Previous Article | Next Article 
Journal of Virology, November 1998, p. 8747-8755, Vol. 72, No. 11
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Effects of Mutations in the Rubella Virus E1
Glycoprotein on E1-E2 Interaction and Membrane Fusion
Activity
Decheng
Yang,
Dorothy
Hwang,
Zhiyong
Qiu, and
Shirley
Gillam*
Department of Pathology and Laboratory
Medicine, University of British Columbia, Vancouver, British
Columbia V5Z 4H4, Canada
Received 22 January 1998/Accepted 27 July 1998
 |
ABSTRACT |
Rubella virus (RV) virions contain two glycosylated membrane
proteins, E1 and E2, that exist as a heterodimer and form the viral
spike complexes on the virion surface. Formation of an E1-E2 heterodimer is required for transport of E1 out of the endoplasmic reticulum lumen to the Golgi apparatus and plasma membrane. To investigate the nature of the E1-E2 interaction, we have introduced mutations in the internal hydrophobic region (residues 81 to 109) of
E1. Substitution of serine at Cys82 (mutant C82S) or deletion of this
hydrophobic domain (mutant dt) of E1 resulted in a disruption of the E1
conformation that ultimately affected E1-E2 heterodimer formation and
cell surface expression of both E1 and E2. Substitution of either
aspartic acid at Gly93 (G93D) or glycine at Pro104 (P104G) was found to
impair neither E1-E2 heterodimer formation nor the transport of E1 and
E2 to the cell surface. Fusion of RV-infected cells is induced by a
brief treatment at a pH below 6.0. To test whether this internal
hydrophobic domain is involved in the membrane fusion activity of RV,
transformed BHK cell lines expressing either wild-type or mutant spike
proteins were exposed to an acidic pH and polykaryon formation was
measured. No fusion activity was observed in the C82S, dt, and G93D
mutants; however, the wild type and the P104G mutant exhibited
fusogenic activities, with greater than 60% and 20 to 40% of the
cells being fused, respectively, at pH 4.8. These results suggest that
it is likely that the region of E1 between amino acids 81 and 109 is
involved in the membrane fusion activity of RV and that it may be
important for the interaction of that protein with E2 to form the E1-E2
heterodimer.
 |
INTRODUCTION |
Rubella virus (RV), the etiological
agent of German measles, is a small enveloped RNA virus that belongs to
the togavirus family (31) and bears similarities to the
prototype alphaviruses in terms of its genomic organization and
strategy for viral gene expression (11). RV virions contain
two glycosylated envelope proteins (E1 [58 kDa] and E2 [42 to 47 kDa]), located on the virion surface (32), that exist as
heterodimers in the viral spike complexes (3, 49). E1, the
major target antigen of RV, contains virus-neutralizing and
hemagglutinin epitopes (6). The biological role of E2 is not
well defined, although it has been reported to possess strain-specific
epitopes and possibly a neutralizing domain (9). The RV
structural proteins are synthesized from a subgenomic RNA as a
polyprotein precursor that is cleaved to form the viral polypeptides C,
E2, and E1 (33). The coordinate and individual expression of
the C, E2, and E1 proteins shows that E2 is necessary for the cell
surface expression of E1 and that E1 is not required for exit of E2
from the endoplasmic reticulum (ER) and its passage through the Golgi
complex to the cell surface (16). However, E1 seems to
increase the rate of transport of E2 to the cell surface
(16). In the absence of E2, E1 is arrested in a post-ER,
pre-Golgi complex compartment (18) and is only transported
to the cell surface in the presence of E2 (16). Since the
association of E1 and E2 is a hydrophobic interaction (3,
16), it is likely that E2 interacts specifically with an E1
hydrophobic domain to form the E1-E2 complexes that are transport
competent.
Although RV appears to be similar to alphaviruses in terms of its
structure as well as its structural-protein expression, its replication
cycle kinetics are different. Cells infected with alphaviruses
generally reach maximum rates of virus production 4 to 8 h after
infection (22). RV, in contrast, has a latent period of more
than 12 h, and peak virus production is reached between 24 and
48 h postinfection (13). The maturation and
intracellular transport of alphavirus structural proteins have
been extensively studied (27, 47, 48, 51). Compared to
that of alphaviruses, RV glycoprotein processing occurs
relatively slowly and the transport of glycoproteins E2 and
E1 to the plasma membrane is inefficient (16). Like Semliki
Forest virus (SFV), RV infects cells via endocytosis and an
acid-triggered fusion step (1, 3, 26, 45). The
reported acid-induced conformational changes in RV E1 and E2 and
the removal of E2 by proteolytic digestion of RV particles, resulting
in E1 particles that can still bind to liposomes (23),
suggest that RV E1 plays a dominant role in membrane fusion in the
acidic endosomal compartment, similar to that of SFV E1 (24, 25,
30), and may contain a noncleavable fusion peptide in the
internal region of E1.
Inspection of the amino acid sequence of RV E1 revealed that there is
an internal hydrophobic domain within E1, 29 amino acids long and 82 residues from the E1 NH2 (Fig.
1). We speculated that this internal
hydrophobic domain is involved in E1-E2 interaction as well as in cell
fusion. We initiated experiments to determine the role of this E1
hydrophobic region in the E1-E2 interaction and fusogenic activity of
BHK cells expressing RV antigens. In vitro mutagenesis was used to
introduce four mutations into the hydrophobic region of E1. BHK cells
were transfected with recombinant plasmids, and stable transformed BHK
cell lines expressing wild-type or mutant spike proteins were isolated
via methotrexate selection (38). Here we present evidence
that the internal hydrophobic domain of RV E1 plays a major role in
E1-E2 interaction and membrane fusion of RV.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic diagram of RV cDNAs and the hydrophobic domain
of the RV E1 glycoprotein. Respective portions of the C, E2, and E1
genes are indicated above the constructs. Intergene borders are marked
by vertical lines extending through the cDNAs. The translation start
site of the capsid protein is utilized in all constructs. Signal
peptides are indicated by open boxes, and the transmembrane regions are
shown as closed boxes. The hydrophobic domain of E1 is depicted as an
open box 81 amino acid residues from the N terminus of E1. Restriction
endonuclease sites are abbreviated as follows: E, EcoRI; H,
HindIII; B, BamHI; and N, NcoI.
The bar represents approximately 500 nucleotides. Beneath the arrows
are the single-amino-acid changes and the deletion (dt) mutation. 24S,
the cDNA containing all three structural protein genes of RV; E2E1, the
cDNA containing the E1 and E2 genes.
|
|
 |
MATERIALS AND METHODS |
Plasmid construction and mutagenesis.
RV cDNAs encoding the
polyprotein precursor for all three structural proteins (24S)
(7) and the E2E1 polyprotein precursor (E2E1)
(16) are shown in Fig. 1. The cDNAs were subcloned into the
SmaI site of the transfer vector pNUT (34) under
the control of the metallothionein 1 promoter. The construction of
plasmids pNUT-24S and pNUT-E2E1 has been previously described
(38). Plasmid pNUT-E2 was constructed by insertion of a
blunted EcoRI-HindIII fragment from plasmid
pCMV5-E2 (15) into the SmaI site of the pNUT
vector.
Mutations (substitution of serine at Cys82 of E1 [C82S] and deletion
of the hydrophobic domain [residues 81 to 109] of E1
[dt]) were
introduced by oligonucleotide-directed mutagenesis
on a
uracil-containing single-stranded DNA template (
28).
M13mp18-3'E2E1
was constructed by insertion of the
EcoRI-
HindIII fragment from
p3'E2E1
(
14) into M13mp18 vector which had been digested with
the
EcoRI and
HindIII restriction enzymes.
Mutagenic oligonucleotides
were pCAGAAGGT
CGACGCGCGCT
(mutated bases are underlined) and
pGTGGTACTGCTTCTAGCGCTGTGTGCCATT,
respectively, for the C82S
and dt mutants. To create an E2E1 cDNA
containing an introduced
mutation in E1, the
NcoI fragment from
pCMV5-E2
(
15), encoding the N-terminal 202 amino acid residues
of E2
and a portion of C (8 and 54 amino acid residues at the
N and C termini
of the C protein, respectively) (Fig.
1), was
inserted into the
NcoI site of the mutant plasmid. The resulting
cDNA was
subcloned into the
SmaI site of the pNUT vector. The
identities of the recombinant plasmids were confirmed by DNA sequencing
and restriction analysis.
Generation of mutations at residues Gly93 and Pro104 was carried out
with a Quik Change site-directed mutagenesis kit (Stratagene)
with
mutagenic oligonucleotides
pGCCTACTCCTCTG
ACGGGTACGCGCAG-3'
and
pCTGCGCGTACCCGTCAGAGGAGTAGG-3' for the Gly93-to-aspartic
acid
substitution (G93D) and
pCCTCTTACTTCAAC
GGTGGCGGCAGCTAC and
pGTAGCTGCCGCCA
CCGTTGAAGTAAGAGG
for
alteration of Pro104 to glycine (P104G) (mutated bases are
underlined).
The cDNA used in the mutagenesis was pSPT19 E2E1
(
39), and
the cycling reactions consisted of 16 cycles of 95°C
for 30 s,
55°C for 1 min, and 68°C for 14 min. The resulting E2E1
cDNA
containing the introduced mutation was subcloned into the
SmaI site of the pNUT vector. The identity of the introduced
mutation
was confirmed by DNA sequencing.
Generation of stable transformed BHK cell lines.
BHKtk
cells (46) grown in Dulbecco modified
Eagle medium (DMEM) with 5% fetal bovine serum were transfected with
recombinant plasmids by the calcium phosphate method (12).
After 24 h, the medium was changed to DMEM containing 500 µM
methotrexate. The presence of dihydrofolate reductase cDNA driven by
the simian virus 40 early promoter in the pNUT vector (34)
permits the selection of transfected BHK cells in the presence of high
concentration of methotrexate (38). After 10 days in the
selection medium, methotrexate-resistant colonies were picked and
screened for the expression of RV structural proteins by Western blot
analysis (44). The resultant cell lines were named
BHK-E2E1(wt), BHK-E2E1(C82S), BHK-E2E1(dt),
BHK-E2E1(G93D), and BHK-E2E1(P104G).
Metabolic labelling, biotinylation, immunoprecipitation, and
endoglycosidase digestion.
Transformed BHK cells, grown as
monolayers (in 35-mm-diameter petri dishes) in growth medium (DMEM
containing 2.5% fetal bovine serum), were induced with zinc sulfate
(40 µM) for 16 h. Induced BHK cells were labelled with 100 µCi
of [35S]methionine for 30 min and chased with 1 mM
unlabelled methionine for various time periods. Cell surface
biotinylation was carried out as described by Duffus et al.
(10). Briefly, labelled cells were placed on ice, washed
twice with phosphate-buffered saline (PBS), and incubated with 0.5 ml
of sulfosuccinimidobiotin (0.5 mg/ml in PBS) for 15 min on ice.
The biotinylation reaction was repeated once with fresh
reagent. The reaction was stopped by washing with cold 10 mM
glycine containing 10 mM Tris-HCl (pH 7.4) and 150 mM NaCl. The cells
were lysed with lysis buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 2 mM EDTA, and 1% Triton X-100), and spike proteins were
immunoprecipitated with human anti-RV serum. The biotinylated spike
proteins were recovered from streptavidin-agarose and analyzed by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
(29). Immunoprecipitation of cellular spike proteins was
performed as described by Wahlberg et al. (47). Briefly, at
the end of the pulse or chase period, the monolayers were washed twice
with PBS and lysed with buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 2 mM EDTA, 1% Nonidet P-40 (NP-40), and 74 µM
antipain dihydrochloride (Boehringer Mannheim). RV antiserum-coated protein A-Sepharose was washed with lysis buffer and incubated with
35S-labelled cellular lysate overnight at 4°C. The beads
were washed twice with washing buffer containing 10 mM Tris-HCl (pH
7.4), 150 mM NaCl, 2 mM EDTA, and 0.2% NP-40 and once with 10 mM
Tris-HCl (pH 7.4). RV antigen was eluted into 100 mM sodium citrate (pH 5.5) containing 0.15% SDS and 1 mM phenylmethylsulfonyl fluoride at
100°C for 4 min and analyzed by SDS-PAGE (29). Some
immunoprecipitates were digested with endoglycosidase H (5 mU/50 µl)
as described previously (16).
Fusion assay.
BHK cells expressing either wild-type or
mutant RV spike proteins were cultured in six-well plates.
After ZnSO4 induction for 16 h, the cells were washed
once with fusion medium (DMEM without bicarbonate, containing 0.2%
bovine serum albumin, 10 mM HEPES, and 10 mM morpholinoethanesulfonic
acid; pH 7.0) and then incubated for 20 min at 37°C with fusion
medium adjusted to a pH of 4.0 to 7.0 as required. After exposure to
the desired pH, the fusion medium was replaced with growth medium of pH
7.0 and the cells were incubated for an additional 4 h at 37°C
to allow both maximal RV spike protein expression in the newly fused cells and morphological reorganization of the cell nuclei.
Polykaryons containing more than five nuclei were counted under a
phase-contrast microscope. Fusion activity was presented as
the percentage of fused cells, which is the ratio of the mean total
number of polykaryons counted in five random fields to the mean total
number of unfused cells and polykaryons.
Localization of spike protein by immunofluorescence.
Transformed BHK cells were seeded onto poly-L-lysine-coated
coverslips. After ZnSO4 induction, the cells were washed
three times with PBS containing 0.7 mM CaCl2 and 0.3 mM
MgCl2, fixed for 20 min at room temperature in 2%
formaldehyde-PBS, and then washed with PBS. Some cells were
permeabilized with 0.075% NP-40-PBS for 30 min prior to being blocked
with bovine serum albumin (1% in PBS) for localization of
intracellular RV antigen (16). The cells were then treated
with mouse monoclonal antibodies against E1 (1:50) or E2 (1:50)
followed by incubation with fluorescein- or rhodamine-conjugated
secondary antibodies (Kirkegaard and Perry Laboratories).
Sucrose velocity gradients.
Samples (500 µl) were layered
onto 11.5-ml linear gradients of 5 to 20% sucrose in 50 mM Tris-HCl
(pH 7.5)-150 mM NaCl-2 mM EDTA-0.1% NP-40 and centrifuged for
30 h at 40,000 rpm in a Beckman SW41 rotor. Fractions (0.5 ml)
were collected from the bottom of the tube.
 |
RESULTS |
Expression of mutant proteins.
To determine whether the
internal hydrophobic region (residues 81 to 109) is involved in E1-E2
interaction and cell-cell fusion, four mutants (C82S, dt, G93D, and
P104G) were constructed by oligonucleotide-directed mutagenesis.
Since the antigenic structure of E1 is dependent on N-linked
glycosylation and intramolecular disulfide bonding (37), the
Cys82 residue in the hydrophobic region was selected as a target for
studying E1-E2 interaction. The substitution of aspartic acid at
Gly93 was based on the assumption that if the E1 internal hydrophobic
region interacts directly with the host cell membrane as a prerequisite
of or during the fusion event, the introduction of a charged residue
may inhibit the ability of E1 to induce membrane fusion. The internal
fusion domains have been postulated to contain helix-breaking
residues near their centers (50); therefore, proline
104 was changed to glycine.
Because the processing of RV glycoprotein occurs relatively slowly and
transport of E1 and E2 to the plasma membrane is inefficient
in
transfected COS cells (
16), stably transformed BHK cell
lines
expressing mutant proteins were isolated by transfection of BHK
cells with recombinant plasmids as described in Materials and
Methods.
Metabolic labelling and immunoprecipitation were used
to evaluate
the expressed spike proteins. Transformed BHK cells
were incubated with
growth medium containing 40 µM zinc sulfate
for 16 h to induce
the expression of RV structural proteins from
the metallothionein
promoter (
34). Induced transformed BHK cells
were labelled
with [
35S]methionine for 30 min and then chased with 1 mM
unlabelled methionine
for 2 h. Labelled intracellular RV proteins
were immunoprecipitated
with human anti-RV serum and treated with
endo-

-
N-acetylglycosaminidase
H (endo-H) to monitor the
processing of N-linked sugars (
43).
In the cell lysates of
the wild type and three of the mutants
(C82S, G93D, and P104G) were
found protein species corresponding
to E1 (57 kDa) and E2 (39 kDa)
while the intracellular E1 dt (54
kDa) and E2 (39 kDa) of the dt
mutants were immunoprecipitated
(Fig.
2A). Deletion of 29 amino acids of E1
resulted in the loss
of approximately 3 kDa of mass from E1. No
RV-specific proteins
of the size of E1 and E2 were detected in
control BHK cells (Fig.
2A). Digestion with endo-H reduced the sizes of
E1, E1 dt, and
E2 to 51, 48, and 32 kDa, respectively (Fig.
2A),
indicating the
presence of immature high-mannose N-linked sugars on
these proteins
within the compartments of the ER and the medial
Golgi apparatus.
The levels of E1 and E2 proteins expressed by both the
C82S and
dt mutants were greatly reduced compared to those of the wild
type and the G93D and P104G mutants (Fig.
2A).

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of mutant proteins. Induced BHK cells were
labelled with [35S]methionine for 30 min and chased with
1 mM unlabelled methionine for 2 h. Intracellular RV antigens were
isolated by immunoprecipitation with human anti-RV serum (A) or with
anti-E1 monoclonal antibody (B), followed by SDS-PAGE and fluorography.
Portions of the immunoprecipitates were (+) or were not ( ) digested
with endo-H. The positions of apparent molecular mass markers are shown
at the right (in kilodaltons). BHK, BHK cells; Wt, BHK-E2E1(wt);
Cys, BHK-E2E1(C82S); dt, BHK-E2E1(dt); Gly, BHK-E2E1(G93D);
Pro, BHK-E2E1)(P104G); Human, human anti-RV serum; Mab-E1, monoclonal
antibody against RV E1.
|
|
It is interesting that in the C82S and dt mutants the ratio of the
amount of E1 immunoprecipitated to that of immunoprecipitated
E2 was
smaller than the E1/E2 ratios in the wild type and the
G93D and P104G
mutants (Fig.
2A). To investigate whether the introduced
mutations in
the C82S and dt mutants affect the E1 structure recognized
by
antibodies, we performed immunoprecipitation in nonionic detergent,
using a conformation-sensitive anti-E1 monoclonal antibody
(
6).
As expected, E1 was immunoprecipitated only from the
lysates of
the wild type and the G93D and P104G mutants, not from those
of
the C82S and dt mutants (Fig.
2B), indicating that the antigenic
structure in C82S and dt mutants has been altered by the mutation
introduced in E1.
To determine whether mutant proteins reached the plasma membrane, cell
surface expression of mutant proteins was determined
by indirect
immunofluorescence with RV anti-E1 and anti-E2 monoclonal
antibodies. Transformed BHK cells were seeded onto
poly-
L-lysine-coated
coverslips, induced with
ZnSO
4, and processed for detection of
the presence of cell
surface RV antigen in live unpermeabilized
cells (
16).
We observed that the wild type and the G93D and
P104G mutants
displayed strong cell surface staining, as evidenced
by the binding of
the anti-E1 and anti-E2 monoclonal antibodies
(Fig.
3). No cell surface staining was observed
in the C82S and
dt mutants (Fig.
3), indicating that E2 and E1
from these mutants
did not reach the cell surface. The permeabilized
cells of the
wild type and the G93D and P104G mutants exhibited strong
fluorescence
in a juxtanuclear region likely corresponding to the Golgi
apparatus
(Fig.
3). In contrast, RV antigen in the C82S and dt mutants
was
found mostly in a reticular distribution not corresponding to
the
Golgi region (Fig.
3), indicating that RV antigen in the C82S
and dt
mutants accumulated in the ER. These results indicate that
the
processing and intracellular transport of E1 and E2 in the
C82S and dt
mutants were greatly affected by the mutation introduced
in E1.

View larger version (81K):
[in this window]
[in a new window]
|
FIG. 3.
Localization of RV spike proteins by immunofluorescence.
Induced BHK cells were fixed with 2% formaldehyde-PBS, incubated with
monoclonal antibodies against E1 (1:50) or E2 (1:50), and then
incubated with fluorescein isothiocyanate-conjugated anti-mouse
immunoglobulin G. Wt, BHK-E2E1; Gly, BHK-E2E1 (G93D); Pro,
BHK-E2E1(P104G); Cys, BHK-E2E1(C82S); dt, BHK-E2E1(dt).
Magnifications, ×400.
|
|
To quantitate the cell surface E1 and E2 in the G93D and P104G mutants,
induced BHK cells were labelled with [
35S]methionine
for 30 min and chased with excess unlabelled methionine
for 2 or 8 h. The cells were derivatized with sulfosuccinimidobiotin
and then
lysed (
10). RV spike proteins were precipitated with
human
anti-RV serum and separated into surface and internal proteins
by
streptavidin binding. In the absence of a chase, no cell surface
antigen was detected in the wild type or the mutants (data not
shown).
After a 2-h chase, only a small fraction (10%) of the
total RV antigen
was detected at the cell surfaces of the wild
type and both mutants
(data not shown). After an 8-h chase, about
40% of the RV antigen
reached the cell surface (Fig.
4) and the
proportion of E1 and E2 in G93D mutant that was derivatized with
biotin
was less than that of the wild type (Fig.
4B). This appeared
to be due
to the release of E1 and E2 into the medium during the
chase period,
possibly due to proteolytic degradation (Fig.
4B).
Quantitation of the
protein bands by scintillation counting indicated
that the amounts of
E1 and E2 expressed at the cell surfaces of
the G93D and P104G mutants
were 45 and 82%, respectively, of that
of the wild type (100%). The
majority of the cell surface E2 existed
as an endo-H-resistant 43-kDa
form that contained both N- and
O-linked sugars (
36,
40).
The cell surface E1 of the wild
type and both mutants was partially
endo-H resistant (Fig.
4B),
whereas greater proportions of the internal
spike protein E1 and
E2 were endo-H sensitive (Fig.
4A).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 4.
Cell surface expression of wild-type and mutant
proteins. Induced BHK cells were labelled with
[35S]methionine for 30 min and chased with 1 mM
unlabelled methionine for 2 or 8 h. Cell surface RV antigens were
derivatized with sulfosuccinimidobiotin and isolated as described in
Materials and Methods. The virus spike proteins were precipitated and
separated into internal (A) and surface (B) proteins by streptavidin
binding. Portions of the immunoprecipitates were (+) or were not ( )
digested with endo-H. The positions of apparent molecular mass markers
are shown at the right (in kilodaltons). Internal, intracellular
antigens; surface, cell surface antigens; medium, RV antigens released
into the culture medium; Wt, W, BHK-E2E1; Gly, G, BHK-E2E1(G93D);
Pro, P, BHK-E2E1(P104G).
|
|
We have shown previously that E1 secreted from insect cells was
partially resistant to endo-H digestion (
42) whereas E1
secreted from CHO cells was endo-H resistant (
20). There are
three N-linked glycosylation sites in RV E1 (
17). It is
likely
that one or more of the three high-mannose N-linked
oligosaccharide
chains on E1 were processed to a mature form in
the medial Golgi
apparatus before reaching the cell surface and
that N glycosylation,
but not processing of N-linked oligosaccharide,
is required for
cell surface expression of E1 in BHK cells.
Taken together, our results indicate that substitution of
serine at Cys82 or deletion of the hydrophobic domain of E1 completely
impaired the transport of E1 and E2 to the plasma membrane. In
contrast, the mutations introduced in the G93D and P104G mutants
did
not affect the cell surface expression of E1 and E2, although
the
expression level was lower than that of the wild type.
Glycan processing and intracellular stability of mutant
proteins.
To study the processing and stability of the C82S and dt
mutant proteins, pulse-chase experiments were carried out. In the wild
type, after 30 min of pulse-labelling, E2 was found predominantly as a
39-kDa form, and removal of high-mannose glycans by digestion with
endo-H reduced the molecular size to 31 kDa (Fig. 5, top panel). Approximately 20, 40, and 60% of
E2 was further processed to complex-type glycans (16)
(indicated by asterisks in Fig. 5, top panel). In contrast, E2 from the
mutants was not processed to complex-type glycans and was not detected
after the 8-h chase period (Fig. 5, middle and bottom panels). It is
likely that the unassociated E2 in the C82S and dt mutants was either
degraded in the ER or transported to the cell surface by itself.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 5.
Time course of glycan processing of wild-type and mutant
proteins. Induced transformed BHK cells were pulse-labelled with
[35S]methionine for 30 min and chased for various periods
of time as indicated. Some immunoprecipitates were digested with endo-H
for 8 h (+); others were not ( ). E1 and E2 arrowheads indicate
the E1 and E2 protein species in the absence or presence of endo-H
treatment. The processing of E2 is indicated by the asterisks. The
positions of molecular size markers are shown on the left (in
kilodaltons). WT, BHK-E2E1; CYS, BHK-E2E1(C82S); DT,
BHK-E2E1(dt).
|
|
Following a 30-min pulse-labelling, an RV-specific protein the size of
E1 (57 kDa in the wild type and the C82S mutant; 54
kDa in the dt
mutant) was detected in both the wild type and the
mutants. Digestion
with endo-H reduced the size of E1 to 53 and
51 kDa, indicating the
presence of high-mannose sugars on the
protein (Fig.
5). The presence
of the 53-kDa endo-H digestion
product just above the 51-kDa E1
indicates that a fraction of
E1 acquired complex sugar moieties.
Heterogeneous processing of
E1 glycans was observed after
increasing the length of the chase
period (Fig.
5). In the wild type,
after an 8-h chase, about 40%
of the E1 was partially endo-H resistant
(Fig.
5, top panel).
The processing of E1 by the mutants was similar to
that by the
wild type, although the level of expression was only
about 10
to 20% of the wild-type level (Fig.
5, middle and bottom
panels).
In the dt mutant, a fraction of 54-kDa E1 was still present
after
endo-H digestion (Fig.
5, bottom panel). It is possible that in
the absence of the hydrophobic peptide, E1 in the dt mutant became
misfolded and the misfolded E1 was more resistant to endo-H digestion.
Effect of mutation on E1 conformation.
RV E1 and E2 are rich
in cysteine residues and contain intramolecular disulfide bridges that
are important in maintenance of the proper protein folding
(49). RV E1 and E2 show increased mobility in SDS-PAGE gels
if disulfide bond reduction is omitted (49). This difference
in mobility is probably due to the presence of intrachain disulfide
bonds in E1 and E2. To determine whether a mutation would affect the
conformation of E1, Western blot analysis was used to detect the
binding of E1 to human anti-RV serum and monoclonal antibodies
against E1 or E2 under reducing and nonreducing conditions. Under
reducing conditions, the binding of antibodies to the wild-type E1 and
their binding to mutant E1 proteins were similar (Fig.
6). In contrast, under nonreducing
conditions, E1 proteins from the wild type and the G93D and P104G
mutants retained their antibody binding activities, whereas the E1
proteins from the C82S and dt mutants lost most of their ability to
bind the human anti-RV serum and anti-E1 monoclonal antibody (Fig. 6)
and no E1-E2 heterodimer was detected (note asterisks in Fig. 6). As
expected, E2 binding activity was not affected under nonreducing conditions in either the wild type or the mutants (Fig. 6). This decrease in E1 antibody binding activity of the C82S and dt mutants is
not due to the formation of E1-E1 or E1-E2 oligomers under nonreducing conditions, since no higher-molecular-weight protein species were observed (Fig. 6). Thus, the antibodies appear to detect conformational changes with respect to
intrachain disulfide bonding in the C82S and dt mutants. This
result is consistent with our data on the immunoprecipitation of RV
antigen with a conformation-specific anti-E1 monoclonal antibody
(Fig. 2B).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 6.
Immunoblot analysis of E1 mutant proteins. Monolayers of
induced BHK cells were lysed in lysis buffer containing 10 mM
iodoacetamide to prevent the formation of disulfide bonds. The protein
samples were denatured in the presence (+ -Me) or absence ( -Me)
of 2-mercaptoethanol, separated by SDS-PAGE, and transferred to
nitrocellulose membranes for immunoblot analysis. RV antigens were
detected by using human anti-RV serum (Human), anti-E1 monoclonal
antibody exhibiting hemagglutination-inhibiting activity (Mab-E1), and
anti-E2 monoclonal antibody (Mab-E2). The positions of the apparent
molecular mass standards are indicated on the right (in kilodaltons).
E1-E2 heterodimer is indicated by an asterisk. Wt, BHK-E2E1; Cys,
BHK-E2E1(C82S); dt, BHK-E2E1(dt); Gly, BHK-E2E1(G93D); Pro,
BHK-E2E1(P104G).
|
|
E1-E2 heterodimer interaction.
Since correct E1-E2
oligomerization appears to be required for efficient transport of
these two proteins through the Golgi apparatus and to the
plasma membrane (3), alteration of the E1 conformation
may affect the E1-E2 heterodimer interaction. Biochemical studies
have demonstrated that RV particles can be solubilized by nonionic
detergent into an E1-E2 heterodimer structure and nucleocapsid
(32). This E1-E2 noncovalent protein complex is not
dissociated by NP-40 lysis buffer. Therefore, the formation of
intracellular E1-E2 dimers can be detected by sedimentation analysis in
sucrose gradients. To determine whether the mutations in E1 affect the
interaction between E1 and E2, induced BHK cells were solubilized in
lysis buffer containing 1% NP-40 and cellular lysates were
fractionated on isokinetic gradients (3). Gradient fractions
were analyzed by SDS-PAGE under nonreducing conditions. RV antigens
transferred to membranes were detected with human anti-RV serum. Two
distinct E1 peaks were observed in the wild type and in both the G93D
and P104G mutants (Fig. 7, top three panels). The slower-migrating peak
(fractions 15 to 19) was the monomeric E1, and the
faster-sedimenting peak (fractions 7 to 10) contained E1-E2
heterodimers as well as E1 oligomers. Baron and Forsell (3)
have reported that RV E1 migrates as two peaks in sucrose velocity
gradients. The lighter peak is the E1 monomer, while the heavier peak
is the E1 oligomer, which is larger than the E1-E2 heterodimer.
Therefore, it is likely that the fractions between 11 and 14 contained
mostly E1-E2 heterodimer. This interpretation is further supported by
the band intensity of undissociated E1-E2 in the Western blots (Fig. 7,
top three panels). In the Cys and dt mutants, only a small fraction of
E1 and E2 was found as a heterodimer. Most of E2 was detected as E2
oligomers (fractions 7 to 13), and no oligomeric E1 was observed (Fig.
7, bottom two panels). It appears that alteration of the conformation
of E1 in the C82S and dt mutants resulted in prevention of E1-E2
interaction.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 7.
Sucrose velocity analysis of E2 and E1 from cellular
lysates. Induced BHK cells were lysed in lysis buffer, and the lysates
were spun to remove the nuclei. Each lysate was analyzed on a 5 to 20%
linear sucrose gradient as described in Materials and Methods.
Fractions from each gradient were analyzed by immunoblotting. E2 and E1
were detected with human anti-RV serum (1:100 dilution). Sedimentation
is from right to left. The positions of the apparent molecular mass
standards are indicated on the right (in kilodaltons). Wt,
BHK-E2E1; Gly, BHK-E2E1(G93D); Pro, BHK-E2E1(P104G); Cys,
BHK-E2E1(C82S); dt, BHK-E2E1(dt).
|
|
Cell-cell fusion activities of mutants.
Katow and Sugiura
(23) suggested that RV E1 plays a vital role in
membrane fusion in the acidic endosomal compartment. Bernasconi et
al. (5) reported that RV E1 containing a
glycosylphosphatidylinositol (GPI) anchor was transported to
the cell surface, where it retained the hemadsorption activity
characteristic of the wild-type E1-E2 heterodimer. To examine whether
E1 is the fusogenic protein of RV, transformed BHK cell lines
expressing RV E2 (BHK-E2) were isolated and used in the fusion assay in
parallel with the wild type, BHK-E2E1. Induced BHK cells were treated
with fusion medium at pH 5.0, 6.0, or 7.0 for 20 min at 37°C. The
cells were washed with growth medium (pH 7.0) and incubated with the
same medium at 37°C for an additional 3 to 4 h. The
polykaryons formed were viewed under a phase-contrast microscope.
The wild type, BHK-E2E1, showed extensive polykaryon formation at
both pH 5.0 and 6.0 but not at pH 7.0 (Fig.
8A). The majority of polykaryons
contained 20 to 50 nuclei at pH 5.0 and 5 to 20 nuclei at pH 6.0 (Fig.
8A). No syncytium formation was observed in the induced BHK-E2 cells at
any pH tested (data not shown). The lack of detectable cell fusion
observed in BHK-E2 cells is not due to limited cell surface expression,
since we have shown previously that RV E2 can reach the cell surface by
itself (16) and the expression level in transformed BHK
cells is five times higher than that of the transfected COS cells (data
not shown). Taken together, these results indicate that E1 contains the
fusogenic domain of RV, consistent with the finding that RV E1
particles can bind to liposomes in the absence of E2 (23).

View larger version (167K):
[in this window]
[in a new window]

View larger version (113K):
[in this window]
[in a new window]
|
FIG. 8.
Syncytium formation in cells expressing wild-type or
mutant proteins. (A) pH dependence of polykaryon formation.
BHK-E2E1 (WT) and BHK cells were induced with ZnSO4 for
16 h, exposed to fusion medium at pH 5.0, 6.0, or 7.0 for 20 min,
incubated in regular growth medium for 4 h, and photographed. (B)
Polykaryon formation by mutant proteins. Induced BHK cells were exposed
to fusion medium at pH 5.0 for 20 min, incubated in regular growth
medium for 4 h, fixed, and photographed. WT, BHK-E2E1; Gly,
BHK-E2E1(G93D); Pro, BHK-E2E1(P104G).
|
|
To examine whether the internal hydrophobic domain of E1 is
involved in membrane fusion, the pH dependence of fusion activity
of the mutants was investigated. Induced BHK cells were treated
with fusion medium over the pH range of 4.0 to 7.0, and polykaryons
formed were quantitated. Since the extent of syncytium formation
in the
cultures is dependent on both the number of cells expressing
RV antigen
and the amount of RV antigen on the cell surface, the
results presented
in Table
1 are the averages of data from
four
separate experiments. The fusion activity is presented as the
percentage of cell fused in the culture for each mutant at the
pH
indicated. As expected, no fusion activity was observed in
the C82S and
dt mutants, since RV antigen was not expressed on
the cell surface in
these mutants (Table
1). For the G93D mutant,
no fusogenic activity was
detected, although occasionally a cell
fusion rate of less than 0.5%
was observed at pH 5 to 4.5. We
found that the wild type and the P104G
mutant had a broad pH range
for fusion, with maximum fusogenic activity
at around pH 4.8 and
corresponding fusion rates of greater than 60%
and between 20
and 40%, respectively (Table
1 and Fig.
8B). The
average polykaryon
sizes were 20 to 30 nuclei for the wild type and
5 to 10 nuclei
for the P104G mutant (Fig.
8B). The decrease in fusion
activity
of the P104G mutant and the block in cell fusion
observed in the
G93D mutant are not due to the limited amount of
spike protein
at the cell surface. We have assayed the fusogenic
activity of
wild-type BHK cells induced at various ZnSO
4
concentrations in
order to determine the minimal level of cell surface
spike protein
required for fusion. We found that in the absence of
ZnSO
4 induction
(10% cell surface antigen, compared
to 100% at 40 µM ZnSO
4), cell
fusion rates of 5 to
10% were observed, while at 10 µM ZnSO
4 induction
(25% cell surface antigen), more than 30% of cells showed
polykaryon
formation at pH 4.8 (data not shown). Therefore,
it is likely
that this hydrophobic region of E1 represents the fusion
domain
of RV.
 |
DISCUSSION |
RV envelope glycoproteins E1 and E2 are targeted to the Golgi
complex as heterodimers. It has been suggested that heterodimerization of E1 with E2 is required for the former protein to be correctly folded
and transported to the Golgi complex (4, 19), where the
complex accumulates due to a Golgi retention signal in the membrane-spanning domain of E2 (21). However, RV E1 can be
rendered transport competent in the absence of E2 by the addition of a GPI anchor to the C terminus of the E1 ectodomain (5).
Addition of a GPI anchor has been used for studying the role of
individual domains of several membrane proteins in oligomerization and
transport (8, 41) and has been shown to influence folding
(2). Thus, it is conceivable that E1 retention is mediated
by the binding of E1 to another protein, perhaps via a sequence(s) in
the ectodomain, and this interaction may be prevented by
oligomerization with E2 or fusion to a GPI anchor.
Our results showed that the internal hydrophobic domain (residues 81 to
109) in RV E1 plays a major role in the formation of the E1-E2
heterodimer and in the low-pH-induced cell fusion. We have shown
previously that the antigenic structure of E1 is dependent on both
N-linked glycans and intramolecular disulfide bonding (37).
It is likely that substitution of serine at Cys82 disturbed the
intramolecular disulfide bridges in E1 that are critical in maintaining
the conformation of E1 for E1-E2 interaction and cell surface
transport. The defect in dimerization and transport in the deletion
mutant may imply that the E1 hydrophobic domain indirectly interacts
with E2. However, we believe that the transport defect is more likely
due to an overall disruption of the conformation of E1 in the absence
of this hydrophobic domain. It is possible that the E1 hydrophobic
domain is normally masked in the ER by association of E1 and E2, in
order for transport to proceed further. In the absence of this
hydrophobic moiety, E1 became misfolded or bound to ER proteins,
such as the resident ER protein Bip (35).
Our results with G93D and P104G mutants demonstrated that the
hydrophobic domain of E1 is closely involved in RV membrane fusion.
This interpretation is further supported by our recent experiments
using virus-like particles and an infectious clone containing a G93D or
P104G mutation. We have shown previously that C protein of RV
mediates the assembly of RV spike glycoproteins into virus-like
particles (38). We found that virus-like particles containing either G93D or P104G mutations were produced as efficiently as the wild type (unpublished results). In the G93D mutant, the release of spike proteins into the medium was not observed in the
presence of C protein. We have also carried out the fusion assay using
BHK cells producing G93D or P104G virus-like particles; the results
obtained are in agreement with those reported here. The other evidence
supporting our interpretation lies in experiments in which defective
G93D virus was produced from an RV infectious RNA transcript containing
the G93D mutation. Further studies on G93D and P104G viruses to define
the steps in fusion processes that are affected by these mutations are
in progress.
A variety of mutations affecting the fusion activity of SFV have been
reported (30). Although mutations at many positions affect the pH dependence of fusion, only a mutation (Gly91 to Asp) in
the hydrophobic domain of SFV E1 was found to completely block
fusion (30). It is interesting that in RV E1, substitution of aspartic acid at Gly93 also resulted in complete blockage of cell
fusion.
The binding and fusion process mediated by the spike proteins in
the envelope of the virus particle usually involve a series of
conformational changes in these proteins. In the case of SFV, conformational changes in E1 and E2 on exposure to a pH that induces fusion have been investigated by using protease digestion and monoclonal antibody assays (24, 25). Under the acidic
conditions of the endosomes, the E1-E2 heterodimer of SFV dissociates
and an NP-40-resistant E1 trimer is formed (48). Due to the
lack of conformation-specific monoclonal antibodies available for RV, little is known about the low-pH-mediated fusion process of RV structural proteins. Although RV E2 is transported to the plasma membrane in the absence of E1 (16) and does not have fusion activity, the involvement of RV E2 in the fusion process cannot be
ruled out. It is possible that conformational changes in RV E2 are
necessary for activation of E1 acid sensitivity. Unfortunately, the E2
and E1 subunits are correctly folded and transported only as a
heterodimer. No direct evidence for this mechanism is yet available. It
is also possible that a maturation step occurring late in the exocytic
pathway is required to confer acid sensitivity on newly synthesized E1.
 |
ACKNOWLEDGMENTS |
This work was supported by a grant from the Medical Research
Council of Canada. Zhiyong Qiu was the recipient of a British Columbia's Children's Hospital Foundation postdoctoral fellowship. Shirley Gillam is an investigator of British Columbia's
Children's Hospital Foundation.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pathology, University of British Columbia, Research Centre, 950 W. 28th Ave., Vancouver, British Columbia V5Z 4H4, Canada. Phone: (604) 875-2474. Fax: (604) 875-2496. E-mail: gillam{at}wpog.childhosp.bc.ca.
 |
REFERENCES |
| 1.
|
Anderson, R. G. W., and L. Orci.
1988.
A view of acidic intracellular compartments.
J. Cell Biol.
106:539-543[Free Full Text].
|
| 2.
|
Barboni, E.,
B. P. Rivero,
A. J. T. George,
S. R. Martin,
D. V. Renouf,
E. F. Hounsell,
P. C. Barber, and R. J. Morris.
1995.
The glycosylphosphatidylinositol anchor affects the conformation of Thy-I protein.
J. Cell Sci.
108:487-497[Abstract].
|
| 3.
|
Baron, M., and K. Forsell.
1991.
Oligomerization of the structural proteins of rubella virus.
Virology
185:811-819[Medline].
|
| 4.
|
Baron, M. D.,
T. Ebel, and M. Suomalainen.
1992.
Intracellular transport of rubella virus structural proteins expressed from cloned cDNA.
J. Gen. Virol.
73:1073-1086[Abstract/Free Full Text].
|
| 5.
|
Bernasconi, E.,
N. Fasel, and R. Wittek.
1996.
Cell surface expression of a functional rubella virus E1 glycoprotein by addition of a GPI anchor.
J. Cell Sci.
109:1195-1201[Abstract].
|
| 6.
|
Chaye, H.,
P. Chong,
B. Tripet,
B. Brush, and S. Gillam.
1992.
Localization of the virus neutralizing and hemagglutinin epitopes of E1 glycoprotein of rubella virus.
Virology
189:483-492[Medline].
|
| 7.
|
Clark, D. M.,
T. W. Loo,
I. Hui,
P. Chong, and S. Gillam.
1987.
Nucleotide sequence and in vitro expression of rubella virus 24S subgenomic mRNA encoding the structural proteins E1, E2 and C.
Nucleic Acids Res.
15:3041-3057[Abstract/Free Full Text].
|
| 8.
|
Crise, B.,
A. Ruusala,
P. Zagouras,
A. Shaw, and J. K. Rose.
1989.
Oligomerization of glycolipid-anchored and soluble forms of the vesicular stomatis virus glycoprotein.
J. Virol.
63:5328-5333[Abstract/Free Full Text].
|
| 9.
| Dorsett, P. H., D. C. Miller, K. Y. Green, and F. I. Byrd. 1985. Structure and function of the
rubella virus proteins. Rev. Infect. Dis. 7(Suppl.
I):S150-S156.
|
| 10.
|
Duffus, W. A.,
P. Levy-Mintz,
M. R. Klimjack, and M. Kielian.
1995.
Mutations in the putative fusion peptide of Semliki Forest virus affect spike protein oligomerization and virus assembly.
J. Virol.
69:2471-2479[Abstract].
|
| 11.
|
Frey, T. K.
1994.
Molecular biology of rubella virus.
Adv. Virus Res.
44:69-160[Medline].
|
| 12.
|
Gorman, C. M.,
L. F. Moffat, and B. H. Howard.
1982.
Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells.
Mol. Cell. Biol.
2:1044-1051[Abstract/Free Full Text].
|
| 13.
|
Hemphill, M. L.,
R. Forng,
E. S. Abernathy, and T. K. Frey.
1988.
Time course of virus-specific macromolecular synthesis during rubella virus infection in Vero cells.
Virology
162:65-75[Medline].
|
| 14.
|
Hobman, T. C.,
R. Shukin, and S. Gillam.
1988.
Translocation of rubella virus glycoprotein E1 into the endoplasmic reticulum.
J. Virol.
62:4259-4264[Abstract/Free Full Text].
|
| 15.
|
Hobman, T. C., and S. Gillam.
1989.
In vitro and in vivo expression of rubella virus E2 glycoprotein: the signal peptide is located in the C-terminal region of capsid protein.
Virology
173:241-250[Medline].
|
| 16.
|
Hobman, T. C.,
M. L. Lundström, and S. Gillam.
1990.
Processing and intracellular transport of rubella virus structural proteins in COS cells.
Virology
178:122-133[Medline].
|
| 17.
|
Hobman, T. C.,
Z. Qiu,
H. Chaye, and S. Gillam.
1991.
Analysis of rubella virus E1 glycosylation mutants expressed in COS cells.
Virology
181:768-772[Medline].
|
| 18.
|
Hobman, T. C.,
L. Woodward, and M. G. Farquhar.
1992.
The rubella virus E1 glycoprotein is arrested in a novel post-ER, pre-Golgi compartment.
J. Cell Biol.
118:795-811[Abstract/Free Full Text].
|
| 19.
|
Hobman, T. C.,
L. Woodward, and M. G. Farquhar.
1993.
The rubella virus E2 and E1 spike glycoproteins are targeted to the Golgi complex.
J. Cell Biol.
121:269-281[Abstract/Free Full Text].
|
| 20.
|
Hobman, T. C.,
N. Seto, and S. Gillam.
1994.
Expression of soluble forms of rubella virus glycoproteins in mammalian cells.
Virus Res.
31:277-289[Medline].
|
| 21.
|
Hobman, T. C.,
L. Woodward, and M. G. Farquhar.
1995.
Targeting of a heterodimeric membrane protein complex to the Golgi: rubella virus E2 glycoprotein contains a transmembrane Golgi retention signal.
Mol. Biol. Cell
6:7-20[Abstract].
|
| 22.
|
Kääriäinen, L., and H. Soderlund.
1978.
Structure and replication of alphaviruses.
Curr. Top. Microbiol. Immunol.
82:15-69[Medline].
|
| 23.
|
Katow, S., and A. Sugiura.
1988.
Low pH-induced conformational changes of rubella virus envelope proteins.
J. Gen. Virol.
69:2797-2807[Abstract/Free Full Text].
|
| 24.
|
Kielian, M., and A. Helenius.
1985.
pH-induced alterations in the fusogenic spike protein of Semliki Forest virus.
J. Cell Biol.
101:2284-2291[Abstract/Free Full Text].
|
| 25.
|
Kielian, M.,
S. Jungerwirth,
K. U. Sayad, and S. DeCandido.
1990.
Biosynthesis, maturation, and acid activation of the Semliki Forest virus fusion protein.
J. Virol.
64:4614-4624[Abstract/Free Full Text].
|
| 26.
|
Kobayashi, N.
1978.
Hemolytic activity of rubella virus.
Virology
89:6610-6612.
|
| 27.
|
Kondor-Koch, C.,
B. Burke, and H. Garoff.
1983.
Expression of Semliki Forest virus proteins from cloned complementary DNA. 1. The fusion activity of the spike glycoproteins.
J. Cell Biol.
97:644-651[Abstract/Free Full Text].
|
| 28.
|
Kunkel, T.,
J. D. Roberts, and R. A. Zakour.
1987.
Rapid and efficient site-specific mutagenesis without phenotypic selection methods.
Methods Enzymol.
154:367-387[Medline].
|
| 29.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature (London)
227:680-685[Medline].
|
| 30.
|
Levy-Mintz, P., and M. Kielian.
1991.
Mutagenesis of the putative fusion domain of the Semliki Forest virus spike protein.
J. Virol.
65:4292-4300[Abstract/Free Full Text].
|
| 31.
|
Matthews, R. E. F.
1982.
Classification and nomenclature of viruses. Third report of the International Committee on Taxonomy of Viruses.
Intervirology
17:1-199[Medline].
|
| 32.
|
Oker-Blom, C.,
N. Kalkkinen,
L. Kääriäinen, and R. F. Pettersson.
1983.
Rubella virus contains one capsid protein and three envelope glycoproteins, E1, E2a, and E2b.
J. Virol.
46:964-973[Abstract/Free Full Text].
|
| 33.
|
Oker-Blom, C.
1984.
The gene order for rubella virus structural proteins is NH2-C-E2-E1-COOH.
J. Virol.
51:354-358[Abstract/Free Full Text].
|
| 34.
|
Palmiter, R. D.,
R. R. Behringer,
C. J. Quaife,
F. Maxwell,
I. H. Maxwell, and R. I. Brinster.
1987.
Cell lineage ablation in transgenic mice by cell-specific expression of toxic gene.
Cell
50:435-443[Medline].
|
| 35.
|
Pelham, H. R. B.
1986.
Speculation on the functions of the major heat shock and glucose-regulated proteins.
Cell
46:959-961[Medline].
|
| 36.
|
Qiu, Z.,
T. C. Hobman,
H. L. McDonald,
N. O. L. Seto, and S. Gillam.
1992.
Role of N-linked oligosaccharides in processing and intracellular transport of E2 glycoprotein of rubella virus.
J. Virol.
66:3514-3521[Abstract/Free Full Text].
|
| 37.
|
Qiu, Z.,
F. Tufaro, and S. Gillam.
1992.
The influence of N-linked glycosylation on the antigenicity and immunogenicity of rubella virus E1 glycoprotein.
Virology
190:876-881[Medline].
|
| 38.
|
Qiu, Z.,
D. Ou,
H. Wu,
T. C. Hobman, and S. Gillam.
1994.
Expression and characterization of virus-like particles containing rubella virus structural proteins.
J. Virol.
68:4086-4091[Abstract/Free Full Text].
|
| 39.
|
Qiu, Z.,
H. L. McDonald,
J. Chen,
T. C. Hobman, and S. Gillam.
1994.
Mutational analysis of the arginine residues in the E2-E1 junction region on the proteolytic processing of the polyprotein precursor of rubella virus.
Virology
200:821-825[Medline].
|
| 40.
|
Qiu, Z.,
F. Tufaro, and S. Gillam.
1995.
Brefeldin A and monensin arrest cell surface expression of membrane glycoproteins and release of rubella virus.
J. Gen. Virol.
76:855-863[Abstract/Free Full Text].
|
| 41.
|
Salzwedel, K.,
P. B. Johnston,
S. J. Roberts,
J. W. Dubay, and E. Hunter.
1993.
Expression and characterization of glycophospholipid-anchored human immunodeficiency virus type 1 envelope glycoproteins.
J. Virol.
67:5279-5288[Abstract/Free Full Text].
|
| 42.
|
Seto, N. L.,
D. Ou, and S. Gillam.
1995.
Expression and characterization of secreted forms of rubella virus E2 glycoprotein in insect cells.
Virology
206:736-741[Medline].
|
| 43.
|
Tarentino, A. L., and F. Maley.
1974.
Purification and properties of an endo- -N-acetylglucosaminidase from Streptomyces griseus.
J. Biol. Chem.
249:811-817[Abstract/Free Full Text].
|
| 44.
|
Towbin, H.,
Y. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354[Abstract/Free Full Text].
|
| 45.
|
Väänänen, P., and L. Kääriäinen.
1980.
Fusion and haemolysis of erthrocytes caused by three togaviruses: Semliki Forest, Sindbis and rubella.
J. Gen. Virol.
46:467-475[Abstract/Free Full Text].
|
| 46.
|
Waechter, D. E., and R. Baserga.
1982.
Effect of methylation on expression of microinjected genes.
Proc. Natl. Acad. Sci. USA
79:1106-1110[Abstract/Free Full Text].
|
| 47.
|
Wahlberg, J. M.,
W. A. M. Boere, and H. Garoff.
1989.
The heterodimeric association between the membrane proteins of Semliki Forest virus changes its sensitivity to low pH during virus maturation.
J. Virol.
63:4991-4997[Abstract/Free Full Text].
|
| 48.
|
Wahlberg, J. M.,
R. Bron,
J. Wilschut, and H. Garoff.
1992.
Membrane fusion of Semliki Forest virus involves homotrimers of the fusion protein.
J. Virol.
66:7309-7318[Abstract/Free Full Text].
|
| 49.
|
Waxham, M. W., and J. S. Wolinsky.
1983.
Immunochemical identification of rubella virus hemagglutinin.
Virology
126:194-203[Medline].
|
| 50.
|
White, J. M.
1992.
Membrane fusion.
Science
258:917-924[Abstract/Free Full Text].
|
| 51.
|
Zhao, H., and H. Garoff.
1992.
Role of cell surface spikes in alphavirus budding.
J. Virol.
66:7089-7095[Abstract/Free Full Text].
|
Journal of Virology, November 1998, p. 8747-8755, Vol. 72, No. 11
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Claus, C., Hofmann, J., Uberla, K., Liebert, U. G.
(2006). Rubella virus pseudotypes and a cell-cell fusion assay as tools for functional analysis of the rubella virus E2 and E1 envelope glycoproteins.. J. Gen. Virol.
87: 3029-3037
[Abstract]
[Full Text]
-
Lee, J.-Y., Bowden, D. S.
(2000). Rubella Virus Replication and Links to Teratogenicity. Clin. Microbiol. Rev.
13: 571-587
[Abstract]
[Full Text]
-
Qiu, Z., Yao, J., Cao, H., Gillam, S.
(2000). Mutations in the E1 Hydrophobic Domain of Rubella Virus Impair Virus Infectivity but Not Virus Assembly. J. Virol.
74: 6637-6642
[Abstract]
[Full Text]
-
Takikawa, S., Ishii, K., Aizaki, H., Suzuki, T., Asakura, H., Matsuura, Y., Miyamura, T.
(2000). Cell Fusion Activity of Hepatitis C Virus Envelope Proteins. J. Virol.
74: 5066-5074
[Abstract]
[Full Text]