Previous Article | Next Article 
Journal of Virology, November 1998, p. 8690-8696, Vol. 72, No. 11
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Measles Virus Attenuation Associated with Transcriptional
Impediment and a Few Amino Acid Changes in the Polymerase and
Accessory Proteins
Makoto
Takeda,1,2
Atsushi
Kato,1
Fumio
Kobune,3
Hiroko
Sakata,3
Yan
Li,1
Tatsuo
Shioda,1
Yuko
Sakai,1
Makoto
Asakawa,1 and
Yoshiyuki
Nagai1,2,*
Department of Viral Infection, Institute of
Medical Science, University of Tokyo, Shirokanedai 4-6-1, Minato-ku, Tokyo 108-86391 and
Department of Viral Disease and Vaccine
Control3 and
AIDS Research
Center,2 National Institute of Infectious
Disease, Gakuen 4-7-1, Musashimurayama, Tokyo 208-0011, Japan
Received 24 April 1998/Accepted 27 July 1998
 |
ABSTRACT |
Measles virus (MV) isolated in B95a cells, a marmoset B-cell line,
retains full pathogenicity for cynomolgus monkeys, while its derivative
obtained by adaptation to the growth in Vero cells, a monkey kidney
cell line, loses the pathogenic potential (F. Kobune, H. Sakata, and A. Sugiura, J. Virol. 64:700-705, 1990). Here, we show with a pair
of strains, a fresh isolate (9301B) in B95a cells and its Vero
cell-adapted form (9301V), that the in vivo attenuation parallels the
decrease of replication and syncytium-inducing capabilities in the
original B95a cells and that these in vitro phenotypes are attributable
to impediment of transcription, which is already obvious at the level
of primary transcription catalyzed by the virion-associated RNA
polymerase. On the other hand, cell fusion assays detected no
functional difference between the glycoproteins of the two viruses.
Essentially the same transcriptional impediment with reduced syncytium
induction following Vero cell adaptation was found with two other pairs of strains that had been similarly prepared. Nucleotide sequence comparison between the 9301B and 9301V viruses revealed that a few (at
most five) amino acid changes, which sporadically took place in the
polymerase (L and P proteins) and/or accessory V and C proteins, were
responsible for the in vitro and in vivo attenuation through adaptation
to growth in Vero cells.
 |
INTRODUCTION |
Measles is a highly contagious
disease characterized by a prodromal illness of fever, coryza,
cough, and conjunctivitis followed by the appearance of a generalized
maculopapular rash (for a review, see reference
9a). Despite the development of successful live attenuated vaccines, measles remains a major cause of mortality of
children in developing countries and a cause of continuing outbreaks in
industrialized nations (27).
Measles virus (MV), the etiologic agent, is an enveloped virus
containing a nonsegmented, negative-strand (
) RNA as the
genome. It is classified in the genus Morbillivirus of the
family Paramyxoviridae. The viral genome of about 15 kb
is organized starting with a short 3' leader region, followed by
the six genes encoding N (nucleocapsid), P (phospho), M (matrix), F
(fusion), H (hemagglutinin), and L (large) proteins, and
ending with a short 5' trailer region. In addition to the P
protein, the second gene expresses accessory genes V and C by a process
known as cotranscriptional editing to insert a single nontemplated G
residue and by using an overlapping frame, respectively. The
genome is tightly associated with N subunits, forming the helical
ribonucleoprotein complex (RNP). This RNP but not the naked RNA
is the template for both transcription and replication. There is only a
single promoter for the RNA polymerase (L-P) (10) at the 3'
end. By recognizing the stop (termination/polyadenylation) and restart
signals at each gene boundary, the polymerase gives rise to leader RNA
and each mRNA. After translation of these mRNAs and accumulation
of the translation products, genome replication begins. In this
step, the same polymerase copies the same RNP template but now somehow
ignores the successive stop signals for the leader RNA and mRNAs
and generates a full-length antigenomic positive-strand
(+) RNP. The same polymerase enters the promoter at the 3' end of (+)
RNP to copy the genomic (
) RNP, which serves as
the template for the next round of transcription and replication (for a review, see reference 16a).
Initiation of the infectious cycle begins with the binding of H
glycoprotein on the envelope to the cell surface receptor on
susceptible cells. This is followed by F glycoprotein-mediated fusion
of the envelope with the cell membrane, delivering the viral content
into the cytoplasm. The membrane cofactor protein or CD46 has
been identified to be the specific receptor (4, 21,
22). However, some other molecules may be additionally involved
in virus attachment to the cell surface or in the subsequent fusion
process (5, 25). The final step of the virus life cycle is
the assembly of viral components at the cell surface and the release of
progeny by budding.
MV is most successfully isolated from peripheral blood leukocytes or
respiratory secretions inoculated onto primary human and monkey kidney
cells (6). Due to problems with animal use and possible
contamination of primary cells with simian viruses, continuous monkey
kidney cell lines (e.g., Vero and CV-1) are currently more frequently
used for primary MV isolation. However, several blind passages in these
cell lines are generally required before virus propagation and
development of cytopathic effects (CPE) to detectable levels. More
recently, an Epstein-Barr virus (EBV)-transformed marmoset B-lymphocyte
line, B95-8 (18), and its derivatives have been found to be
extremely susceptible to wild-type MV and to allow rapid isolation of
the virus from clinical specimens (13). More importantly, MV
isolated into one of the derivative lines, B95a, retained full
pathogenicity for monkeys, whereas MV subsequently adapted to growth in
Vero cells lost pathogenic potential (13, 14). These results
suggest that Vero and related cell lines select a minor, nonpathogenic
population in heterologous mixed populations (quasispecies) circulating
in the body and that the virus must undergo further mutations and
selections to become fully replicative in these cells. In this study,
we compared a pair of MV strains, a fresh isolate in B95a cells and its
derivative which had been adapted to full growth in Vero cells. The
Vero cell-adapted virus was found to still be able to replicate in B95a
cells, but its replication was significantly slower than that of the
original B95a isolate. These two viruses were then compared for the
entire genome sequence, functions of envelope glycoproteins, and gene
expression and replication. The results suggested that MV attenuation
through adaptation to growth in Vero cells could involve the impediment
of transcription in the original B95a cells, which appeared to be
caused by a few amino acid changes in the polymerase and/or the
accessory V and C proteins.
 |
MATERIALS AND METHODS |
Viruses and cells.
A monkey kidney-derived cell line, Vero,
and an EBV-transformed marmoset B-lymphocyte, B95a, were grown in
Eagle's minimal essential medium supplemented with 5%
heat-inactivated (56°C for 30 min) fetal bovine serum (FBS) and RPMI
1640 supplemented with 10% FBS, respectively. The wild-type MV strain,
9301B, was isolated with B95a cells from throat swabs of children
diagnosed with acute measles. The Vero cell-adapted strain, 9301V, was
obtained by several blind passages of strain 9301B in Vero cells. Two
additional pairs of fresh isolates in B95a cells and Vero cells strains
9303B and 9303V and strains 9403B and 9403V, were also obtained
similarly.
Virus growth in cell cultures and experimental infection of
monkeys.
The monolayer cultures of Vero cells and subconfluent
B95a cells, both in 6-well cluster plates, were infected with viruses at different multiplicities of infection (MOIs). At various times postinfection (p.i.), the cells were scraped into culture medium. After
three cycles of freezing and thawing, infectivity titers were
determined by measuring the plaque titers in Vero cells or the 50%
tissue culture infectious doses (TCID50) in B95a cells. The
pair of viruses 9301B and 9301V were inoculated into cynomolgus monkeys
subcutaneously and compared for the clinical manifestations and
pathological changes as described previously (13).
Sequencing of the 9301B and 9301V genomes.
With the RNA
isolation reagent RNAzol B (Biotex Laboratories, Houston, Tex.), the
genome RNAs were extracted from 9301B and 9301V virions purified by
sucrose gradient centrifugation from culture supernatants of
9301B-infected B95a cells and 9301V-infected Vero cells, respectively.
Fifteen cDNA fragments (nucleotide positions 1 to 830, 82 to 1721, 1674 to 2480, 1777 to 3350, 3000 to 4462, 4261 to 4795, 5449 to 7130, 7000 to 8042, 7261 to 9144, 9001 to 10239, 10001 to 11240, 11197 to 12663, 12501 to 13900, 13857 to 14797, and 14755 to 15894) were amplified from
these vRNA templates by reverse transcription-PCR with reverse
transcriptase (Superscript II; Gibco-BRL, Gaithersburg, Md.),
Taq DNA polymerase (Ex Taq; TaKaRa, Seta, Japan), and the 15 specific primer pairs. The cDNAs spanning the noncoding region between
the M and F open reading frames (ORFs) were difficult to obtain, but
this difficulty was overcome by using the Superscript One-Step reverse
transcription-PCR system (Gibco-BRL). Paramyxovirus virions contain, in
addition to the genomic (
) RNA, the antigenomic (+)
RNA in different amounts (15). Therefore, the rapid
amplification of cDNA ends (5'-RACE) system (Gibco-BRL) was used to
sequence the 3'- and 5'-terminal regions including the leader and
trailer sequences, respectively, with the genomic and
antigenomic strands in the virion preparations as the
templates. The detailed procedures for the above sequencing of the
entire genomes and the data obtained will be published elsewhere.
Plasmid construction and fusion assay.
The F genes of 9301B
and 9301V were identical in sequence, while their H genes differed by
three nucleotides that were all nonsynonymous (see below). The cDNAs
encoding the common (actually derived from 9301V) F protein, 9301B H
protein, and 9301V H protein were inserted at the SmaI site
just downstream of the T7 promoter in pGEM-3Z plasmids (Promega,
Madison, Wis.). These recombinant plasmids were named pGEM-F,
pGEM-H/9301B, and pGEM-H/9301V. Subconfluent B95a cells in 24-well
cluster plate were infected with vaccinia virus expressing T7
polymerase, vTF7-3, a gift of B. Moss (9), at an input MOI
of 2.0 PFU per cell. Then, plasmids pGEM-F(10 µg) and pGEM-H/9301B or
pGEM-H/9301V (10 µg) were transfected individually or together into
the VV-infected cells, with the aid of the lipofection reagent, DOSPER
(Boehringer GmbH, Mannheim, Germany), as specified by the manufacturer.
These B95a cells were incubated in RPMI 1640 with 10% FBS. At 24 h p.i., the cells were stained with Giemsa's solution and then the
number of nuclei within syncytia as a proportion of a total of 1,000 nuclei in several microscopic fields was counted. The fusion index
(100 × the total number of nuclei within syncytia per 1,000 nuclei) was calculated by the formula of Ohgimoto et al.
(23).
Detection of primary transcripts.
Subconfluent B95a cells in
a 6-cm-diameter dish were infected with 9301B or 9301V at an input MOI
of 0.02 TCID50 per cell in the presence of 100 µg of
cycloheximide per ml so that the RNA transcription catalyzed by the
virion-associated polymerase, but not genome replication or gene
amplification, was allowed to occur. Total RNAs extracted from infected
cells at 4, 8, and 11 h p.i. with the RNA isolation reagent RNAzol
B were reverse transcribed into cDNAs with oligo(dT) primers and
reverse transcriptase (Superscript II) at 42°C for 60 min. The
cDNAs were amplified by PCR for 35 cycles of 1 min at 95°C, 2 min at
55°C, and 3 min at 72°C with Taq DNA polymerase. The
primers used were
5'-1001CCTTGATGAACCTTTACCAG1020-3'
(sense for N gene),
5'-1680CTAGAAGATCACTGTCATTG1661-3'
(antisense for N gene),
5'-1778TCAACCATCCACTCCCACGA1797-3'
(sense for P gene),
5'-2480TCGGCAGTGCTGGCCCTACT2461-3'
(antisense for P gene),
5'-4001CAACCTGCTGGTGACCCTTA4020-3'
(sense for M gene),
5'-4462TTGCTGGGCACTACGGTCTA4443-3'
(antisense for M gene),
5'-6001ATCAATAATGAGCTGATACC6021-3'
(sense for F gene),
5'-7130GTTTCAAGAGTTGTAGAGGA7111-3'
(antisense for F gene),
5'-8501GGGGTCTTGTCTGTTGACCT8520-3'
(sense for H gene),
5'-9144AGATTGGTTCACTAGCAGCC9125-3'
(antisense for H gene),
5'-15001GGGATTTTGTTCAGGGATTT15020-3'
(sense for L gene), and
5'-15785TTAAT CCTTAATCAGGGCAC15766-3'
(antisense for L gene). The cDNA for
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA was amplified
as an internal control. The primer pair used for GAPDH was
5'-CAGCCGCATCTTCTTGTGC-3' (sense) and
5'-CTCCTGGAAGATGGTGATGGG-3' (antisense).
Detection of genome RNAs and mRNAs.
Total RNAs extracted
from infected B95a cells at 16, 23 and 35 h p.i. were reverse
transcribed into cDNAs with the specific sense primer for MV genome
RNA, 5'-1ACCAAACAAAGTTGGGTAAG20-3'.
The reverse transcriptase in the reaction mixture was heat denatured and then, using the same sense primer and an N gene-specific antisense primer,
5'-470GGTACCTCTTGATGCGAAGG451-3',
the synthesized first-strand cDNAs were amplified by PCR under the conditions described above. After every five cycles, amplified cDNAs were taken and analyzed by electrophoresis in 1.5%
agarose-Tris-borate-EDTA (TBE) gels. At 16 and 24 h p.i., mRNAs
were also extracted with the QuickProp Micro mRNA purification kit
(Pharmacia, Uppsala, Sweden), electrophoresed in 0.9%
agarose-formamide/morpholinepropanesulfonic acid (MOPS)
gels, and capillary transferred onto Hybond-N filters (Amersham
Pharmacia Biotech, Uppsala, Sweden) for Northern hybridization. They
were hybridized with F and H gene-specific
(NheI-PvuII fragment of pGEM-H/9301V)
probes that had been labeled with [
-32P]dCTP with the
Multiprime DNA-labeling system (Amersham Pharmacia Biotech) and with
an [
-32P]GTP-labeled F gene-specific
riboprobe made with SP6 RNA polymerase (Epicentre Technologies,
Madison, Wis.) by using pGEM-F linearlized with EcoRV. The
same filter was also hybridized with the
[
-32P]GTP-labeled cellular GAPDH-specific
riboprobe, which served as an internal control.
Western blotting.
Infected B95a cells were lysed and
proteins were separated by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (7.5% polyacrylamide), electrotransferred onto
polyvinylidene difluoride membranes (Millipore, Bedford, Mass.), and
immunoblotted with anti-Fcyt rabbit anti-peptide serum, anti-Hcyt
rabbit anti-peptide serum (2) (gifts of R. Cattaneo), and
anti-MV human polyclonal serum obtained from a healthy volunteer
infected with MV vaccine strain Schwarz FF-8 (26), which was
able to detect N protein clearly.
Nucleotide sequence accession numbers.
The nucleotide
sequence data reported in this paper will appear in the
DDBJ/EMBL/GenBank nucleotide sequence databases with accession no.
AB012948 and AB012949.
 |
RESULTS |
Attenuation of MV through adaptation to growth in Vero cells.
The 9301B virus is a fresh isolate in B95a cells, which has been
expanded to a sufficient titer for infection experiments only by
several passages in the same cells. This virus was incapable of
productively growing in Vero cells, but after 10 passages it became
fully adapted to growth in Vero cells; this virus is named 9301V (Table
1).
Table 1 summarizes the pathogenicity of the two viruses for cynomolgus
monkeys. The wild-type 9301B virus produced maculopapular rashes
typical of measles and caused lymphopenia and weight loss in a monkey
after subcutaneous inoculation. Histopathologically, development of
giant cells and necrosis in the entire thymus and other lymphoid
tissues such as the spleen and lymph nodes were also evident. None of
these extensive macroscopic and microscopic pathological changes was
apparent with the 9301V virus, except for a moderate degree of
syncytium formation in lymphoid tissues, which was limited in
both number and size. These results confirm the previous view
that measles virus becomes attenuated following adaptation to growth in
Vero cells (13).
Growth comparison of 9301B and 9301V viruses in B95a cells.
To
learn how measles virus would replicate in the original B95a cells
after adaptation to Vero cells, we compared the growth kinetics of
9301B and 9301V viruses in B95a cells. As shown in Fig.
1, the 9301V virus replicated
significantly less fast than the 9301B virus following infections at
three different MOIs, although the final titers were the same or nearly
comparable between the two viruses. The 9301B virus caused severe CPE,
indicated by extensive cell fusion (giant-cell formation), whereas no
such strong CPE was found for the 9301V virus (Fig. 1). It was most probably due to severe CPE in the entire culture that 9301B virus growth appeared to be self-limiting, with the virus reaching final titers comparable to those of 9301V virus.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Replication kinetics of 9301B and 9301V viruses in
B95a cells. Infections were initiated with input MOIs of 0.02, 0.002, and 0.0002 TCID50 per cell. The degree of CPE is shown in
parentheses as scores of +4 (cell fusion in the entire culture) to +1
(a few fusion foci in a microscopic field) and 0 (no apparent fusion).
(B) Micrographs showing CPE manifested in 9301B- or 9301V-infected B95a
cells 24 h after infection at a MOI of 0.02 per cell.
|
|
These results suggest that poor replication capability and
low syncytium-inducing capacity in B95a cells are the in vitro
correlates of reduced in vivo pathogenicity caused by adaptation
of MV
to Vero cells.
Nucleotide and amino acid sequence comparison between the
9301B and 9301V viruses.
Identification of nucleotide changes
present throughout the entire genomes of 9301B and 9301V viruses
would be a necessary first step toward revealing the basis underlying
MV attenuation through adaptation to growth in Vero cells. Probably
because of the tendency to form higher-order RNA structures, it was
initially not easy to obtain cDNAs spanning the region between the M
and F ORFs, but this difficulty was eventually overcome (see Materials and Methods), leading to sequencing of the entire genomes. The results
revealed that the two genomes were identical in length (15,894 nucleotides) but differed by 8 nucleotides (Table
2). All these nucleotide changes were
found in ORFs for the P, V, C, H, and L proteins. The other regions
including the leader, trailer, transcription start and stop signals,
intergenic sequences, and noncoding regions of all six genes were
identical between the two. The pyrimidine-rich BB boxes, which were
previously suggested to guide and facilitate RNA polymerase
attachment (1), were also identical. Thus, we concluded that
all the cis-acting elements for controlling viral
transcription, translation, and replication were identical between the
two viruses. All or some of the eight nonsilent changes would therefore
be responsible for the above-described remarkable phenotypic
changes caused by virus adaptation to growth in Vero cells.
Functional comparisons of the 9301B and 9301V envelope
glycoproteins.
The H glycoprotein of MV is involved in receptor
recognition, whereas the F protein is involved in the envelope-cell
membrane fusion. Although the F protein is the direct mediator of cell fusion, coexpression of the receptor binding H protein is required for
cell fusion (28). The remarkable differences in cell fusion capacity between the 9301B and 9301V viruses (Fig. 1) raised the possibility of structural and functional differences in one or both of
their glycoproteins. Nucleotide sequencing revealed no difference in
either coding or noncoding region of the F gene but identified three
nucleotide changes, all nonsynonymous, in the H gene between the two
viruses (Table 2). We examined whether the H proteins of 9301B and
9301V viruses similarly have a supporting function in cell fusion.
Either of the H proteins was expressed in B95a cells along with the
common F protein (actually derived from 9301V) from the respective
transfected plasmids by vaccinia virus-encoded T7 polymerase.
As shown in Fig.
2, the H proteins
derived from the 9301B and 9301V viruses were equally able to support
cell fusion in the
presence of F protein. Besides, although the 9301V
virus replicated
slowly in B95a cells (Fig.
1), the virus titer assayed
in these
cells (1.7 × 10
6 TCID
50/ml) was
comparable to that in Vero cells (2.1 × 10
6
TCID
50/ml), to which the virus had been highly adapted.
This
comparable plating efficiency also suggested that the capacity
of
9301V virus to bind to and penetrate into B95a cells was not
impaired.
So far, therefore, no functional impairment of glycoproteins
has been
found for the 9301V virus. Thus, the amino acid changes
in the 9301V
virus H protein appeared to be just incidental and
irrelevant to
measles virus adaptation to Vero cells. This notion
was supported by
the fact that there was no amino acid change
in the H gene between
another pair of strains (9403B and 9403V),
which were similarly
prepared.

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 2.
Cell fusion-supporting activities of the H proteins
derived from 9301B and 9301V. Subconfluent 24-well cluster plates of
B95a cells were infected with vTF7-3 and transfected with pGEM-F alone
or together with pGEM-H/9301B or pGEM-H/9301V. At 24 h p.i., the
cells were stained with Giemsa (A) and fusion indices were determined
as described in Materials and Methods (B).
|
|
Gene expression and replication.
Paramyxovirus RNA polymerase
consists of the catalytic L and cofactor P proteins (10). In
addition, studies with Sendai virus demonstrated a significant
contribution of the accessory V and C proteins to in vivo pathogenicity
as well as in vitro replication (11, 12, 16). In addition,
host cell factors appear to play roles (3, 17, 19, 20). The
amino acid changes in these polymerase and accessory proteins
between 9301B and 9301V prompted us to explore whether these two
viruses would display differences at the steps of gene expression and
replication in B95a cells. Infected cells were incubated in the
presence of cycloheximide to block de novo protein synthesis and allow
only the primary transcription catalyzed by the polymerase associated with the infecting viruses. At various time points, RNAs were extracted
from the cells, the N, P, M, F, H, and L mRNAs were reverse
transcribed, and the cDNAs were amplified by PCR (Fig. 3A, top). Compared with those of 9301B,
the signals were much weaker or marginal for 9301V. The specificity of
each band was confirmed by Southern blotting with specific DNA
probes (data not shown). To be more quantitative, the RNAs at
4 h p.i. were diluted to 10
1 to
10
3 and the reverse-transcribed and PCR-amplified
products were compared. Again, the specific products of 9301V infection
were found to be significantly less abundant than those from 9301B
infection when primers specific for N, M, F, and L (Fig. 3A, bottom),
as well as for P and H (data not shown), were used. Amplified gene expression in the absence of cycloheximide in B95a cells was also compared between the two viruses by Northern hybridization. As represented by the results with F- and H-specific probes, the gene
expression levels were considerably lower for 9301V than for 9301B
(Fig. 3B). Western blotting further demonstrated that the levels of the
gene products, i.e., the N, F, and H proteins, were all remarkably
lower for 9301V than for 9301B (Fig. 3C). Finally, we compared the
levels of intracellular genomic RNA between the two viruses.
Paramyxovirus genomic RNA migrates in gels to the 50S position,
but nonspecific aggregates of mRNAs also migrate to the same position.
Therefore, we routinely use semiquantitative PCR, which amplifies a
region from the 3' terminus to an appropriate position within the N
gene (11, 12, 16). Here, we amplified such a region of
470 nucleotides by using 20 and 25 cycles of PCR. It was clearly
shown that the genome replication of 9301V was significantly impaired
in B95a cells compared with that of 9301B (Fig. 3D).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 3.
Primary transcription (A), amplified gene expression
(B), accumulation of gene products (C), and genome replication (D)
during 9301B and 9301V virus infection in B95a cells. GAPDH expression
was used as an internal control in the experiments in panels A and B. (A and D) PCR products; (B) Northern blot; (C) Western blot. RNAs
extracted from infected cells at various times p.i. were directly
reverse transcribed and PCR amplified with specific primers (A, top,
and D), or the RNAs at 4 h p.i. were diluted to 10 1,
10 2, and 10 3 before being subjected to
reverse transcription-PCR (A, bottom).
|
|
Studies with two other pairs of wild-type and Vero
cell-adapted strains.
Essentially the same differences in
fusion-inducing capacity (Fig. 4A) and
replication capacity (data not shown) as were found between the 9301 pair were also observed between each new pair of 9303B-9303V and
9403B-9403V. Each pair of strains was then compared for primary
transcription. It was again found that the Vero cell-adapted viruses
were attenuated at the level of primary transcription (Fig. 4B). Thus,
three independent trials of adaptation of fresh isolates to growth in
Vero cells gave rise to very similar patterns of transcriptional
attenuation in the original host, B95a cells.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 4.
Cell fusion 24 h after infection of B95a cells with
9303B, 9303V, 9403B, and 9403V (A) and RT-PCR detection of the primary
transcripts of these viruses at 8 h p.i. in these cells (B).
|
|
 |
DISCUSSION |
Before the EBV-transformed marmoset B-lymphoblastoid cell line
B95-8 and its derivatives such as B95a became available, monkey kidney
cell lines (e.g., Vero and CV-1) were most frequently used for MV
isolation and propagation (7, 8). However, spreading of the
virus to a high titer in those monkey kidney lines has required at
least several blind passages, indicating a highly selective pressure
for the wild-type MV to become fully replicative in these cells. The
viruses thus isolated can no longer produce clinical symptoms and
pathological changes characteristic of measles in experimental animals
(cynomolgus monkeys), as shown in the present study and previously
(13). In contrast, the use of B95a and other related cell
lines has allowed rapid isolation and propagation of fresh MV,
suggesting that the selective pressure, if present, is marginal. Thus,
the isolates closely represent the wild-type, pathogenic MV as a
population and therefore have been readily able to reproduce the
disease course of measles in monkeys, as shown here and
previously (13, 14). MV adaptation to growth in Vero
cells is accompanied by a decrease of its capacity to replicate and
induce syncytia in B95a cells. Thus, these decreases are probably good
in vitro markers for MV attenuation of in vivo pathogenicity. The
purpose of our present study has been to decide the step(s) impeded in
the life cycle of Vero cell-adapted, attenuated MV in the
original B95a cells. For this, a fresh wild-type MV isolated in B95a cells (9301B) and its Vero cell-adapted strain (9301V)
were systematically and comparatively analyzed for their genome
sequences, glycoprotein structure and function, and gene expression and
replication.
The nucleotide sequence comparison of the entire genomes revealed no
change in the cis-acting regulatory regions for viral Zranscription and replication, including the leader,
trailer, stop-restart, and intergenic sequences. Again,
no change was found in noncoding regions of all six MV genes, which
might be involved in translational regulation. The
identified nucleotide changes were all within the ORFs and caused amino
acid changes. These sequence data were highly informative in that
the remarkable phenotypic differences both in vitro and in vivo were
attributable to the changes of viral trans-acting but not
cis-acting elements. While F protein amino acid sequences
were identical between 9301B and 9301V, three amino acid
differences were found in the H protein. The significance of
these amino acid changes was studied by the fusion assay with either of
the H proteins in combination with the common F protein. The results
indicated that the amino acid changes led to no appreciable
functional change but were neutral and hence provided no
explanation for the reduced fusion activity during the course of 9301V
infection in B95a cells. The functional integrity of 9301V H protein
was further supported by the finding that this virus had the
same plating efficiency (TCID50) on B95a and Vero
cells.
On the other hand, the gene transcription of 9301V virus in B95a cells
was significantly impaired compared with that of the 9301B virus. This
resulted in reduced levels of the gene products, including the F and H
proteins, which in turn could clearly explain the reduced
level of 9301V induced fusion in B95a cells. The impairment of
transcription would be due to the amino acid changes in the L
and P proteins constituting the polymerase complex (10). In view of the importance of the accessory V and C genes for Sendai virus
transcription, replication, and pathogenicity (11, 12, 16),
the amino acid changes in the V and C frames could also be relevant to
the attenuated transcription. The facts that the primary transcription
catalyzed by the virion-associated polymerase was already attenuated
and that the V and C proteins were not present in the virions as major
components (24) suggest that changes of P and L proteins
would be more central to the attenuated phenotype of 9301V than those
of V and C proteins. However the possibility of accessory-protein
involvement, particularly of the C protein, remains open, because C
protein knockout Sendai virus appeared to be less infectious (relative
to the particle number, roughly represented by the hemagglutination
units [16]). The genome replication of 9301V in B95a
cells also appeared to be impaired. However, since any effect on
transcription probably would decrease replication, it is not known
whether the reduction of replication is a direct or an indirect result.
Paramyxovirus transcription appears to be optimized by
cellular cofactors (3, 17, 19, 20). The impaired
transcription of the Vero-adapted virus in B95a cells could be due to
the lack of such cofactors in cells or to reduced compatibility of the
factors with the 9301V polymerase. Anyway, MV adaptation to growth in
Vero cells seems to result in transcriptional attenuation in the
original B95a cells, which could be caused by at most five
amino acid changes sporadically found in the polymerase and
accessory proteins. This attenuation so far appears to explain the
retarded replication and reduced fusion activity in B95a cells,
which are characteristic of Vero cell-adapted MV and are
probably the primary cause of its reduced pathogenicity for the
monkeys.
 |
ACKNOWLEDGMENTS |
We thank R. Cattaneo for providing anti-H and -F antibodies, M. Billeter for technical advice on the sequencing of the MV genome, and
Y. Yogo, S. Ohgimoto, K. Takeuchi, K. Tanabayashi, K. Komase, M. Matsuda, and C. Moriya for helpful discussions. We are also grateful to
the Human Genome Center (HGC) of our institution for providing the
Genome Net services and databases.
This work was supported by grants from the Ministry of Education,
Science, Sports and Culture and the Ministry of Health and Welfare,
Japan.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Viral Infection, Institute of Medical Science, University of Tokyo,
Shirokanedai 4-6-1, Minato-ku, Tokyo 108-8639, Japan. Phone:
81-3-5449-5285. Fax: 81-3-5449-5409. E-mail:
ynagai{at}hgc.ims.u-tokyo.ac.jp
 |
REFERENCES |
| 1.
|
Blumberg, B. M.,
J. Chan, and S. A. Udem.
1991.
Function of paramyxiovirus 3' and 5' end sequences in theory and practice, p. 235-247.
In
D. Kingsbury (ed.), The paramyxioviruses. Plenum Press, New York, N.Y.
|
| 2.
|
Cathomen, T.,
H. Y. Naim, and R. Cattaneo.
1998.
Measles virus with altered envelope protein cytoplasmic tails gain cell fusion competence.
J. Virol.
72:1224-1234[Abstract/Free Full Text].
|
| 3.
|
Das, T.,
M. Mathur,
A. K. Gupta,
G. M. C. Janssen, and A. K. Banerjee.
1998.
RNA polymerase of vesicular stomatitis virus specifically associates with translation elongation factor-1 for its activity.
Proc. Natl. Acad. Sci. USA
95:1449-1454[Abstract/Free Full Text].
|
| 4.
|
Dorig, R. E.,
A. Marcil,
A. Chopra, and C. D. Richardson.
1993.
The human CD46 molecule is a receptor for measles virus (Edmonston strain).
Cell
75:295-305[Medline].
|
| 5.
|
Dunster, L. M.,
J. Schneider-Schaulies,
J. Loffler,
W. Lankes,
R. Schwartz-Albeiz,
F. Lottspeich, and V. ter Meulen.
1994.
Moesin: a cell membrane protein linked with susceptibility to measles virus infection.
Virology
198:265-274[Medline].
|
| 6.
|
Enders, J. F., and T. C. Peebles.
1954.
Propagation in tissue culture of cytopathogenic agents from patients with measles.
Proc. Soc. Exp. Biol. Med.
86:277-286.
|
| 7.
|
Enders, J. F.,
T. C. Peebles,
K. McCarthy,
M. Milovanovic,
A. Mitus, and A. Holloway.
1957.
Measles virus: a summary of experiments concerned with isolation, properties, and behavior.
Am. J. Public Health
47:275-282.
|
| 8.
|
Enders, J. F.
1962.
Measles virus: historical review, isolation and behavior in various systems.
Am. J. Dis. Child.
103:282-287.
|
| 9.
|
Fuerst, T. R.,
E. G. Niles,
F. W. Studier, and B. Moss.
1986.
Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase.
Proc. Natl. Acad. Sci. USA
83:8122-8126[Abstract/Free Full Text].
|
| 9a.
|
Griffin, D. E., and W. J. Bellini.
1996.
Measles virus, p. 1267-1312.
In
B. N. Fields, D. M. Knipe, P. M. Howley, et al. (ed.), Fields virology, 3rd ed. Raven Press, New York, N.Y.
|
| 10.
|
Hamaguchi, M.,
T. Yoshida,
K. Nishikawa,
H. Naruse, and Y. Nagai.
1983.
Transcriptive complex of Newcastle disease virus. I. Both L and P proteins are required to constitute an active complex.
Virology
128:105-117[Medline].
|
| 11.
|
Kato, A.,
K. Kiyotani,
Y. Sakai,
T. Yoshida, and Y. Nagai.
1997.
The paramyxovirus, Sendai virus, V protein encodes a luxury function required for viral pathogenesis.
EMBO J.
16:578-587[Medline].
|
| 12.
|
Kato, A.,
K. Kiyotani,
Y. Sakai,
T. Yoshida,
T. Shioda, and Y. Nagai.
1997.
Importance of the cysteine-rich carboxyl-terminal half of V protein for Sendai virus pathogenesis.
J. Virol.
71:7266-7272[Abstract].
|
| 13.
|
Kobune, F.,
H. Sakata, and A. Sugiura.
1990.
Marmoset lymphoblastoid cells as a sensitive host for isolation of measles virus.
J. Virol.
64:700-705[Abstract/Free Full Text].
|
| 14.
|
Kobune, F.,
H. Takahashi,
K. Terao,
T. Ohkawa,
Y. Ami,
Y. Suzaki,
N. Nagata,
H. Sakata,
K. Yamanouchi, and C. Kai.
1996.
Nonhuman primate models of measles.
Lab. Anim. Sci.
46:315-320[Medline].
|
| 15.
|
Kolakofsky, D., and A. Bruschi.
1975.
Antigenome in Sendai virions and Sendai virus-infected cells.
Virology
66:185-191[Medline].
|
| 16.
| Kurotani, A., K. Kiyotani, A. Kato, K. Mizumoto, T. Shioda, Y. Sakai, T. Yoshida, and Y. Nagai. Sendai virus C
proteins are categorically nonessential proteins but silencing their
expression severely impairs viral replication in vitro and totally
attenuates pathogenicity in vivo. Genes Cells
3:111-124.
|
| 16a.
|
Lamb, R. A., and D. Kolakofsky.
1996.
Paramyxoviridae: the viruses and their replication, p. 1177-1204.
In
B. N. Fields, D. M. Knipe, P. M. Howley, et al. (ed.), Fields virology, 3rd ed. Raven Press, New York, N.Y.
|
| 17.
|
Liston, P.,
C. DiFlumeri, and D. J. Briedis.
1995.
Protein interactions entered into by the measles virus P, V, and C proteins.
Virus Res.
38:241-259[Medline].
|
| 18.
|
Miller, G.,
T. Shope,
H. Lisco, and M. Lipman.
1972.
Epstein-Barr virus: transformation, cytopathic changes, and viral antigens in squirrel monkey and marmoset leukocytes.
Proc. Natl. Acad. Sci. USA
69:383-389[Abstract/Free Full Text].
|
| 19.
|
Mizumoto, K.,
K. Muroya,
T. Takagi,
T. Omata-Yamada,
H. Shibuta, and K. Iwasaki.
1995.
Protein factors required for in vitro transcription of Sendai virus genome.
J. Biochem.
117:527-534[Abstract/Free Full Text].
|
| 20.
|
Moyer, S. A.,
S. C. Baker, and S. M. Horikami.
1990.
Host cell proteins required for measles virus reproduction.
J. Gen. Virol.
71:775-783[Abstract/Free Full Text].
|
| 21.
|
Naniche, D.,
T. F. Wild,
C. Rabourdin-Combe, and D. Gerlier.
1993.
Measles virus haemagglutinin induces down-regulation of gp57/67, a molecule involved in virus binding.
J. Gen. Virol.
74:1073-1079[Abstract/Free Full Text].
|
| 22.
|
Naniche, D.,
G. Varior-Krishnan,
F. Cervoni,
T. F. Wild,
B. Rossi,
C. Rabourdin-Comb, and D. Gerlier.
1993.
Human membrane cofactor protein (CD46) acts as a cellular receptor for measles virus.
J. Virol.
67:6025-6032[Abstract/Free Full Text].
|
| 23.
|
Ohgimoto, S.,
N. Tabata,
S. Suga,
M. Nishio,
H. Ohta,
M. Tsurudome,
H. Komada,
M. Kawano,
N. Watanabe, and Y. Ito.
1995.
Molecular characterization of fusion regulatory protein-1 (FRP-1) that induces multinucleated giant cell formation of monocytes and HIV gp160-mediated cell fusion.
J. Immunol.
155:3585-3592[Abstract].
|
| 24.
|
Portner, A.,
K. C. Gupta,
J. M. Seyer,
E. H. Beachey, and D. W. Kingsbury.
1986.
Localization and characterization of Sendai virus nonstractural C and C' proteins by antibodies against synthetic peptides.
Virus Res.
6:109-121[Medline].
|
| 25.
|
Schneider-Schaulies, J.,
L. M. Dunster,
R. Schwartz-Albiez,
G. Krohne, and V. ter Meulen.
1995.
Physical association of moesin and CD46 as a receptor complex for measles virus.
J. Virol.
69:2248-2256[Abstract].
|
| 26.
|
Schwarz, A. J. F.
1962.
Preliminary tests of a highly attenuated measles vaccine.
Am. J. Dis. Child.
103:216-219.
|
| 27.
|
Weiss, R.
1992.
Measles battle loses potent weapon.
Science
258:546-547[Free Full Text].
|
| 28.
|
Wild, T. F.,
E. Malvoisin, and R. Buckland.
1991.
Measles virus: both the haemagglutinin and fusion glycoproteins are required for fusion.
J. Gen. Virol.
72:439-442[Abstract/Free Full Text].
|
Journal of Virology, November 1998, p. 8690-8696, Vol. 72, No. 11
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Nakatsu, Y., Takeda, M., Iwasaki, M., Yanagi, Y.
(2009). A Highly Attenuated Measles Virus Vaccine Strain Encodes a Fully Functional C Protein. J. Virol.
83: 11996-12001
[Abstract]
[Full Text]
-
Okada, H., Itoh, M., Nagata, K., Takeuchi, K.
(2009). Previously Unrecognized Amino Acid Substitutions in the Hemagglutinin and Fusion Proteins of Measles Virus Modulate Cell-Cell Fusion, Hemadsorption, Virus Growth, and Penetration Rate. J. Virol.
83: 8713-8721
[Abstract]
[Full Text]
-
Takeda, M., Ohno, S., Tahara, M., Takeuchi, H., Shirogane, Y., Ohmura, H., Nakamura, T., Yanagi, Y.
(2008). Measles Viruses Possessing the Polymerase Protein Genes of the Edmonston Vaccine Strain Exhibit Attenuated Gene Expression and Growth in Cultured Cells and SLAM Knock-In Mice. J. Virol.
82: 11979-11984
[Abstract]
[Full Text]
-
Rout, S. N., Samal, S. K.
(2008). The Large Polymerase Protein Is Associated with the Virulence of Newcastle Disease Virus. J. Virol.
82: 7828-7836
[Abstract]
[Full Text]
-
Takeda, M., Tahara, M., Hashiguchi, T., Sato, T. A., Jinnouchi, F., Ueki, S., Ohno, S., Yanagi, Y.
(2007). A Human Lung Carcinoma Cell Line Supports Efficient Measles Virus Growth and Syncytium Formation via a SLAM- and CD46-Independent Mechanism. J. Virol.
81: 12091-12096
[Abstract]
[Full Text]
-
Tahara, M., Takeda, M., Yanagi, Y.
(2007). Altered Interaction of the Matrix Protein with the Cytoplasmic Tail of Hemagglutinin Modulates Measles Virus Growth by Affecting Virus Assembly and Cell-Cell Fusion. J. Virol.
81: 6827-6836
[Abstract]
[Full Text]
-
Tahara, M., Takeda, M., Seki, F., Hashiguchi, T., Yanagi, Y.
(2007). Multiple Amino Acid Substitutions in Hemagglutinin Are Necessary for Wild-Type Measles Virus To Acquire the Ability To Use Receptor CD46 Efficiently. J. Virol.
81: 2564-2572
[Abstract]
[Full Text]
-
Yanagi, Y., Takeda, M., Ohno, S.
(2006). Measles virus: cellular receptors, tropism and pathogenesis.. J. Gen. Virol.
87: 2767-2779
[Abstract]
[Full Text]
-
Tahara, M., Takeda, M., Yanagi, Y.
(2005). Contributions of Matrix and Large Protein Genes of the Measles Virus Edmonston Strain to Growth in Cultured Cells as Revealed by Recombinant Viruses. J. Virol.
79: 15218-15225
[Abstract]
[Full Text]
-
Ohno, S., Ono, N., Takeda, M., Takeuchi, K., Yanagi, Y.
(2004). Dissection of measles virus V protein in relation to its ability to block alpha/beta interferon signal transduction. J. Gen. Virol.
85: 2991-2999
[Abstract]
[Full Text]
-
Miyajima, N., Takeda, M., Tashiro, M., Hashimoto, K., Yanagi, Y., Nagata, K., Takeuchi, K.
(2004). Cell tropism of wild-type measles virus is affected by amino acid substitutions in the P, V and M proteins, or by a truncation in the C protein. J. Gen. Virol.
85: 3001-3006
[Abstract]
[Full Text]
-
Combredet, C., Labrousse, V., Mollet, L., Lorin, C., Delebecque, F., Hurtrel, B., McClure, H., Feinberg, M. B., Brahic, M., Tangy, F.
(2003). A Molecularly Cloned Schwarz Strain of Measles Virus Vaccine Induces Strong Immune Responses in Macaques and Transgenic Mice. J. Virol.
77: 11546-11554
[Abstract]
[Full Text]
-
Nemirov, K., Lundkvist, A., Vaheri, A., Plyusnin, A.
(2003). Adaptation of Puumala Hantavirus to Cell Culture Is Associated with Point Mutations in the Coding Region of the L Segment and in the Noncoding Regions of the S Segment. J. Virol.
77: 8793-8800
[Abstract]
[Full Text]
-
Shingai, M., Ayata, M., Ishida, H., Matsunaga, I., Katayama, Y., Seya, T., Tatsuo, H., Yanagi, Y., Ogura, H.
(2003). Receptor use by vesicular stomatitis virus pseudotypes with glycoproteins of defective variants of measles virus isolated from brains of patients with subacute sclerosing panencephalitis. J. Gen. Virol.
84: 2133-2143
[Abstract]
[Full Text]
-
Masse, N., Barrett, T., Muller, C. P., Wild, T. F., Buckland, R.
(2002). Identification of a Second Major Site for CD46 Binding in the Hemagglutinin Protein from a Laboratory Strain of Measles Virus (MV): Potential Consequences for Wild-Type MV Infection. J. Virol.
76: 13034-13038
[Abstract]
[Full Text]
-
Schneider, U., von Messling, V., Devaux, P., Cattaneo, R.
(2002). Efficiency of Measles Virus Entry and Dissemination through Different Receptors. J. Virol.
76: 7460-7467
[Abstract]
[Full Text]
-
Bankamp, B., Kearney, S. P., Liu, X., Bellini, W. J., Rota, P. A.
(2002). Activity of Polymerase Proteins of Vaccine and Wild-Type Measles Virus Strains in a Minigenome Replication Assay. J. Virol.
76: 7073-7081
[Abstract]
[Full Text]
-
Woelk, C. H., Pybus, O. G., Jin, L., Brown, D. W. G., Holmes, E. C.
(2002). Increased positive selection pressure in persistent (SSPE) versus acute measles virus infections. J. Gen. Virol.
83: 1419-1430
[Abstract]
[Full Text]
-
Vincent, S., Tigaud, I., Schneider, H., Buchholz, C. J., Yanagi, Y., Gerlier, D.
(2002). Restriction of Measles Virus RNA Synthesis by a Mouse Host Cell Line: trans-Complementation by Polymerase Components or a Human Cellular Factor(s). J. Virol.
76: 6121-6130
[Abstract]
[Full Text]
-
Takeuchi, K., Takeda, M., Miyajima, N., Kobune, F., Tanabayashi, K., Tashiro, M.
(2002). Recombinant Wild-Type and Edmonston Strain Measles Viruses Bearing Heterologous H Proteins: Role of H Protein in Cell Fusion and Host Cell Specificity. J. Virol.
76: 4891-4900
[Abstract]
[Full Text]
-
Waku Kouomou, D., Wild, T. F.
(2002). Adaptation of Wild-Type Measles Virus to Tissue Culture. J. Virol.
76: 1505-1509
[Abstract]
[Full Text]
-
Nakayama, T., Komase, K., Uzuka, R., Hoshi, A., Okafuji, T.
(2001). Leucine at position 278 of the AIK-C measles virus vaccine strain fusion protein is responsible for reduced syncytium formation. J. Gen. Virol.
82: 2143-2150
[Abstract]
[Full Text]
-
Ohgimoto, S., Ohgimoto, K., Niewiesk, S., Klagge, I. M., Pfeuffer, J., Johnston, I. C. D., Schneider-Schaulies, J., Weidmann, A., ter Meulen, V., Schneider-Schaulies, S.
(2001). The haemagglutinin protein is an important determinant of measles virus tropism for dendritic cells in vitro. J. Gen. Virol.
82: 1835-1844
[Abstract]
[Full Text]
-
Parks, C. L., Lerch, R. A., Walpita, P., Wang, H.-P., Sidhu, M. S., Udem, S. A.
(2001). Comparison of Predicted Amino Acid Sequences of Measles Virus Strains in the Edmonston Vaccine Lineage. J. Virol.
75: 910-920
[Abstract]
[Full Text]
-
Parks, C. L., Lerch, R. A., Walpita, P., Wang, H.-P., Sidhu, M. S., Udem, S. A.
(2001). Analysis of the Noncoding Regions of Measles Virus Strains in the Edmonston Vaccine Lineage. J. Virol.
75: 921-933
[Abstract]
[Full Text]
-
Naniche, D., Yeh, A., Eto, D., Manchester, M., Friedman, R. M., Oldstone, M. B. A.
(2000). Evasion of Host Defenses by Measles Virus: Wild-Type Measles Virus Infection Interferes with Induction of Alpha/Beta Interferon Production. J. Virol.
74: 7478-7484
[Abstract]
[Full Text]
-
Takeda, M., Takeuchi, K., Miyajima, N., Kobune, F., Ami, Y., Nagata, N., Suzaki, Y., Nagai, Y., Tashiro, M.
(2000). Recovery of Pathogenic Measles Virus from Cloned cDNA. J. Virol.
74: 6643-6647
[Abstract]
[Full Text]
-
Hasan, M. K., Kato, A., Muranaka, M., Yamaguchi, R., Sakai, Y., Hatano, I., Tashiro, M., Nagai, Y.
(2000). Versatility of the Accessory C Proteins of Sendai Virus: Contribution to Virus Assembly as an Additional Role. J. Virol.
74: 5619-5628
[Abstract]
[Full Text]
-
Manchester, M., Eto, D. S., Valsamakis, A., Liton, P. B., Fernandez-Muñoz, R., Rota, P. A., Bellini, W. J., Forthal, D. N., Oldstone, M. B. A.
(2000). Clinical Isolates of Measles Virus Use CD46 as a Cellular Receptor. J. Virol.
74: 3967-3974
[Abstract]
[Full Text]
-
Tatsuo, H., Okuma, K., Tanaka, K., Ono, N., Minagawa, H., Takade, A., Matsuura, Y., Yanagi, Y.
(2000). Virus Entry Is a Major Determinant of Cell Tropism of Edmonston and Wild-Type Strains of Measles Virus as Revealed by Vesicular Stomatitis Virus Pseudotypes Bearing Their Envelope Proteins. J. Virol.
74: 4139-4145
[Abstract]
[Full Text]
-
Valsamakis, A., Auwaerter, P. G., Rima, B. K., Kaneshima, H., Griffin, D. E.
(1999). Altered Virulence of Vaccine Strains of Measles Virus after Prolonged Replication in Human Tissue. J. Virol.
73: 8791-8797
[Abstract]
[Full Text]
-
Johnston, I. C. D., ter Meulen, V., Schneider-Schaulies, J., Schneider-Schaulies, S.
(1999). A Recombinant Measles Vaccine Virus Expressing Wild-Type Glycoproteins: Consequences for Viral Spread and Cell Tropism. J. Virol.
73: 6903-6915
[Abstract]
[Full Text]
-
Escoffier, C., Gerlier, D.
(1999). Infection of Chicken Embryonic Fibroblasts by Measles Virus: Adaptation at the Virus Entry Level. J. Virol.
73: 5220-5224
[Abstract]
[Full Text]