Previous Article | Next Article 
Journal of Virology, November 1998, p. 8532-8540, Vol. 72, No. 11
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Specific Interaction of Heterogeneous Nuclear Ribonucleoprotein
Particle U with the Leader RNA Sequence of Vesicular Stomatitis
Virus
Ashim K.
Gupta,1
Judith A.
Drazba,2 and
Amiya K.
Banerjee1,*
Departments of Molecular
Biology1 and
Neurosciences,2 The Lerner Research
Institute, The Cleveland Clinic Foundation, Cleveland, Ohio 44195
Received 8 April 1998/Accepted 6 July 1998
 |
ABSTRACT |
The 3' ends of the genome and antigenome RNA of vesicular
stomatitis virus (VSV) serve as the promoter sites for the
RNA-dependent RNA polymerase in the initiation of transcription and
replication, respectively. The leader RNA, the first transcript
synthesized during the RNA synthetic step, contains sequences to
initiate encapsidation with the nucleocapsid protein, which is a
prerequisite for replication. It also plays a role in the inhibition of
cellular RNA synthesis. To search for a specific cellular factor(s)
which may interact with the leader RNA sequences and regulate these processes, we used a gel mobility shift assay to identify such a
protein(s). By using nuclear extract, it was found that in addition to
the previously reported La protein, a 120-kDa nuclear protein specifically interacts with the leader RNA. Biochemical and
immunological studies identified the 120-kDa protein as heterogeneous
nuclear ribonucleoprotein particle U (hnRNP U), which is involved in
pre-mRNA processing. We also demonstrate that hnRNP U is associated
with the leader RNA in the nuclei of VSV-infected cells and also
packaged within the purified virions. By double immunofluorescence
labeling and confocal microscopy, hnRNP U appears to colocalize with
the virus in the cytoplasm of infected cells. These results strongly suggest that hnRNP U plays an important role in the life cycle of VSV.
 |
INTRODUCTION |
When a virus infects a cell, one of
the hallmarks of the process is the recruitment by the virus of
specific cellular proteins for its replicative advantage. Viruses
interact with such cellular proteins primarily to aid their own
multiplication. Viruses also shut off cellular functions by
sequestering or inhibiting synthesis of vital cellular proteins for
their own replicative advantage. Vesicular stomatitis virus (VSV), a
prototype rhabdovirus, is a paradigm for studying such host-virus
interactions. VSV contains a negative-strand RNA genome 11,161 nucleotides (nt) long which, when transcribed by a virion-associated
RNA polymerase, synthesizes in vitro or in vivo five monocistronic
messages in the following order: 3' nucleocapsid protein (N),
phosphoprotein (P), glycoprotein (G), matrix protein (M), and the RNA
polymerase (L) 5' (1). The RNA-dependent RNA polymerase
consists of two subunits, L and P. It first synthesizes a 47-nucleotide
leader RNA and then sequentially synthesizes five mRNAs that are capped
and polyadenylated (1, 2). During replication, however, the
RNA polymerase first synthesizes the full-length plus-sense antigenome
which is enwrapped with the N protein, forming the N-RNA complex; this
complex then serves as the template for the synthesis of the
negative-sense progeny genome RNA (1, 2). It is envisaged
that the N protein complexes with the nascent leader RNA transcript to
initiate encapsidation (1, 3-5, 12) of the growing RNA
chains, leading to the replicative reaction. It still remains unclear
how the RNA polymerase switches its transcription mode and enters the
replicative mode. Several recent studies suggest that the L protein may
associate with the N-P complex, a prerequisite entity for the
replicative event, and the resulting tripartite complex along with a
specific host protein(s) may initiate the replicative reaction on the
N-RNA template (6, 13).
It is generally believed that the 3'-terminal RNA sequence of the
genome RNA is the binding site of the VSV RNA polymerase (2, 14,
15) to initiate transcription. Thus, the 3'-terminal domain of
the genome RNA and its complement (leader-sense [LS]) RNA are the two
important cis-acting RNA sequences that are potential targets for cellular proteins to bind and promote the functions of the
transcriptase and the replicase, respectively. Keene et al. (18,
19, 25) have shown previously that both plus-strand and
minus-strand leader RNA (the complement of the 3'-terminal sequence of
the plus-strand genome RNA) interact specifically with the nuclear
autoantigen, La protein, in infected-cell cytoplasm, raising the
possibility that this interaction may have some specific role in the
replicative pathway of the virus. Moreover, in view of the similarity
in the sequences of RNA polymerase III products and the 3' end of the
leader RNA, it seems that the interaction of La protein with the leader
RNA may be mediated by a sequence motif which regulates VSV
transcription and replication. In a separate series of studies, the
leader RNA of VSV was implicated in inhibiting cellular RNA synthesis
by its transient localization inside the nucleus following infection
(19, 24), suggesting that it may interact with specific
nuclear proteins involved in RNA synthesis. To test that directly,
McGowan et al. (20), using a soluble cell extract as the
source of the RNA polymerase, showed that purified leader RNA indeed
inhibits DNA-dependent transcription of adenovirus and simian virus 40 genes in vitro. Since leader RNA specifically interacts with the
nuclear autoantigen La, the possibility that this interaction may have
some role in the inhibition of RNA polymerase II activity exists,
although such interaction within the nucleus has not yet been reported.
So far, no other cellular proteins involved in transcription or
posttranscription steps of mRNA synthesis have been shown to interact
with the VSV leader RNA.
In the present study, we searched for an additional cellular factor(s)
which specifically interacts with VSV leader RNA sequences. Using a gel
mobility shift assay with nuclear extract, we showed that in addition
to La protein, a nuclear protein, heterogeneous nuclear
ribonucleoprotein particle U (hnRNP U), specifically binds to the VSV
leader RNA both in vitro and in vivo. Moreover, colocalization of hnRNP
U with VSV in the infected-cell cytoplasm, coupled with its packaging
within the purified virions, raises an interesting possibility of its
direct involvement in the life cycle of VSV and in virus-induced
pathogenesis.
 |
MATERIALS AND METHODS |
Materials.
All enzymes and biochemicals were obtained either
from Boehringer Mannheim or from Sigma. Radionucleotides were purchased from Amersham. Tissue culture reagents and media were obtained from
Life Technologies, Inc.
Cell cultures and virus.
HeLa cells were grown in Eagle's
minimal medium containing 5% fetal calf serum. VSV, Indiana serotype,
Mudd Summers strain, was used for infecting the cells.
Cloning of the LS RNA construct and in vitro transcription.
The LS RNA construct was made in the pUC19 vector, which contains the
oligodeoxynucleotides corresponding to the first 60 nt from the 5' end
of plus-sense RNA, under the control of T7 RNA polymerase. The
construct was made essentially by reverse transcriptase-PCR
amplification of the genome RNA isolated from purified virions of VSV,
Indiana serotype. The primer used for the reverse transcriptase
reaction for making LS RNA was
5'CCGGAATTCTAATACGACTCACTATAGGACGAAGACAAACCCATTA3', which in
addition to viral sequences contains an EcoRI site and T7
RNA polymerase promoter sequences. PCR amplification was carried out
with the addition of a second primer,
5'TGCACTGCAGATTACTGTTAAAGTTTCTCC3', which contains a
PstI site. Digestion of the recombinant pUC19 vector with
PstI followed by a Klenow reaction in the absence of
deoxynucleotides would generate the exact 3' end for LS RNA synthesized
by T7 RNA polymerase. In vitro transcription reaction was carried out
with T7 RNA polymerase and [
-32P]UTP according to the
manufacturer's protocol (Boehringer Mannheim). The radiolabeled RNA
was analyzed in a 10% polyacrylamide-urea gel, and the RNA band was
excised and eluted in a buffer containing 0.5 M ammonium acetate, 1 mM
EDTA, and 0.1% sodium dodecyl sulfate (SDS) and purified by
phenol-chloroform extraction followed by ethanol precipitation.
Gel mobility shift assay.
The binding of radiolabeled leader
RNA with the cellular proteins was carried out in a 20-µl binding
buffer containing 15 mM HEPES (pH 7.5), 15 mM KCl, 0.25 mM EDTA, 0.25 mM dithiothreitol, 5 mM MgCl2, 1 mM phenylmethylsulfonyl
fluoride, 200 µg of yeast tRNA per ml, 10% glycerol, 0.1 ng of
labeled RNA, and, unless otherwise mentioned, cell extract containing
2.5 µg of protein. Incubations were done at room temperature for 30 min, and the samples were analyzed in a 5% native polyacrylamide gel.
The gels were run at 130 V, dried, and subjected to autoradiography
(7).
UV cross-linking.
Binding of the radiolabeled RNA with the
cellular proteins was carried out in binding buffer at room temperature
for 30 min. The reaction mixtures were then exposed to short-wavelength
UV light at a 4-cm distance for 1 h in ice. The UV-cross-linked
mixture was then treated with RNase A (0.1 µg) for 15 min at 37°C.
Samples were run in a 10% SDS-polyacrylamide gel, followed by
staining, drying, and autoradiography.
Immunoprecipitation of VSV RNAs.
In vitro, radiolabeled LS
RNA was allowed to bind with either nuclear extract from HeLa cells or
the bacterially expressed hnRNP U (U protein). Monoclonal antibody to U
protein (3G6) was then added to the reaction mixture and incubated for
30 min followed by protein A-Sepharose binding. Immunoprecipitates were
washed in HEPES buffer (pH 7.5) containing 0.1% Nonidet P-40 and 250 mM NaCl, followed by suspension in 100 µl of Tris-EDTA buffer (pH
8.0), phenol-chloroform extraction, and ethanol precipitation. Products
were analyzed in a urea-10% polyacrylamide gel and subjected to
autoradiography. Nucleoplasm from VSV-infected HeLa cells was isolated
according to the method of Pinol-Roma et al. (22). Immunoprecipitation of U-protein-bound nucleic acid was carried out
with the 3G6 monoclonal antibody. Immunoprecipitates were then washed
and purified as described above. The immunoprecipitated RNAs were
annealed with radiolabeled LS RNA complementary probe and subjected to
RNase T2 digestion followed by phenol-chloroform extraction and ethanol
precipitation. The RNA samples were run in a urea-10% polyacrylamide
gel followed by autoradiography.
Immunofluorescent labeling.
HeLa cells were grown on
coverslips and infected with VSV at 10 PFU/cell. At various times
postinfection, the cells were washed with phosphate-buffered saline
followed by fixation with 3.6% paraformaldehyde and permeabilization
with 1% Triton X-100. The cells were then incubated with anti-VSV P
protein (rabbit polyclonal) and monoclonal antibody to hnRNP U, either
separately or together. For labeling, the coverslips were washed and
incubated with rhodamine-conjugated anti-rabbit immunoglobulin G (IgG)
and fluorescein isothiocyanate (FITC)-tagged anti-mouse IgG secondary
antibodies for virus and hnRNP U, respectively. For double staining,
both the secondary antibodies were added together. The coverslips were
finally washed, mounted, and then examined with a Leica confocal laser
scanning microscope.
 |
RESULTS |
Interaction of cellular proteins with VSV LS RNA.
To identify
the cellular proteins that bind to VSV LS RNA, we inserted the cDNA
copies of the first 60 nt complementary to the 3' end of the genome RNA
(LS RNA) (Fig. 1A) in a pUC19 vector along with a T7 RNA polymerase promoter sequence, as described in
Materials and Methods. It is important to note that two nonviral 5' G
residues shown in a box are incorporated in the LS RNA during transcription from the T7 promoter. Thus, the LS RNA (Fig. 1A) includes
sequences for a nucleation site(s) for binding of N protein at its 5'
end. In addition, the LS RNA includes the intergenic sequence between
the leader RNA and the start site of the N gene spanning 13 nt. The
latter sequence may interact with presumptive viral and cellular
proteins required for replication.

View larger version (4K):
[in this window]
[in a new window]

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 1.
Binding of nuclear proteins to LS RNA of VSV. (A) The
sequence of LS RNA is shown. The two Gs shown in the box represent the
nonviral sequence present at the 5' end of the T7 transcript. The arrow
in the sequence denotes the 47th nucleotide position from the 5' end,
which is the exact size of the LS RNA. (B) Radiolabeled LS RNA was used
in a gel mobility shift assay with (lane 2) and without (lane 1) the
nuclear extract of HeLa cells. I and II are the two LS RNA-protein
complexes. (C) UV cross-linking of LS RNA was carried out with
semipurified nuclear extract. Lane 1, probe alone; lanes 2 and 3, UV-cross-linked products, respectively, of complex I- and II-forming
fractions. UV cross-linking was followed by RNase digestion. Numbers on
the right indicate the migration positions of standard molecular weight
markers (weights are in thousands).
|
|
A T7 RNA polymerase-transcribed,
32P-labeled LS RNA probe
was used in a gel mobility shift assay following incubation with HeLa
cell nuclear extracts. As shown in Fig.
1B, LS RNA formed two
distinct
and identifiable complexes (I and II) when incubated
with the nuclear
extract. These two bands were not present when
cytoplasmic extract was
used; instead, a new band whose identity
has not been confirmed
appeared (data not shown). In UV cross-linking
experiments, the nuclear
proteins associated with complexes I
and II migrated in
SDS-polyacrylamide gel electrophoresis consistent
with molecular
weights of 50,000 and 120,000, respectively. The
characterization of
the protein associated with complexes I and
II is described below.
Analysis of the nuclear protein present in complex I.
The
nuclear protein complexed with leader RNA in complex I appeared to be a
50-kDa protein as shown by UV cross-linking (Fig. 1C). Based on the
fact that the La protein, also a 50-kDa protein, has previously been
shown to interact specifically with VSV leader RNA (18), we
used bacterially expressed La protein to establish the identity of the
protein present in complex I. The La protein expressed in
Escherichia coli and subsequently purified was mixed with
32P-labeled VSV leader RNA, and the complex was analyzed in
a gel mobility shift assay, as described in the legend to Fig. 1B. A distinct RNA-La complex migrated in the same position as complex I
(Fig. 1B) in the gel mobility shift assay and when cross-linked by UV
irradiation (Fig. 2A and B). Furthermore,
immunoprecipitation of complex I with anti-La antibody resulted in the
recovery of the 32P LS RNA (Fig. 2C, lane 3). No
32P LS RNA was precipitated when the probe was treated only
with anti-La antibody and protein A-Sepharose as a control (Fig. 2C, lane 2). These results strongly suggest that the protein present in
complex I is indeed the autoantigen La and confirm the previous observations made by Kurilla and Keene (18).

View larger version (77K):
[in this window]
[in a new window]
|
FIG. 2.
Binding of bacterially expressed La protein to LS RNA.
Bacterially expressed La protein was incubated with the radiolabeled LS
RNA, as described in Materials and Methods. (A) Gel mobility shift
assays were done with (lane 2) and without (lane 1) the La protein. (B)
UV cross-linking of the bacterially expressed La protein to LS RNA was
followed by RNase I digestion. Lane 1, probe alone; lane 2, probe with
La protein. Numbers on the right indicate the migration positions of
molecular weight markers (numbers are in thousands). (C)
Immunoprecipitation of LS RNA by anti-La antibody after incubation with
(lane 3) or without (lane 2) La protein. Lane 1, LS RNA alone without
binding and immunoprecipitation.
|
|
Analysis of the nuclear protein present in complex II.
In UV
cross-linking experiments, the protein present in complex II was
determined to have a molecular weight of 120,000 (Fig. 1C). The first
step in characterizing the protein was to carry out a computer search
for the RNA binding proteins from the protein data bank to obtain
information on its estimated molecular weight and localization in the
nucleus. This search yielded two proteins, namely, hnRNP U and
nucleolin. Nucleolin was eliminated because antibody against nucleolin
failed to immunoprecipitate LS RNA from complex II (data not shown). To
test whether hnRNP U was the observed 120-kDa RNA binding protein, we
first carried out competition experiments with ribonucleotide
homopolymers to determine whether their properties matched the
characteristic properties of hnRNP U. As shown in Fig.
3, poly(A) had no effect even in a
500-fold molar excess, whereas poly(U) in a 500-fold molar excess reduced the binding of 120-kDa protein to LS RNA by 80%. However, poly(G) competed out almost completely the binding of the 120-kDa protein to LS RNA even in a 250-fold molar excess. These findings are
consistent with the known properties of hnRNP U observed previously (16, 17). As expected, in a control experiment, T7 RNA
polymerase-transcribed, unlabeled LS RNA completely competed out the
binding of this RNA to the protein. As shown in Fig. 3B, a heterologous
RNA transcribed from the pGEM4A vector failed to compete with the
binding of the 120-kDa protein with LS RNA, indicating specificity of
this interaction.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 3.
Interaction of the 120-kDa protein by competition with
different ribonucleotide homopolymer competitors and homologous and
heterologous RNA probes. Binding of the 120-kDa protein to LS RNA in
the presence of competitors was assayed by UV cross-linking followed by
polyacrylamide gel electrophoresis. (A) The ribonucleotide homopolymer
competitor used is shown at the top of each lane. The number at the top
of each lane corresponds to the molar excess (fold) of competitor used
in the reaction. (B) The number at the top of each lane corresponds to
the molar excess (fold) of heterologous RNA (HL RNA) competitor used.
Heterologous RNA was synthesized by T7 RNA polymerase from an
EcoRI-digested pGEM4Z-vector DNA. In panels A and B, numbers
on the sides denote the positions of migration of molecular weight
markers (weights are in thousands). Lane 1, control (probe alone); lane
2, probe cross-linked with the 120-kDa protein in the absence of any
competitor.
|
|
To confirm more definitively the identity of the 120-kDa protein, a
cDNA clone of hnRNP U was expressed in
E. coli, and the
recombinant hnRNP U protein was tested for its ability to bind
the LS
RNA probe. As shown in Fig.
4A,
bacterially expressed hnRNP
U protein had a gel mobility shift pattern
identical to that of
the LS RNA bound to the 120-kDa protein from
nuclear extract.
Furthermore, this RNA-protein complex
immunoprecipitated the bound
leader RNA when a monoclonal antibody
(3G6) raised against hnRNP
U protein was used (
10,
16). As
shown in Fig.
4B, radiolabeled
LS RNA was effectively
immunoprecipitated when incubated in vitro
either with nuclear extract
(lane 3) or with recombinant hnRNP
U (lane 5). No LS RNA was recovered
in the control lanes where
nuclear extract or antibody was omitted
(lanes 2 and 4, respectively).
Since hnRNP U protein is also known as a
scaffold attachment factor
A which binds to the
scaffold-attachment-region element of genomic
DNAs for its bending
(
11,
23), we investigated the competition
of binding of
hnRNP U protein to LS RNA with the MII fragment
of the human
topoisomerase I gene containing the specific DNA
sequences which bind
to scaffold attachment factor A. In a Northwestern
blot experiment with
purified HeLa nuclear extract, the binding
of the 120-kDa protein to
the LS RNA was competed out to about
80% when unlabeled MII DNA was
added along with the probe in an
80-fold molar excess (data not shown).
These results further established
that the 120-kDa protein in the
nuclear extract of HeLa cells
is indeed hnRNP U.

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 4.
Characterization of the 120-kDa protein. (A) LS RNA was
incubated without (lane 1) or with (lanes 2 to 5) total nuclear extract
made from HeLa cells, or with bacterially expressed recombinant hnRNP U
protein (lanes 6 to 9), and subjected to a gel retardation assay. The
concentrations of the nuclear extract used were 0.2, 0.4, 0.8, and 1.6 µg for lanes 2, 3, 4, and 5, respectively. The concentrations of
recombinant hnRNP U were 25, 50, 100, and 200 ng, respectively for
lanes 6, 7, 8, and 9. The arrow indicates the position of the complex
formed by the 120-kDa protein. (B) Immunoprecipitation of the LS RNA
with monoclonal antibody of hnRNP U (3G6) was done as described in
Materials and Methods. NE, nuclear extract; Pr.A, protein
A-Sepharose.
|
|
Association of hnRNP U with leader RNA in nuclei of VSV-infected
cells.
Since it has been shown that following VSV infection leader
RNA transiently enters the nucleus (19), we investigated
whether hnRNP U also binds to LS RNA in the nuclei of VSV-infected
cells. Monoclonal antibody to hnRNP U protein (3G6) was used to
immunoprecipitate the nucleic acid bound to hnRNP U protein in the
nuclear extract prepared from VSV-infected cells. Immunoprecipitates
were then subjected to RNase protection assay with radiolabeled LS RNA
complement as the probe. It can be seen in Fig.
5 that only in the immune complex
isolated from VSV-infected nuclear extract (lane 5) was a 47-nt-long
RNA fragment protected by the LS RNA complementary probe. We conclude
from this experiment that (i) the hnRNP U-associated RNA within the
nucleus of the cell is VSV specific and (ii) since the protected length
of the RNA species is 47 nt and not 60 nt (the length of the LS RNA
probe used), the LS RNA seems to be degraded to 47 nt. This result
prompted us to determine whether the 47-nt-long leader RNA synthesized
in vitro is sufficient to form a complex with hnRNP U. In addition, we
carried out deletion analyses to determine which part of the LS RNA
binds to the hnRNP U protein. Figure 6A
shows the sequences of LS RNA and the deletion mutants used in our
studies. It is apparent from Fig. 6B that bacterially expressed hnRNP U
protein bound as effectively to LS 3'
13 RNA, which is the authentic
47-nt-long leader RNA, as the 60-nt-long LS RNA. Deletion of an
additional 11 nt from the 3' end of the leader RNA did not affect the
binding efficiency. However, deletion of 15 nt from the 5' end of LS
RNA markedly decreased the efficiency of binding to the hnRNP U
protein. Taken together, these results demonstrate that 47-nt-long
leader RNA is sufficient to bind to hnRNP U and that the sequences at
the 5' end of the leader RNA are crucial for binding to the protein.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 5.
Association of hnRNP U with leader RNA in the nuclei of
VSV-infected cells. Nucleoplasm from the VSV-infected HeLa cells was
isolated 3 h postinfection. Monoclonal antibody against hnRNP U
protein (3G6) was used to immunoprecipitate the protein-bound nucleic
acids. Radiolabeled complement of LS RNA was used for RNase protection
as described in Materials and Methods. NE, nuclear extract. Arrows
denote the positions of 60- and 47-nt-long RNAs.
|
|

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 6.
Determination of the region of hnRNP U binding to LS
RNA. (A) The sequences of the wild-type LS RNA (LSwt) and the deletion
mutants derived from it are shown. The two Gs present in a box at the
5' end of each RNA sequence represent the nonviral sequence derived
from T7 transcription. (B) The wild type and each deletion mutant were
used for gel retardation either alone or with mock bacterial extract or
extract expressing hnRNP U protein. Probes: lanes 1, wild type; lanes
2, 3' 24; lanes 3, 3' 13; lanes 4, 5' 15; and lanes 5, 5' 30.
|
|
Intracellular distribution of hnRNP U and VSV RNP.
We used
indirect double immunofluorescence labeling and confocal microscopy to
study colocalization, if any, of hnRNP U with the viral RNP in the
infected cells. As described in detail in Materials and Methods, HeLa
cells were infected with VSV on coverslips. At different times
postinfection, the fixed cells were immunostained either singly or
doubly with FITC-conjugated secondary antibody for hnRNP U and/or
rhodamine-conjugated secondary antibody for VSV P protein.
Colocalization of virus and hnRNP U was examined by confocal
microscopy. As shown in Fig. 7A, hnRNP U
is exclusively localized in the nucleus of uninfected cells. However,
at 1.5 h postinfection, a small but distinct staining of hnRNP U
was evidence in the cytoplasm (Fig. 7D) and, with double staining (Fig.
7F), there was the appearance of yellow color, signifying colocalization. At 3 h postinfection, increased staining of hnRNP U was observed in the cytoplasm with a concomitant increase in yellow
color (Fig. 7G and I). Finally, at 6 h postinfection, a distinct
green halo was seen surrounding the nucleus, suggesting further
accumulation of hnRNP U in the cytoplasm (Fig. 7J). The strong yellow
color followed the same pattern as that observed for virus and hnRNP U
individually (Fig. 7J through L). It is important to note that at
6 h postinfection several uninfected cells did not release hnRNP U
in the cytoplasm, suggesting that a distinct and discernible amount of
hnRNP U either is retained in the cytoplasm following its synthesis or
extrudes from the nucleus following VSV infection. Most importantly,
the virus particles appear to remain always associated with hnRNP U in
the cytoplasm.

View larger version (99K):
[in this window]
[in a new window]
|
FIG. 7.
Intracellular distribution of hnRNP U and viral RNP.
HeLa cells were infected with VSV at 10 PFU/cell. At 1.5 h (D
through F), 3 h (G through I), and 6 h (J through L)
postinfection, cells were fixed and permeabilized as described in
Materials and Methods. Coverslips were treated with anti-VSV-P
polyclonal antibody and anti-hnRNP U monoclonal antibody, either
separately or together. As a secondary antibody, FITC-conjugated
anti-mouse antibodies (for hnRNP U) or rhodamine-conjugated anti-rabbit
antibodies (for VSV-P protein) were used. (A) Uninfected cells treated
with 3G6 antibody and FITC-tagged secondary antibody; (B) infected
cells treated with anti-P antibody and rhodamine-conjugated secondary
antibody; (C) uninfected cells treated with anti-P antibody followed by
addition of secondary antibody for P protein and hnRNP U protein; (D to
L) infected cells treated with both anti-P and anti-hnRNP U antibody
followed by FITC- and rhodamine-tagged secondary antibody,
respectively. A, D, G, and J show hnRNP U staining, and B, E, H, and K
show virus staining. C, F, I, and L show colocalization of virus and
hnRNP U staining.
|
|
Finally, we wanted to study whether such an interaction between hnRNP U
and virus particles leads to packaging of hnRNP U
in the mature
virions. Figure
8 shows the results of
Western blot
analysis of purified RNP: hnRNP U was clearly discernible
when
blotted against 3G6 monoclonal antibody, indicating that hnRNP
U
interacts and remains associated with the RNP during the virus's
replicative cycle.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 8.
Western blot analysis of hnRNP U in purified virions.
Total HeLa cell nuclear extract and purified virions of VSV (50 µg)
were run in an SDS-10% polyacrylamide gel and transferred onto
nitrocellulose membrane. The blot was developed with monoclonal
antibody against hnRNP U followed by peroxidase-conjugated goat
anti-mouse IgG. The antigen-antibody complex was detected by ECL
reagent (Amersham Corp.). The numbers at the left denote the migration
positions of molecular weight markers (weights are in thousands).
|
|
 |
DISCUSSION |
Leader RNA, the RNA product synthesized during initial
transcription of VSV genome RNA, plays an important role in vivo in the
synthesis of the full-length positive-strand genome RNA by providing
the necessary cis-regulatory sequences for signaling encapsidation with the N protein (1). In addition, leader
RNA appears to have a role in the inhibition of cellular RNA synthesis by its entry into the nucleus (19) and subsequent
downregulation of polymerase II activity. To gain insight into these
presumed activities of the leader RNA and the possible involvement of
host proteins in these processes, we wanted to study the specific
interactions, if any, of the cytoplasmic and nuclear proteins with the
leader RNA.
By using a gel mobility shift assay with cell extracts, we were able to
detect specific binding of host proteins with the leader RNA. One of
the proteins was characterized as an autoantigen, La protein, which
bound to both cytoplasmic extracts (data not shown) and nuclear
extracts (Fig. 1 and 2). La protein was previously shown to bind with
similar cis-acting RNA sequences of human parainfluenza virus type 3 (7), suggesting that both viruses contain
common RNA sequences or structures at the 3' end of the genome RNA and its complement which mediate specific binding with the La protein. The
La protein was previously shown to bind leader RNA in VSV-infected cells (18). Based on the observation that leader RNA enters the nucleus during the early phase of infection (19), it was suggested that leader RNA may interact with the La protein, a protein
associated with RNA-synthetic machinery in the nucleus, and may have a
negative effect on cellular RNA synthesis (18, 19). It is
important to note that the La protein also binds specifically to the 5'
untranslated region of poliovirus to regulate RNA translation
(21). Thus, it seems that La protein may have pleotropic
functions in the life cycle of certain RNA viruses.
In the present study, we have characterized an additional unique
protein, identified as hnRNP U, which specifically bound to the leader
RNA of VSV, both in vitro and in vivo (Fig. 3B and 5). Initial
characterization of this protein was done by computer search based on
its molecular weight (120,000), nuclear localization, and competition
with oligonucleotides. This protein was precisely identified by its
binding to bacterially expressed hnRNP U protein and
immunoprecipitation of bound RNA with a monoclonal antibody specific
for hnRNP U (Fig. 4). Competition of this binding with a specific
cellular substrate, the MII fragment of the human topoisomerase I gene,
further confirmed its identity (data not shown). Remarkably, LS RNA is
competed out by poly(G) most efficiently, although LS RNA is rich in A
and U (Fig. 3). This observation is similar to that previously reported
regarding the binding of hnRNP U to ribohomopolymers (16,
17). Since the binding motif of hnRNP U is not known, it appears
that it recognizes a domain within the secondary structure of the
cis-acting RNAs rather than its sequences. This observation was further confirmed by mutational analysis, in which deletion of 15 nucleotides from the 5' end of LS RNA (67% A content) reduced binding
by 90% (Fig. 6A), although poly(A) by itself failed to compete binding
of LS RNA to hnRNP U (Fig. 3). Further studies are needed to determine
the precise structural motif in LS RNA needed for hnRNP U binding.
hnRNP U is an abundant nucleoplasmic phosphoprotein, the largest of the
major hnRNP proteins (16, 17) in eucaryotic cells. These
molecules have been shown to associate with nascent RNA polymerase II
transcripts in the nucleoplasm to form hnRNP complexes which are
implicated in pre-mRNA processing (8, 9, 16). The finding
that leader RNA can be immunoprecipitated from the nuclei of
VSV-infected cells with the monoclonal antibody against the hnRNP U
protein (Fig. 5) indicates that upon infection with VSV, LS RNA could
be a natural substrate for hnRNP U and may have some role in disrupting
the machinery of cellular RNA synthesis, as postulated previously
(18-20).
Indirect double immunofluorescence labeling and confocal microscopic
analyses provided evidence for the localization of both hnRNP U and
viral RNP during infection (Fig. 7). It is apparent from these studies
that hnRNP U, which is predominantly a resident protein in the nucleus,
diffuses out in the cytoplasm following VSV infection and colocalizes
with VSV RNP in the same region. These results can be interpreted to
suggest that VSV either blocks the entry of newly synthesized hnRNP U
into the nucleus or facilitates its exit from the nucleus. At present,
it is not clear which event is actually facilitated by VSV. Whatever
the role of VSV in this process, the immunofluorescence studies
strongly suggest that hnRNP U and VSV RNP colocalize in the cytoplasm.
Coupled with the finding that hnRNP U is also packaged within the
virions (Fig. 8), this strongly suggests that hnRNP U plays an
important role in the life cycle of VSV. It is tempting to speculate
that leader RNA, by its binding to hnRNP U, may be involved in
VSV-mediated shutoff of host DNA and RNA metabolism. To the virus's
advantage, the binding of hnRNP U to leader RNA, possibly in
association with the La protein, may cause structural alteration of the
leader-N junction, enabling the RNA polymerase to read through the
junction region and leading to the synthesis of the full-length
antigenome. Future experiments along these lines would certainly shed
light on the role of hnRNP U in the gene expression of VSV.
 |
ACKNOWLEDGMENTS |
We thank Jack D. Keene for kindly providing anti-La antibody and
La protein-expressing vector; Marion Schmidt-Zachmann, German Cancer
Research Center, Heidelberg, Germany, for antinucleolin antibody;
Gideon Dreyfuss, University of Pennsylvania School of Medicine, for
anti-hnRNP U monoclonal antibody and clone of hnRNP U protein; and
Frank O. Fackelmayer, University of Konstanz, Konstanz, Germany, for
the MII DNA.
This work was supported in part by an NIH grant (AI-26585) to A.K.B.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Biology, The Lerner Research Institute, The Cleveland Clinic Foundation, 9500 Euclid Ave., NC20, Cleveland, OH 44195. Phone: (216)
444-0625. Fax: (216) 444-0512. E-mail:
banerja{at}cesmtp.ccf.org.
 |
REFERENCES |
| 1.
|
Banerjee, A. K.
1987.
Transcription and replication of rhabdoviruses.
Microbiol. Rev.
51:66-87[Free Full Text].
|
| 2.
|
Banerjee, A. K.,
G. Abraham, and R. J. Colonno.
1977.
Vesicular stomatitis virus: mode of transcription.
J. Gen. Virol.
34:1-8[Abstract/Free Full Text].
|
| 3.
|
Blumberg, B. M.,
C. Giorgi, and D. Kolakofsky.
1983.
N protein of vesicular stomatitis virus selectively encapsidates leader RNA in vitro.
Cell
32:559-567[Medline].
|
| 4.
|
Blumberg, B. M.,
C. Giorgi,
K. Rose, and D. Kolakofsky.
1984.
Preparation and analysis of the nucleocapsid proteins of vesicular stomatitis virus and Sendai virus, and analysis of the sendai virus leader-NP gene region.
J. Gen. Virol.
65:769-779[Abstract/Free Full Text].
|
| 5.
|
Blumberg, B. M.,
M. Leppert, and D. Kolakofsky.
1981.
Interaction of VSV leader RNA and nucleocapsid protein may control VSV genome replication.
Cell
23:837-845[Medline].
|
| 6.
|
Das, T.,
A. K. Pattnaik,
A. M. Takacs,
T. Li,
L. N. Hwang, and A. K. Banerjee.
1997.
Basic amino acid residues at the carboxy terminal eleven amino acid region of the phosphoprotein are required for transcription but not for replication of vesicular stomatitis virus genome RNA.
Virology
238:103-114[Medline].
|
| 7.
|
De, B. P.,
S. Gupta,
H. Zhao,
J. A. Drazba, and A. K. Banerjee.
1996.
Specific interaction in vitro and in vivo of glyceraldehyde-3-phosphate dehydrogenase and La protein with cis-acting RNAs of human parainfluenza virus type 3.
J. Biol. Chem.
271:24728-24735[Abstract/Free Full Text].
|
| 8.
|
Dreyfuss, G.
1986.
Structure and function of nuclear and cytoplasmic ribonucleoprotein particles.
Annu. Rev. Cell Biol.
2:459-498.
|
| 9.
|
Dreyfuss, G.,
M. S. Swanson, and S. Pinol-Roma.
1988.
Heterogeneous nuclear ribonucleoprotein particles and the pathway of mRNA formation.
Trends Biochem. Sci.
13:86-91[Medline].
|
| 10.
|
Dreyfuss, G.,
Y. D. Choi, and S. A. Adam.
1984.
Characterization of heterogeneous nuclear RNA-protein complexes in vivo with monoclonal antibodies.
Mol. Cell. Biol.
4:1104-1114[Abstract/Free Full Text].
|
| 11.
|
Fackelmayer, F. O.,
K. Dahm,
A. Renz,
U. Ramsperger, and A. Richter.
1994.
Nucleic-acid-binding properties of hnRNP U/SAF-A, a nuclear-matrix protein which binds DNA and RNA in vivo and in vitro.
Eur. J. Biochem.
221:749-757[Medline].
|
| 12.
|
Giorgi, C.,
B. Blumberg, and D. Kolakofsky.
1983.
Sequence determination of the (+) leader RNA regions of the vesicular stomatitis virus Chandipura, Cocal, and Piry serotype genomes.
J. Virol.
46:125-130[Abstract/Free Full Text].
|
| 13.
|
Gupta, A. K., and A. K. Banerjee.
1997.
Expression and purification of vesicular stomatitis virus N-P complex from Escherichia coli: role in genome RNA transcription and replication in vitro.
J. Virol.
71:4264-4271[Abstract].
|
| 14.
|
Isaac, C. L., and J. D. Keene.
1982.
RNA polymerase-associated interactions near template promoter sequences of defective interfering particles of vesicular stomatitis virus.
J. Virol.
43:241-249[Abstract/Free Full Text].
|
| 15.
|
Keen, J. D.,
B. J. Thornton, and S. U. Emerson.
1981.
Sequence specific contacts between the RNA polymerase of vesicular stomatitis virus and the leader RNA gene.
Proc. Natl. Acad. Sci. USA
78:6191-6195[Abstract/Free Full Text].
|
| 16.
|
Kiledjian, M., and G. Dreyfuss.
1992.
Primary structure and binding activity of the hnRNP U protein: binding RNA through RGG box.
EMBO J.
11:2655-2664[Medline].
|
| 17.
|
Kries, J. P.,
F. Buck, and W. H. Stratling.
1994.
Chicken MAR binding protein p120 is identical to human heterogeneous nuclear ribonucleoprotein (hnRNP) U.
Nucleic Acids Res.
22:1215-1220[Abstract/Free Full Text].
|
| 18.
|
Kurilla, M., and J. D. Keene.
1983.
The leader RNA of vesicular stomatitis virus is bound by a cellular protein reactive with anti-La lupus antibodies.
Cell
34:837-845[Medline].
|
| 19.
|
Kurilla, M. G.,
H. Piwnica-Worms, and J. Keene.
1982.
Rapid and transient localization of the leader RNA of vesicular stomatitis virus in the nuclei of infected cells.
Proc. Natl. Acad. Sci. USA
79:5240-5244[Abstract/Free Full Text].
|
| 20.
|
McGowan, J. J.,
S. U. Emerson, and R. R. Wagner.
1982.
The plus-strand leader RNA of VSV inhibits DNA-dependent transcription of adenovirus and SV40 genes in a soluble whole cell extract.
Cell
28:325-333[Medline].
|
| 21.
|
Meerovitch, K.,
Y. V. Svitkin,
H. S. Lee,
F. Lejbkowicz,
D. J. Kenan,
E. K. L. Chan,
V. I. Agol,
J. D. Keene, and N. Sonenberg.
1993.
La autoantigen enhances and corrects aberrant translation of poliovirus RNA in reticulocyte lysate.
J. Virol.
67:3798-3807[Abstract/Free Full Text].
|
| 22.
|
Pinol-Roma, S.,
Y. D. Choi, and G. Dreyfuss.
1990.
Immunological methods for purification and characterization of heterogenous nuclear ribonucleoprotein particles.
Methods Enzymol.
181:317-325[Medline].
|
| 23.
|
Romig, H.,
F. O. Fackelmayer,
A. Renz,
U. Ramsperger, and A. Richter.
1992.
Characterization of SAF-A, a novel nuclear DNA binding protein from HeLa cells with high affinity for nuclear matrix/scaffold attachment DNA elements.
EMBO J.
11:3431-3440[Medline].
|
| 24.
|
Weck, P. K., and R. R. Wagner.
1978.
Inhibition of RNA synthesis in mouse myeloma cells infected with vesicular stomatitis virus.
J. Virol.
25:770-780[Abstract/Free Full Text].
|
| 25.
|
Wilusz, J.,
M. Kurilla, and J. D. Keene.
1983.
A host protein (La) binds to a unique species of minus-sense leader RNA during replication of vesicular stomatitis virus.
Proc. Natl. Acad. Sci. USA
80:5827-5831[Abstract/Free Full Text].
|
Journal of Virology, November 1998, p. 8532-8540, Vol. 72, No. 11
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Frolova, E., Gorchakov, R., Garmashova, N., Atasheva, S., Vergara, L. A., Frolov, I.
(2006). Formation of nsP3-Specific Protein Complexes during Sindbis Virus Replication.. J. Virol.
80: 4122-4134
[Abstract]
[Full Text]
-
Bose, S., Mathur, M., Bates, P., Joshi, N., Banerjee, A. K.
(2003). Requirement for cyclophilin A for the replication of vesicular stomatitis virus New Jersey serotype. J. Gen. Virol.
84: 1687-1699
[Abstract]
[Full Text]
-
Choudhary, S., De, B. P., Banerjee, A. K.
(2000). Specific Phosphorylated Forms of Glyceraldehyde 3-Phosphate Dehydrogenase Associate with Human Parainfluenza Virus Type 3 and Inhibit Viral Transcription In Vitro. J. Virol.
74: 3634-3641
[Abstract]
[Full Text]