western blot analysis with monoclonal antibody against
hnRNP L (data not shown).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 3.
Purification of hnRNP L. Purified hnRNP L was resolved
by SDS-12% PAGE and stained with Coomassie brilliant blue G-250.
Protein profiles in uninduced E. coli cells, in induced
E. coli cells, in E. coli lysate, in E. coli cells after Ni-NTA column chromatography, and in E. coli cells after poly(U) column chromatography are shown in lanes
1, 2, 3, 4, and 5, respectively.
|
|
Direct interaction between hnRNP L and the HCV IRES was investigated by
a UV cross-linking method with purified hnRNP L and
HCV RNAs
spanning different regions of the HCV IRES. Purified
hnRNP L exhibited
a much stronger RNA-binding activity with
[
32P]RNA(18-402) than with
[
32P]RNA(18-331) (compare lane 1 with lane 2 in Fig.
4A). Purified
hnRNP L also bound
to small RNA fragments containing the 3' region
of the HCV IRES
{[
32P]RNA(280-402) and
[
32P]RNA(331-402)} (Fig.
4A, lanes 3 and 4), although the intensities
of the bands were lower. This
reduction in hnRNP L binding is
likely due to the elimination
of the cooperative binding of hnRNP
L to the strong binding
site at the core-coding sequence and the
weaker binding near
the 5' border of the HCV IRES (data not shown).
Protein-protein
interaction between hnRNP L molecules, which may
support cooperative
binding, was detected in a yeast two-hybrid
system and by a
coprecipitation method (data not shown).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
Determination of the minimal hnRNP L-binding site in
the HCV IRES. (A) UV cross-linking of hnRNP to HCV RNA.
[32P]RNA(18-402) (lane 1),
[32P]RNA(18-331) (lane 2),
[32P]RNA(280-402) (lane 3), and
[32P]RNA(331-402) (lane 4) were cross-linked
to purified hnRNP L by UV irradiation. The labeled proteins were then
analyzed by SDS-12% PAGE. (B) Gel mobility shift assay. RNA gel
mobility shift assays were performed with
[32P]RNA(228-331) (lanes 1 to 5) and
[32P]RNA(342-402) (lanes 6 to 10). Samples
in lanes 2 and 7 were incubated with 1 µg of BSA. Samples in lanes 3 and 8, 4 and 9, and 5 and 10 were incubated with 0.15, 0.3, and 0.6 µg of purified hnRNP L, respectively. Samples were analyzed in a 5%
nondenaturing polyacrylamide gel. The positions of free RNA probe and
protein-bound probe are marked "Free" and "Bound,"
respectively.
|
|
To test whether the core-coding region is sufficient for the
interaction with hnRNP L, the HCV probe
[
32P]RNA(342-402) was generated and its
hnRNP L-binding ability was
investigated by the RNA gel
mobility shift assay. HnRNP L showed
high RNA-binding
activity towards [
32P]RNA(342-402), which
spans the N terminus of the core-coding
sequence (Fig.
4B, lanes 8 to
10). However, hnRNP L did not bind
to the similarly sized HCV probe
[
32P]RNA(228-331) (Fig.
4B, lanes 3 to 5).
Under the same conditions,
BSA bound to neither
[
32P]RNA(228-331) nor
[
32P]RNA(342-402) (Fig.
4B, lanes 2 and 6).
This result shows that
hnRNP L can by itself bind to the 3' boundary of
the HCV IRES
corresponding to nt 342 to 402 and that this region is the
major
hnRNP L-binding site.
Strength of hnRNP L binding to HCV IRES correlates with
translation efficiency of an mRNA.
The effect of the
core-coding sequence on HCV mRNA translation was examined by serial
deletions of the core-coding sequence. The CAT-coding sequence was
fused in frame with the truncated core sequence to serve as a reporter
gene. Translational efficiencies of the transcripts were examined in
HeLa cell extract and in RRL in which newly synthesized proteins were
labeled with [35S]methionine. There are equal numbers of
methionine residues in each polypeptide. The translational efficiencies
of the hybrid genes gradually increased with the expansion of the core
sequence both in HeLa extract with a monocistronic configuration
(compare lanes 1, 2, 3, and 4 in Fig. 5A)
and in RRL with a dicistronic configuration (compare lanes 1, 2, 3, and
4 in Fig. 5B). Binding affinity of hnRNP L to HCV RNA gradually
increased along with the length of the core-coding sequence
(compare the 68-kDa protein bands in lanes 1 to 5 in Fig. 5C).
Translational efficiencies (Fig. 5A and B) and the
intensities of the hnRNP L bands (Fig. 5C) of the corresponding
mRNAs matched well, as seen in Fig. 5D. These data therefore
indicate that hnRNP L, which binds around the 3' border of the HCV
IRES, might enhance HCV mRNA translation.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 5.
Correlation between translational efficiency and hnRNP
L-binding affinity. (A) Translation of monocistronic mRNAs in HeLa
cell extract. Uncapped mRNAs were translated in HeLa cell extracts.
Translation products were resolved by SDS-15% PAGE. Schematic
diagrams of the mRNAs are shown at the top of the panel. Core C,
C-terminally truncated core. (B) Translation of dicistronic mRNAs in
RRL. Capped dicistronic mRNAs were translated in RRL. Translation
products were resolved by SDS-15% PAGE. Schematic diagrams of the
mRNAs are shown at the top of the panel. CAT C, C-terminally
truncated CAT gene. (C) UV cross-linking of HCV RNAs.
32P-labeled RNA probes were cross-linked with HeLa cell
extracts and then analyzed by SDS-12% PAGE. Schematic diagrams of
the RNA probes are shown at the top of the panel. (D) Relative
translational efficiencies of the mRNAs and relative affinities of the
same set of RNAs for hnRNP L. The intensities of the bands
corresponding to the polypeptides shown in panels A and B and the bands
corresponding to hnRNP L in panel C were measured with a
phosphorimager. The relative translational efficiencies and relative
hnRNP L-binding affinities of the HCV RNAs were normalized by
considering the activity of HCV RNA(18-402) 100%.
|
|
 |
DISCUSSION |
Translation of HCV RNA is initiated by internal entry of the
ribosome into the HCV IRES. Several cellular proteins that interact specifically with the HCV IRES RNA have been identified (1, 2,
6). PTB, which is required for picornavirus IRES function (17, 22), has been reported to bind to multiple sites on the HCV IRES (1). Ali and Siddiqui (1) observed
inhibition of HCV mRNA translation after depletion of PTB and proteins
associated with it using an antibody against PTB. They predicted the
presence of a PTB-associated protein essential for HCV IRES function,
since translation of HCV mRNA could not be restored by addition
of purified PTB to the PTB-immunodepleted translation mixture
(1). Here we report that hnRNP L binds specifically to
the 3' border region of the HCV IRES (nt 342 to 402) and that
binding correlates with the translational efficiency of HCV mRNA.
Interestingly, we discovered the hnRNP L-PTB interaction using yeast
two-hybrid screening (8). This finding suggests that hnRNP L
may be one of the cellular factors facilitating translation of HCV
mRNA, possibly in cooperation with PTB.
Core-coding sequence up to nt 33 or more was required for efficient
binding of hnRNP L and translation. This result is consistent with
the 3' boundary of the HCV IRES reported by Reynolds et al. (28). Expansion of the core sequence up to nt 61 increased
translation and hnRNP L binding further (compare lane 3 with lane 4 in Fig. 5A and B, and lane 4 with lane 5 in Fig. 5C). These findings
may indicate that the core sequence segment of nt 34 to 61 contributes at least in part, if not essentially, to the translation of HCV RNA,
probably by enhancing the binding of hnRNP L. The requirement of
the core-coding sequence for HCV IRES function was also demonstrated in
the construction of a hybrid poliovirus containing the HCV IRES element
(19). HCV IRES functioning was minimal when only 24 nt of
core-coding sequence was included in the hybrid virus. On the other
hand, HCV IRES function was dramatically increased when 369 nt of
core-coding sequence was included. This indicates that some
core-coding sequence is required for optimal IRES function.
Role of hnRNPs in the translation of mRNAs.
hnRNPs are, by
definition, nuclear proteins that interact with heterogeneous nuclear
RNAs (hnRNAs). Several functions have been suggested for hnRNPs. They
mostly relate to RNA functions such as pre-mRNA processing, mRNA
translocation from the nucleus to the cytoplasm, and translation
(5). The last two functions are attributed to a group of
hnRNPs that shuttle between the nucleus and the cytoplasm. Several
hnRNPs were reported to play roles in translation. PTB (hnRNP I) was
shown to enhance IRES-dependent translation of encephalomyocarditis
virus and foot-and-mouth disease virus mRNAs (17, 22). hnRNP
E2, which is also known as PCBP2, was required for the efficient
translation of poliovirus RNA in HeLa cells (3). On the
other hand, hnRNP K and E1 inhibit translation of erythroid
15-lipoxygenase mRNA by binding to the 3'NTR of the mRNA
(24). Therefore, it is not surprising to discover other hnRNPs which take part in translation.
In order to participate in HCV IRES-dependent translation, hnRNP L
should be present in the cytoplasm at least to some extent.
However,
hnRNP L was reported to be localized mainly in the nucleus
(
26). Interestingly, hnRNP L was found in the cytoplasm as
well
as the nucleus when transcription of cellular mRNA was blocked
by
poliovirus infection or treatment with actinomycin D (data
not shown).
These findings suggest that hnRNP L may shuttle between
the nucleus and
the cytoplasm in a transcription-sensitive manner
similar to that of
some other hnRNP proteins (for example, hnRNP
A1, E, and I
[
21]). Therefore, hnRNP L may facilitate
translation
of some mRNAs while it stays in the cytoplasm.
How can hnRNP L facilitate translation of HCV mRNA?
With the
limited information of hnRNP L we have, we cannot conclusively infer
the molecular mechanism of the translational activation by hnRNP L. However, we can speculate about the role of hnRNP L in translation.
First, binding of hnRNP L to HCV mRNA may put the structure of the
HCV mRNA into a proper conformation accessible to the translational
machinery. The putative conformational change might be induced by
interactions among mRNA, PTB, and hnRNP L (note that hnRNP L-PTB,
PTB-PTB, PTB-RNA, and hnRNP L-RNA interactions are all possible
[8]). Second, hnRNP L that is bound near the initiation codon of HCV mRNA may recruit canonical translational initiation factors or the ribosome through direct interaction. In both
cases, hnRNP L might be removed from the mRNA once the translational
machinery gets onto the initiation codon. Intriguingly, La protein,
which has RNA helicase activity, has been shown to interact with the
initiation codon of HCV mRNA and facilitate translation (2).
Translational activation of HCV mRNA by La protein might happen by a
cleaning up of the prebound initiation factor(s), including hnRNP L,
from the mRNA in order to initiate translation after ribosome
binding to the mRNA.
 |
ACKNOWLEDGMENTS |
We are indebted to G. Dreyfuss, University of Pennsylvania School
of Medicine, Philadelphia, for kindly providing us with a monoclonal
antibody against hnRNP L, 4D11.
This study was supported in part by grants from the G7 program, the
Ministry of Science and Technology, KOESEF BSRI-97-4434, LG Chem.,
KOESEF, through the SRC for cell differentiation, and the POSTECH/BSRI
special fund.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Life Science, Pohang University of Science and Technology, San31
Hyoja-Dong, Pohang, Kyungbuk 790-784, Korea. Phone: 82-562-279-2298. Fax: 82-562-279-2199. E-mail: sungkey{at}postech.ac.kr
 |
REFERENCES |
| 1.
|
Ali, N., and A. Siddiqui.
1995.
Interaction of polypyrimidine tract-binding protein with the 5' noncoding region of the hepatitis C virus RNA genome and its functional requirement in internal initiation of translation.
J. Virol.
69:6367-6375[Abstract].
|
| 2.
|
Ali, N., and A. Siddiqui.
1997.
The La antigen binds 5' noncoding region of the hepatitis C virus RNA in the context of the initiator AUG codon and stimulates internal ribosome entry site-mediated translation.
Proc. Natl. Acad. Sci. USA
18:2249-2254.
|
| 3.
|
Blyn, L. B.,
J. S. Towner,
B. L. Semler, and E. Ehrenfeld.
1997.
Requirement of poly(rC) binding protein 2 for translation of poliovirus RNA.
J. Virol.
71:6243-6246[Abstract].
|
| 4.
|
Brown, E. A.,
H. Zhang,
L. H. Ping, and S. M. Lemon.
1992.
Secondary structure of the 5' nontranslated regions of hepatitis C virus and pestivirus genomic RNAs.
Nucleic Acids Res.
20:5041-5045[Abstract/Free Full Text].
|
| 5.
|
Dreyfuss, G.,
M. J. Matunis,
S. Pinol-Roma, and C. G. Burd.
1993.
HnRNP proteins and the biogenesis of mRNA.
Annu. Rev. Biochem.
62:289-321[Medline].
|
| 6.
|
Fukushi, S.,
C. Kurihara,
N. Ishiyama,
F. B. Hoshino,
A. Oya, and K. Katayama.
1997.
The sequence element of the internal ribosome entry site and a 25-kilodalton cellular protein contribute to efficient internal initiation of translation of hepatitis C virus RNA.
J. Virol.
71:1662-1666[Abstract].
|
| 7.
|
Fukushi, S.,
K. Katayama,
C. Kurihara,
N. Ishiyama,
F. B. Hoshino,
T. Ando, and A. Oya.
1994.
Complete 5' noncoding region is necessary for the efficient internal initiation of hepatitis C virus RNA.
Biochem. Biophys. Res. Commun.
199:425-432[Medline].
|
| 8.
|
Hahm, B.,
O. H. Cho,
J.-E. Kim,
Y. K. Kim,
J. H. Kim,
Y. L. Oh, and S. K. Jang.
1998.
Polypyrimidine tract-binding protein interacts with hnRNP L.
FEBS Lett.
425:401-406[Medline].
|
| 9.
|
Han, J. H.,
V. Shyamala,
K. H. Richman,
M. J. Brauer,
B. Irvine,
M. S. Urdea,
P. Tekamp-Olson,
G. Kuo,
Q.-L. Choo, and M. Houghton.
1991.
Characterization of the terminal regions of hepatitis C viral RNA: identification of conserved sequences in the 5' untranslated region and poly(A) tails at 3' end.
Proc. Natl. Acad. Sci. USA
88:1711-1715[Abstract/Free Full Text].
|
| 10.
|
Hellen, C. U. T.,
T. V. Pestova,
M. Litterst, and E. Wimmer.
1994.
The cellular polypeptide p57 (pyrimidine tract-binding protein) binds to multiple sites in the poliovirus 5' nontranslated region.
J. Virol.
68:941-950[Abstract/Free Full Text].
|
| 11.
|
Honda, M.,
E. A. Brown, and S. M. Lemon.
1996.
Stability of a stem-loop involving the initiator AUG controls the efficiency of internal initiation of translation on hepatitis C virus RNA.
RNA
2:955-968[Abstract].
|
| 12.
|
Honda, M.,
L. H. Ping,
R. C. Rijnbrand,
E. Amphlett,
B. Clarke,
D. Rowlands, and S. M. Lemon.
1996.
Structural requirements for initiation of translation by internal ribosome entry within genome-length hepatitis C virus RNA.
Virology
222:31-42[Medline].
|
| 13.
|
Jang, S. K.,
H. G. Kräusslich,
M. J. H. Nicklin,
G. M. Duke,
A. C. Palmenberg, and E. Wimmer.
1988.
A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation.
J. Virol.
62:2636-2643[Abstract/Free Full Text].
|
| 14.
|
Jang, S. K.,
M. V. Davies,
R. J. Kaufman, and E. Wimmer.
1989.
Initiation of protein synthesis by internal entry of ribosomes into the 5' nontranslated region of encephalomyocarditis virus RNA in vivo.
J. Virol.
63:1651-1660[Abstract/Free Full Text].
|
| 15.
|
Jang, S. K., and E. Wimmer.
1990.
Cap-independent translation of encephalomyocarditis virus RNA: structural elements of the internal ribosomal entry site and involvement of a cellular 57-kD RNA-binding protein.
Genes Dev.
4:1560-1572[Abstract/Free Full Text].
|
| 16.
|
Kato, N.,
M. Hijikata,
Y. Ootsuyama,
M. Nakagawa,
S. Ohkoshi,
T. Suguyama, and K. Shimotohno.
1990.
Molecular cloning of the human hepatitis C virus genome from Japanese patients with non-A non-B hepatitis.
Proc. Natl. Acad. Sci. USA
87:9524-9528[Abstract/Free Full Text].
|
| 17.
|
Kaminski, A.,
S. L. Hunt,
J. G. Patton, and R. J. Jackson.
1995.
Direct evidence that polypyrimidine tract binding protein is essential for internal initiation of translation of encephalomyocarditis virus RNA.
RNA
1:924-938[Abstract].
|
| 18.
|
Kozak, M.
1989.
The scanning model for translation: an update.
J. Cell Biol.
108:229-241[Abstract/Free Full Text].
|
| 19.
|
Lu, H.-H., and E. Wimmer.
1996.
Poliovirus chimeras replicating under the translational control of genetic elements of hepatitis C virus reveal unusual properties of the internal ribosomal entry site of hepatitis C virus.
Proc. Natl. Acad. Sci. USA
93:1412-1417[Abstract/Free Full Text].
|
| 20.
|
Meerovitch, K.,
Y. V. Svitkin,
H. S. Lee,
F. Lejbkowicz,
D. J. Kenan,
E. K. L. Chan,
V. I. Agol,
J. D. Keene, and N. Sonenberg.
1993.
La autoantigen enhances and corrects aberrant translation of poliovirus RNA in reticulocyte lysate.
J. Virol.
67:3798-3807[Abstract/Free Full Text].
|
| 21.
|
Michael, W. M.,
H. Siomi,
M. Choi,
S. Pinol-Roma,
S. Nakielny,
Q. Liu, and G. Dreyfuss.
1995.
Cold Spring Harbor Symp.
Quant. Biol.
60:663-668.
|
| 22.
|
Niepmann, M.
1996.
Porcine polypyrimidine tract-binding protein stimulates translation initiation at the internal ribosome entry site of foot-and-mouth-disease virus.
FEBS Lett.
388:39-42[Medline].
|
| 23.
|
Oh, Y. L.,
B. Hahm,
Y. K. Kim,
H. K. Lee,
J. W. Lee,
O.-K. Song,
K. Tsukiyama-Kohara,
M. Kohara,
A. Nomoto, and S. K. Jang.
1998.
Determination of functional domains in polypyrimidine tract-binding protein.
Biochem. J.
331:169-175.
|
| 24.
|
Ostareck, D. H.,
A. Ostareck-Lederer,
M. Wilm,
B. J. Thiele,
M. Mann, and M. W. Hentze.
1997.
mRNA silencing in erythroid differentiation: hnRNP K and hnRNP E1 regulate 15-lipoxygenase translation from the 3' end.
Cell
16:597-606.
|
| 25.
|
Pelletier, J., and N. Sonenberg.
1988.
Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA.
Nature
334:320-325[Medline].
|
| 26.
|
Pinol-Roma, S.,
M. S. Swanson,
J. G. Gall, and G. Dreyfuss.
1989.
A novel heterogeneous nuclear RNP protein with a unique distribution on nascent transcripts.
J. Cell Biol.
109:2575-2587[Abstract/Free Full Text].
|
| 27.
|
Poole, T. L.,
C. Wang,
R. A. Popp,
L. N. Potgieter,
A. Siddiqui, and M. S. Collett.
1995.
Pestivirus translation initiation occurs by internal ribosome entry.
Virology
206:750-754[Medline].
|
| 28.
|
Reynolds, J. E.,
A. Kaminski,
H. J. Kettinen,
K. Grace,
B. E. Clarke,
A. R. Carroll,
D. J. Rowlands, and R. J. Jackson.
1995.
Unique features of internal initiation of hepatitis C virus RNA translation.
EMBO J.
14:6010-6020[Medline].
|
| 29.
|
Rijnbrand, R.,
T. van der Straaten,
P. A. van Rijn,
W. J. Spaan, and P. J. Bredenbeek.
1997.
Internal entry of ribosomes is directed by the 5' noncoding region of classical swine fever virus and is dependent on the presence of an RNA pseudoknot upstream of the initiation codon.
J. Virol.
71:451-457[Abstract].
|
| 30.
|
Rose, J. K.,
H. Trachsel,
K. Leong, and D. Baltimore.
1978.
Inhibition of translation by poliovirus: inactivation of a specific initiation factor.
Proc. Natl. Acad. Sci. USA
75:2732-2736[Abstract/Free Full Text].
|
| 31.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 32.
|
Tsukiyama-Kohara, K.,
N. Lizuka,
M. Kohara, and A. Nomoto.
1992.
Internal ribosome entry site within hepatitis C virus RNA.
J. Virol.
66:1476-1483[Abstract/Free Full Text].
|
| 33.
|
Wang, C.,
S. Y. Le,
N. Ali, and A. Siddiqui.
1995.
An RNA pseudoknot is an essential structural element of the internal ribosome entry site located within the hepatitis C virus 5' noncoding region.
RNA
1:526-537[Abstract].
|
| 34.
|
Wang, C.,
P. Sarnow, and A. Siddiqui.
1993.
Translation of human hepatitis C virus RNA in cultured cells is mediated by an internal ribosome-binding mechanism.
J. Virol.
67:3338-3344[Abstract/Free Full Text].
|
| 35.
|
Wang, C.,
P. Sarnow, and A. Siddiqui.
1994.
A conserved helical element is essential for internal initiation of translation of hepatitis C virus RNA.
J. Virol.
68:7301-7307[Abstract/Free Full Text].
|
Journal of Virology, November 1998, p. 8782-8788, Vol. 72, No. 11
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Majumder, M., Yaman, I., Gaccioli, F., Zeenko, V. V., Wang, C., Caprara, M. G., Venema, R. C., Komar, A. A., Snider, M. D., Hatzoglou, M.
(2009). The hnRNA-Binding Proteins hnRNP L and PTB Are Required for Efficient Translation of the Cat-1 Arginine/Lysine Transporter mRNA during Amino Acid Starvation. Mol. Cell. Biol.
29: 2899-2912
[Abstract]
[Full Text]
-
Rossbach, O., Hung, L.-H., Schreiner, S., Grishina, I., Heiner, M., Hui, J., Bindereif, A.
(2009). Auto- and Cross-Regulation of the hnRNP L Proteins by Alternative Splicing. Mol. Cell. Biol.
29: 1442-1451
[Abstract]
[Full Text]
-
Topp, J. D., Jackson, J., Melton, A. A., Lynch, K. W.
(2008). A cell-based screen for splicing regulators identifies hnRNP LL as a distinct signal-induced repressor of CD45 variable exon 4. RNA
14: 2038-2049
[Abstract]
[Full Text]
-
Hamilton, B. J., Wang, X.-W., Collins, J., Bloch, D., Bergeron, A., Henry, B., Terry, B. M., Zan, M., Mouland, A. J., Rigby, W. F. C.
(2008). Separate cis-trans Pathways Post-transcriptionally Regulate Murine CD154 (CD40 Ligand) Expression: A NOVEL FUNCTION FOR CA REPEATS IN THE 3'-UNTRANSLATED REGION. J. Biol. Chem.
283: 25606-25616
[Abstract]
[Full Text]
-
Zhang, Z., Harris, D., Pandey, V. N.
(2008). The FUSE Binding Protein Is a Cellular Factor Required for Efficient Replication of Hepatitis C Virus. J. Virol.
82: 5761-5773
[Abstract]
[Full Text]
-
Hung, L.-H., Heiner, M., Hui, J., Schreiner, S., Benes, V., Bindereif, A.
(2008). Diverse roles of hnRNP L in mammalian mRNA processing: A combined microarray and RNAi analysis. RNA
14: 284-296
[Abstract]
[Full Text]
-
Kaneko, S., Rozenblatt-Rosen, O., Meyerson, M., Manley, J. L.
(2007). The multifunctional protein p54nrb/PSF recruits the exonuclease XRN2 to facilitate pre-mRNA 3' processing and transcription termination. Genes Dev.
21: 1779-1789
[Abstract]
[Full Text]
-
Cheli, Y., Kunicki, T. J.
(2006). hnRNP L regulates differences in expression of mouse integrin {alpha}2beta1. Blood
107: 4391-4398
[Abstract]
[Full Text]
-
Quinkert, D., Bartenschlager, R., Lohmann, V.
(2005). Quantitative Analysis of the Hepatitis C Virus Replication Complex. J. Virol.
79: 13594-13605
[Abstract]
[Full Text]
-
Pudi, R., Ramamurthy, S. S., Das, S.
(2005). A Peptide Derived from RNA Recognition Motif 2 of Human La Protein Binds to Hepatitis C Virus Internal Ribosome Entry Site, Prevents Ribosomal Assembly, and Inhibits Internal Initiation of Translation. J. Virol.
79: 9842-9853
[Abstract]
[Full Text]
-
Guang, S., Felthauser, A. M., Mertz, J. E.
(2005). Binding of hnRNP L to the Pre-mRNA Processing Enhancer of the Herpes Simplex Virus Thymidine Kinase Gene Enhances both Polyadenylation and Nucleocytoplasmic Export of Intronless mRNAs. Mol. Cell. Biol.
25: 6303-6313
[Abstract]
[Full Text]
-
Kalliampakou, K. I., Kalamvoki, M., Mavromara, P.
(2005). Hepatitis C virus (HCV) NS5A protein downregulates HCV IRES-dependent translation. J. Gen. Virol.
86: 1015-1025
[Abstract]
[Full Text]
-
Brunner, J. E., Nguyen, J. H. C., Roehl, H. H., Ho, T. V., Swiderek, K. M., Semler, B. L.
(2005). Functional Interaction of Heterogeneous Nuclear Ribonucleoprotein C with Poliovirus RNA Synthesis Initiation Complexes. J. Virol.
79: 3254-3266
[Abstract]
[Full Text]
-
Li, D., Lott, W. B., Martyn, J., Haqshenas, G., Gowans, E. J.
(2004). Differential Effects on the Hepatitis C Virus (HCV) Internal Ribosome Entry Site by Vitamin B12 and the HCV Core Protein. J. Virol.
78: 12075-12081
[Abstract]
[Full Text]
-
Kim, J. H., Paek, K. Y., Ha, S. H., Cho, S., Choi, K., Kim, C. S., Ryu, S. H., Jang, S. K.
(2004). A Cellular RNA-Binding Protein Enhances Internal Ribosomal Entry Site-Dependent Translation through an Interaction Downstream of the Hepatitis C Virus Polyprotein Initiation Codon. Mol. Cell. Biol.
24: 7878-7890
[Abstract]
[Full Text]
-
Choi, K., Kim, J. H., Li, X., Paek, K. Y., Ha, S. H., Ryu, S. H., Wimmer, E., Jang, S. K.
(2004). Identification of cellular proteins enhancing activities of internal ribosomal entry sites by competition with oligodeoxynucleotides. Nucleic Acids Res
32: 1308-1317
[Abstract]
[Full Text]
-
You, S., Stump, D. D., Branch, A. D., Rice, C. M.
(2004). A cis-Acting Replication Element in the Sequence Encoding the NS5B RNA-Dependent RNA Polymerase Is Required for Hepatitis C Virus RNA Replication. J. Virol.
78: 1352-1366
[Abstract]
[Full Text]
-
HUI, J., REITHER, G., BINDEREIF, A.
(2003). Novel functional role of CA repeats and hnRNP L in RNA stability. RNA
9: 931-936
[Abstract]
[Full Text]
-
Imbert, I., Dimitrova, M., Kien, F., Kieny, M. P., Schuster, C.
(2003). Hepatitis C virus IRES efficiency is unaffected by the genomic RNA 3'NTR even in the presence of viral structural or non-structural proteins. J. Gen. Virol.
84: 1549-1557
[Abstract]
[Full Text]
-
KIM, Y. K., LEE, S. H., KIM, C. S., SEOL, S. K., JANG, S. K.
(2003). Long-range RNA-RNA interaction between the 5' nontranslated region and the core-coding sequences of hepatitis C virus modulates the IRES-dependent translation. RNA
9: 599-606
[Abstract]
[Full Text]
-
Pudi, R., Abhiman, S., Srinivasan, N., Das, S.
(2003). Hepatitis C Virus Internal Ribosome Entry Site-mediated Translation Is Stimulated by Specific Interaction of Independent Regions of Human La Autoantigen. J. Biol. Chem.
278: 12231-12240
[Abstract]
[Full Text]
-
Soderberg, M., Raffalli-Mathieu, F., Lang, M. A.
(2002). Inflammation Modulates the Interaction of Heterogeneous Nuclear Ribonucleoprotein (hnRNP) I/Polypyrimidine Tract Binding Protein and hnRNP L with the 3'Untranslated Region of the Murine Inducible Nitric-Oxide Synthase mRNA. Mol. Pharmacol.
62: 423-431
[Abstract]
[Full Text]
-
Kuninger, D. T., Izumi, T., Papaconstantinou, J., Mitra, S.
(2002). Human AP-endonuclease 1 and hnRNP-L interact with a nCaRE-like repressor element in the AP-endonuclease 1 promoter. Nucleic Acids Res
30: 823-829
[Abstract]
[Full Text]
-
Kim, Y. K., Back, S. H., Rho, J., Lee, S. H., Jang, S. K.
(2001). La autoantigen enhances translation of BiP mRNA. Nucleic Acids Res
29: 5009-5016
[Abstract]
[Full Text]
-
Odreman-Macchioli, F., Baralle, F. E., Buratti, E.
(2001). Mutational Analysis of the Different Bulge Regions of Hepatitis C Virus Domain II and Their Influence on Internal Ribosome Entry Site Translational Ability. J. Biol. Chem.
276: 41648-41655
[Abstract]
[Full Text]
-
Hellen, C. U.T., Sarnow, P.
(2001). Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev.
15: 1593-1612
[Full Text]
-
Martínez-Salas, E., Ramos, R., Lafuente, E., López de Quinto, S.
(2001). Functional interactions in internal translation initiation directed by viral and cellular IRES elements. J. Gen. Virol.
82: 973-984
[Full Text]
-
Gutiérrez-Escolano, A. L., Brito, Z. U., del Angel, R. M., Jiang, X.
(2000). Interaction of Cellular Proteins with the 5' End of Norwalk Virus Genomic RNA. J. Virol.
74: 8558-8562
[Abstract]
[Full Text]
-
Lerat, H., Shimizu, Y. K., Lemon, S. M.
(2000). Cell Type-Specific Enhancement of Hepatitis C Virus Internal Ribosome Entry Site-Directed Translation due to 5' Nontranslated Region Substitutions Selected during Passage of Virus in Lymphoblastoid Cells. J. Virol.
74: 7024-7031
[Abstract]
[Full Text]
-
Bartenschlager, R., Lohmann, V.
(2000). Replication of hepatitis C virus. J. Gen. Virol.
81: 1631-1648
[Full Text]
-
Odreman-Macchioli, F. E., Tisminetzky, S. G., Zotti, M., Baralle, F. E., Buratti, E.
(2000). Influence of correct secondary and tertiary RNA folding on the binding of cellular factors to the HCV IRES. Nucleic Acids Res
28: 875-885
[Abstract]
[Full Text]
-
Loflin, P., Chen, C.-Y. A., Shyu, A.-B.
(1999). Unraveling a cytoplasmic role for hnRNP D in the in vivo mRNA destabilization directed by the AU-rich element. Genes Dev.
13: 1884-1897
[Abstract]
[Full Text]
-
Spangberg, K, Schwartz, S
(1999). Poly(C)-binding protein interacts with the hepatitis C virus 5' untranslated region. J. Gen. Virol.
80: 1371-1376
[Abstract]
-
Anwar, A., Ali, N., Tanveer, R., Siddiqui, A.
(2000). Demonstration of Functional Requirement of Polypyrimidine Tract-binding Protein by SELEX RNA during Hepatitis C Virus Internal Ribosome Entry Site-mediated Translation Initiation. J. Biol. Chem.
275: 34231-34235
[Abstract]
[Full Text]