Previous Article | Next Article 
Journal of Virology, November 1998, p. 8510-8516, Vol. 72, No. 11
Zentrum für Innere Medizin,
Received 9 June 1998/Accepted 31 July 1998
The adenovirus E1B 55-kDa and E4 34-kDa oncoproteins bind and
inactivate the p53 tumor suppressor gene product, resulting in cell
transformation. A recently discovered cellular protein, p73, shows
extensive similarities to p53 in structure and function. Here we show
that the simultaneous transient expression of E1B 55-kDa and E4 34-kDa
proteins is sufficient to drastically shorten the intracellular
half-life of p53, leading to strongly reduced steady-state p53 levels.
Concomitantly, the E1B 55-kDa and E4 34-kDa proteins act
synergistically to inactivate the transcriptional activity of p53.
Mutational analysis suggests that physical interactions between the E1B
55-kDa protein and p53 and between the E1B 55-kDa and E4 34-kDa
proteins are both required for p53 degradation. In contrast, the
ability of p53 to interact with the cellular mdm2 oncoprotein or with
its cognate DNA element appears to be dispensable for its
destabilization by adenovirus gene products. The adenovirus E1B 55-kDa
protein did not detectably interact with p73 and failed to inhibit
p73-mediated transcription; also, the E1B 55-kDa and E4 34-kDa proteins
did not promote p73 degradation. When five amino acids near the amino
termini were exchanged at corresponding positions between p53 and p73,
this rendered p53 resistant and p73 susceptible to complex formation
and inactivation by the E1B 55-kDa protein. Our results suggest that
while p53 inactivation is a central step in virus-induced tumor
development, efficient transformation can occur without targeting p73.
The development of malignant tumors
commonly includes mechanisms to inactivate the p53 tumor suppressor
gene product. Viral oncoproteins bind and inactivate p53. Two
adenovirus proteins, the E1B 55-kDa and E4 34-kDa proteins, form a
complex with a dual function. First, these proteins modulate the
nuclear export of mRNA during virus infection (1, 10, 24)
and undergo nucleocytoplasmic shuttling (7). On the other
hand, both proteins were reported to bind p53 and antagonize
p53-mediated transcription (8, 25, 30). In cell
transformation assays, the combination of the E1B 55-kDa and E4 34-kDa
proteins promotes the formation of colonies more strongly than does the
E1B 55-kDa protein alone (20, 21), raising the possibility
that the two proteins act synergistically to inactivate p53.
Some p53 antagonists are known to promote the intracellular degradation
of p53. This destabilization of p53 is an activity common to
oncoproteins of human papillomaviruses (HPVs) (32), and the
cellular mdm2 protein (11, 16, 27). Intriguingly, the
half-life of p53 was shown to be reduced during adenovirus infection
(25, 33), depending on the presence of the E1B 55-kDa and E4
34-kDa proteins. Furthermore, the steady-state level of p53 is
downregulated after transformation with the E1B 55-kDa and E4 34-kDa
proteins (20, 21), leading to the hypothesis that the E1B
55-kDa and E4 34-kDa proteins might be sufficient to accelerate the
degradation of p53 even without the context of virus infection.
A recently discovered cellular protein, p73, shows many homologies to
p53 (14). The sequence homologous between p53 and p73 covers
the N-terminal domain of p53, which is known to interact with the
adenovirus E1B 55-kDa protein (15), raising the question whether p73 might also interact with this protein.
The homology of p53 and p73 is particularly extensive within the DNA
binding region and includes all amino acids known to form contact sites
between p53 and DNA. Both proteins activate transcription from
p53-responsive promoters and were reported to induce apoptosis
(13). To date, the only known functional difference between
p53 and p73 consists of the upregulation of p53 but not p73 levels in
response to DNA damage. The fact that at least some p53-responsive
promoters can also be activated by p73, along with the structural
similarities between p53 and p73, initially suggested that p53
antagonists might also inactivate p73 to achieve complete
transcriptional inhibition. Therefore, we analyzed the potential of
adenovirus oncoproteins to inactivate p73 in addition to p53.
We show that the simultaneous transient expression of the adenovirus
E1B 55-kDa and E4 34-kDa proteins is sufficient to strongly promote the
intracellular degradation of p53. In contrast, the adenovirus proteins
did not inhibit p73-mediated transcription, nor did they destabilize
p73. The E1B 55-kDa protein selectively binds p53 but not p73, due to a
5-amino-acid difference between the primary structures of p53 and p73.
Thus, despite the similar transcriptional activities of p53 and p73,
p73 does not represent a target of the adenovirus p53 antagonists.
Cell culture and plasmid construction.
Cells were maintained
in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal
bovine serum. The expression plasmids for p53 and mutants
(18), HA-tagged E1B 55-kDa protein (termed pCGNE1B)
(7), and E4 34-kDa protein (8) have been
described. An expression plasmid for nontagged E1B 55-kDa protein was
obtained by cloning the E1B 55-kDa protein coding region from pCGNE1B
into the pCG vector (34) with BamHI. To obtain
expression constructs for nontagged p73 Transfections and reporter assays.
Saos-2 cells (5 × 105 per assay) were transfected with a cationic lipid
preparation (Fugene 6; Boehringer Mannheim). Luciferase activities were
determined with a premanufactured assay system (Promega).
Western blotting.
Proteins were separated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (10%
polyacrylamide), transferred to nitrocellulose, incubated with
antibodies in phosphate-buffered saline (PBS) containing 5% milk
powder and 0.05% Tween, and subjected to chemiluminescent
detection (Pierce) of peroxidase-coupled secondary antibody (Jackson).
Antibody Pab1801 to p53 was from Calbiochem; antibody HA.11
against the HA epitope was from Babco.
Pulse-chase analysis.
Cells (5 × 105 per
lane) were transfected and starved for 30 min in starving medium (DMEM
lacking methionine and cysteine) and then subjected to incubation with
35S-labelled amino acids (Promix; Amersham) diluted 1:30 in
starving medium. After 10 min, the medium was changed to DMEM
containing 10% fetal bovine serum. After various chase times, the
cells were lysed and p53 was immunoprecipitated as described previously
(26).
Immunofluorescence.
Transfected cells were fixed for 15 min
with 4% paraformaldehyde in PBS, permeabilized for 25 min with 0.2%
Triton X-100 in PBS, and incubated with antibody as described
previously (6). To stain the HA tag, a rabbit polyclonal
antibody (Santa Cruz) was used, followed by a Texas red-labeled
secondary antibody (Jackson). To detect the E1B 55-kDa protein,
the murine monoclonal antibody 2A6 (31) was used,
followed by a fluorescein isothiocyanate-conjugated secondary antibody
(Jackson).
Immunoprecipitation.
In each experiment, 2 × 106 293 cells constitutively expressing the E1B 55-kDa
protein were lysed, incubated with in vitro-translated p53 or p73
proteins, and immunoprecipitated with antibody 2A6 (31)
against the E1B 55-kDa protein by a previously described procedure
(36).
p53 degradation mediated by transiently expressed E1B 55-kDa and E4
34-kDa proteins.
To determine whether the adenovirus type 5 E1B
55-kDa and E4 34-kDa proteins are sufficient to promote p53
degradation, we transiently expressed p53 in Saos-2 cells, an
osteosarcoma cell line lacking p53, and subjected the cells to
immunological detection of p53. The level of p53 was not detectably
affected by the presence of either the E1B 55-kDa protein or the E4
34-kDa protein separately (Fig. 1A, lanes
1 to 3). However, when both viral proteins were coexpressed with
p53, the amount of p53 was reduced more than 100-fold (lanes 4 to 6).
This effect was considerably stronger than the p53 reduction
achievable with coexpressed mdm2 or HPV E6 proteins (data not shown).
The proteasome inhibitor MG132 elevated to some extent the amount of
detectable p53 in the presence of the adenovirus oncoproteins
(data not shown) but only when it was used at unusually high
concentration (400 µM). It is therefore uncertain whether
proteasome-mediated degradation might be contributing to the observed
drop in p53 levels. Calpain inhibitors did not change the amount of
detected p53 (data not shown). To further address the possibility that
p53 is destabilized in the presence of the E1B 55-kDa and E4 34-kDa
proteins, the transfected cells were pulse-labeled with
[35S]methionine and the decay of p53 was monitored over
time (Fig. 1B). Quantitation of the nondegraded protein (Fig. 1C)
revealed that the biological half-life of p53 was drastically shortened by the simultaneous expression of the E1B 55-kDa and E4 34-kDa proteins. We conclude that the E1B 55-kDa and E4 34-kDa proteins act in
concert to trigger the destabilization of intracellular p53 and may
thereby promote cell transformation.
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Inactivation of p53 but Not p73 by Adenovirus Type
5 E1B 55-Kilodalton and E4 34-Kilodalton Oncoproteins
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
, the corresponding human
cDNA was amplified with the primers
GCGGGATCCGCGGCCGCCACCATGGCCCAGTCCACCGCCACCTCC and
GCGTCTAGAGGTCACGGTCCCCAAGTTCTGACGAGGC and the PCR
product was cloned into pcDNA3 (Invitrogen) with BamHI
and XbaI. To obtain an expression plasmid for nontagged
p73
, the procedure was carried out with the second primer replaced
with GCGTCTAGAGGTCAGTGGATCTCGGCCTCCGTGAAC. An expression
construct for C-terminally tagged p73 was obtained by
performing the same procedure but replacing the second primer with the
oligonucleotide
GCGTCTAGAGGTCAGCTTGCGTAATCCGGTACATCGTAAGGGTACGGTCCCCAAGTTCTGACGAGGC. Expression plasmids for mutant p53 and p73 were obtained by
site-directed mutagenesis (QuikChange; Stratagene). The constructs
were confirmed by sequencing.
RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
View larger version (21K):
[in a new window]
FIG. 1.
Degradation of p53 by the adenovirus type 5 E1B
55-kDa and E4 34-kDa proteins. (A) Expression plasmids
for the p53 (0.5 µg), E1B 55-kDa (0.5 µg), and E4
34-kDa (1.0 µg) proteins or "empty" vector constructs were
transfected into Saos-2 cells as indicated. After 24 h, the cells
were lysed and subjected to SDS-PAGE and Western blot analysis. p53 was
detected with monoclonal antibody Pab1801 (lanes 1 to 6). In a second
experiment (lanes 5 and 6), the film was overexposed to allow detection
of residual p53 in the presence of the E1B 34-kDa and E4
34-kDa proteins. (B) Expression plasmids for the p53 (1 µg), E1B
55-kDa (330 ng), and E4 34-kDa (660 ng) proteins or "empty"
vector constructs were transfected into Saos-2 cells as indicated.
After 24 h, the cells were labeled with
[35S]methionine and [35S]cysteine
for 10 min and then incubated in nonradioactive medium (chase). After
the time points indicated (minutes), the cells were harvested and
subjected to immunoprecipitation with monoclonal antibody Pab421
directed against p53, followed by SDS-PAGE and autoradiography.
Note that the signal intensities obtained with p53 alone
initially increase, possibly reflecting the incorporation of
radioactively labeled amino acids that were internalized into the
cells but not yet assembled into protein at the start of the
chase. (C) The signal intensities obtained in the same experiment with
p53 in the absence (diamonds) or presence (squares) of the E1B
55-kDa and E4 34-kDa proteins were quantified with a Bio
Imaging Analyzer (Fuji) and plotted against the time after removal of
the radioactive medium. (D) Expression plasmids for the p53 (50 ng),
E1B 55-kDa (1.0 µg), and E4 34-kDa (0.5 µg) proteins were
transfected as indicated into Saos-2 cells along with a reporter
plasmid containing a p53-responsive promoter driving
luciferase expression (pBP100luc [27], 0.5 µg). After 24 h, the cells were lysed and subjected to a
luciferase assay. Luciferase activity is indicated in relative units,
and the value obtained with p53 in the absence of antagonists was set
to 100%. Error bars reflect the standard deviation of at least three
independent experiments.
Mutational analysis of p53 degradation by the E1B 55-kDa and E4 34-kDa proteins. When two amino acids within the N terminus (positions 22 and 23) of p53 are mutated, the interaction of p53 with the E1B 55-kDa protein is abolished (18). The same mutation completely protected p53 from intracellular degradation by the E1B 55-kDa and E4 34-kDa proteins (Fig. 2, lanes 1 and 2), suggesting that the interaction between p53 and the E1B 55-kDa protein is a prerequisite for oncogene-mediated p53 degradation. In contrast, p53 levels were still reduced by the E1B 55-kDa and E4 34-kDa proteins, albeit less strongly, when the C-terminal domain of p53 was removed (leaving residues 1 to 317) (lanes 3 and 4). Since the C-terminal domain of p53 was previously mapped to interact with the E4 34-kDa protein (8), this argues that direct interactions between p53 and the E4 34-kDa protein might contribute to but are not necessary for the degradation of p53. Finally, a mutant form of the E4 34-kDa protein (deletion of amino acids 240 to 244) that lacks the ability to relocate the E1B 55-kDa protein from the cytoplasm to the nucleus (35a) did not reduce p53 levels when coexpressed with the E1B 55-kDa protein (lanes 5 and 6), suggesting that the interaction between the E1B 55-kDa and E4 34-kDa proteins is a requirement for p53 degradation. Mutation of p53 amino acids 14 and 19 is known to abolish complex formation between p53 and the mdm2 protein while preserving the ability of p53 to associate with the E1B 55-kDa protein (18). The abundance of this p53 mutant was downregulated by the adenovirus oncoproteins (lanes 7 and 8), arguing that mdm2 is not involved in adenovirus-mediated p53 degradation. Finally, a tumor-derived mutation of p53 (R175H) that abolishes promoter-binding activity did not stabilize the protein in the presence of the E1B 55-kDa and E4 34-kDa proteins (lanes 9 and 10), suggesting that adenovirus-mediated degradation of p53 occurs regardless of the specific DNA binding activity of p53.
|
Selective inactivation of p53 but not p73 by adenovirus
oncoproteins.
Given the structural and functional homology
between the p53 and p73 proteins, it has been proposed that both
proteins might be regulated by the same antagonists (14). To
test this, the transcriptional activities of p53 and the and forms of p73 (p73 and p73) were assessed by using a luciferase
reporter. p73 was found to be a considerably weaker transcriptional
activator than p53 or p73 (Fig. 3B,
lanes 1 to 3), possibly due to its reported failure to form oligomers
(14). Therefore, p73 was chosen for further analysis. The
proportion of transactivation was roughly maintained among p53, p73,
and p73 when several different p53-responsive promoters were used
(data not shown), suggesting that p53 and p73 have similar or identical
target sequences.
|
, and transcription was quantified by measuring the
luciferase activity (Fig. 3B, lanes 4 to 11). The transcriptional activity of p53 was reduced by the E1B 55-kDa protein alone (lane 5) and even more strongly by the two proteins together (lane 7), but
p73 remained unaffected by the adenovirus oncoproteins
(lanes 8 to 11).
Based on previously reported mutational analysis (18), we
suspected that five residues near the amino terminus of p53 (amino acids 24 to 28) might be critical for E1B binding and hence for transcriptional inactivation. The amino acids at the corresponding positions are not conserved between p53 and p73 (Fig. 3A, compare residues 24 to 28 in p53 with amino acids 20 to 24 in p73). We hypothesized that this difference in primary structure might constitute the differential response of p53 and p73 activity to adenovirus oncoproteins. To test this hypothesis, chimeric proteins were designed with these five residues exchanged between
p53 and p73 (Fig. 3A); they are termed p53mt(24-28) and
p73mt(20-24), respectively. This replacement resulted in complete
resistance of p53 to E1B- and/or E4-mediated inhibition (Fig. 3B, lanes
12 to 15). In turn, p73mt(20-24) was fully susceptible to
E1B-mediated inactivation (lane 17), even though the E4 34-kDa
protein did not further enhance this effect (lane 19).
The abundance of p53 but not p73 is reduced in the presence of the
E1B 55-kDa and E4 34-kDa proteins.
Next, we asked if p73
is also resistant to degradation mediated by adenovirus
oncoproteins. To address this question, a hemagglutinin epitope was fused to the carboxy-terminal ends of p53 and p73 (Fig. 3A) to allow parallel quantitation. As expected, p73
levels were not reduced when the proteins were coexpressed with
the adenovirus oncoproteins (Fig.
4, lanes 1 and 2), while tagged p53
was suppressed below detectability (compare lanes 5 and 6).
Surprisingly, the chimeric version of p73 [p73mt(20-24) (Fig.
3A)] that was inhibitable by the E1B 55-kDa protein was not
detectably destabilized by the adenovirus oncoproteins (Fig. 4,
lanes 3 and 4). This is consistent with the finding that the E4
34-kDa protein did not further downregulate the transcriptional
activity of this mutant on top of the effect of the E1B 55-kDa
protein (Fig. 3B, lane 19). Hence, intrinsic properties of p53 other
than E1B binding are required for efficient degradation in the presence
of adenovirus oncoproteins.
|
The E1B 55-kDa protein relocalizes p53 but not p73.
The
intracellular complex formation between the E1B 55-kDa protein and
p53 or p73 was further analyzed by simultaneous immunofluorescent labeling of coexpressed proteins (Fig.
5). The E1B 55-kDa protein relocalizes p53 into characteristic cytoplasmic clusters (Fig. 5,
compare panels a to c with panels d to f) that were described previously (2, 37). In contrast, p73 did not colocalize with the E1B 55-kDa protein (panels g to i). However, when five residues near the amino terminus of p73 were replaced by the analogous amino acids from p53, colocalization with the E1B 55-kDa protein was restored in transfected cells (compare panels j to l with
panels m to o). Both proteins were then found in nuclear clusters,
possibly reflecting a nuclear localization signal within p73 that
maintains its activity despite the association with the E1B 55-kDa
protein.
|
The E1B 55-kDa protein forms a specific complex with p53 but
not p73.
Finally, the interaction of the E1B 55-kDa protein
with p53 and/or p73 was tested in vitro based on coimmunoprecipitation. While p53 efficiently associated with the E1B 55-kDa protein (Fig. 6, lane 5), little if any p73 bound
this protein (lane 7). Conversely, p53mt(24-28) bound weakly if
at all (lane 6) whereas mutant p73, containing five
p53-derived amino acids, was recovered as a complex with the E1B
55-kDa protein (lane 8). In the absence of the E1B 55-kDa
protein, the antibody failed to precipitate any detectable p53 or p73
(lanes 9 to 12). We conclude that the adenovirus oncoproteins under study specifically inactivate p53 but not p73 and that this difference can be ascribed to a small sequence element within p53 that
allows binding to the E1B 55-kDa protein.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
We have shown that p53 is rapidly degraded when coexpressed with
the combination of the adenovirus type 5 E1B 55-kDa and E4 34-kDa proteins. p73 activates p53-responsive promoters at least as strongly as p53 itself does, but it is not antagonized or
destabilized by the adenovirus oncoproteins. The E1B 55-kDa
protein binds and relocalizes p53 but not p73, and this difference was
pinpointed to five N-terminal amino acid residues that are not
conserved between p53 and p73.
As suggested by mutational analysis, both the interaction between the E1B 55-kDa and E4 34-kDa proteins and the association of the E1B 55-kDa protein with p53 seem to be needed for accelerated p53 degradation (Fig. 2). Possibly, a complex that contains all three proteins is formed. It remains to be determined which mechanism(s) ultimately leads to the degradation of p53 in the presence of adenovirus oncoproteins. So far, proteasome-mediated proteolysis (5, 9) and calpain-mediated proteolysis (19, 23) have been reported to shorten the life span of p53. However, a specific inhibitor for the proteasome only weakly inhibited p53 degradation, and calpain inhibitors completely failed to protect p53 in the presence of the E1B 55-kDa and E4 34-kDa proteins. Therefore, it remains possible that the adenovirus oncoproteins trigger p53 degradation by a third mechanism. The ability of such a novel pathway to destroy p53 and its role in the absence of viral proteins are subjects for further studies.
In our hands, the E1B 55-kDa protein reduces the ability of p53 to activate transcription. In contrast, the E4 34-kDa protein has only an auxiliary effect on p53 inhibition when coexpressed with the E1B 55-kDa protein but does not downregulate the activity of p53 in the absence of the E1B 55-kDa protein (Fig. 1D). This was consistently observed over a wide range of plasmid amounts transfected to express p53 and the E4 34-kDa protein (25a), in contrast to a previous report (8). We therefore assume that direct effects of the E4 34-kDa protein alone on p53 activity may be restricted to special conditions but do not represent a generally observable phenomenon. However, the E1B 55-kDa and E4 34-kDa proteins act synergistically to destabilize and inactivate p53.
The E1B 55-kDa and E4 34-kDa proteins are known to shuttle between the nucleus and cytoplasm (7). It is tempting to speculate that this transport phenomenon might be part of the degradation mechanism. Therefore, we compared the E4 34-kDa protein with a mutant carrying a defective nuclear export signal (NES) and asked if their abilities to degrade p53 in the presence of E1B might be different. Indeed, the mutation within the NES resulted in a decreased ability to destabilize p53 (data not shown). However, the reduction of the p53 levels was still readily observable under these conditions, suggesting that nuclear export is not an absolute requirement to mediate p53 degradation. Furthermore, it cannot be excluded that the NES mutation might reduce the ability of the E4 34-kDa protein to associate with the E1B 55-kDa protein and p53. Therefore, we still consider the role, if any, played by nuclear export of adenovirus oncoproteins in the degradation of p53 to be an open question.
The transcriptional activities of p53 and p73 seem virtually
indistinguishable, at least when using the promoters that we have
examined so far (data not shown). These included the promoters of hdm2,
p21 (waf1), and a synthetic p53-responsive plasmid (3). The
ratio between the activities of p53, p73, and p73 consistently remained the same, with p73 being far more active than p73. Possibly, the ability of p73 to form homo-oligomers (14)
enhances its ability to bind the specific DNA element cooperatively,
similar to p53. Given the striking difference in transcriptional
activation by the splice variants p73 and p73, it is conceivable
that alternative splicing might be a mechanism to regulate p73
activity. Future studies are aimed at determining if the ratio between
p73 and p73 varies between cell types.
Since p73 can activate at least a large subset of the p53-responsive promoters, and given its structural similarities to p53, it was initially assumed that oncoproteins might have evolved to bind and inactivate both p53 and p73 (14). However, at least the inhibitors studied here failed to affect p73. The interaction with oncoproteins is only the second functional difference identified between p53 and p73 (the first difference was the increased amount of p53 but not p73 found in cells after treatment with DNA-damaging agents [14]). It remains to be determined whether other p53 antagonists, e.g., the HPV E6 proteins or the cellular mdm2 protein, also inactivate and degrade p53 but not p73. Our recently obtained results suggest that the simian virus 40 T antigen also binds and inactivates p53 but not p73 (26a).
Why is p73 "neglected" by the oncoproteins studied here
while p53 is efficiently inactivated and degraded? One explanation could be that the p73 proteins are controlled by a subset of viral and
cellular factors distinct from the p53 antagonists. However, in the
case of virus-induced tumor formation, the E1B 55-kDa and E4
34-kDa proteins, along with the adenovirus E1A 13S protein, were
shown to be sufficient to strongly promote cell transformation (20, 21) but do not inactivate p73. Thus, it seems that some form of p53 inactivation
preferably destabilizationis a prerequisite for virus-induced tumor development in most cases, while tumors do
arise even when p73 is not affected.
A second possibility is that p73 expression and activity is restricted to certain tissues or cell types. However, detectable amounts of p73 were found in most tissues, and several tumor-derived cell lines were shown to express wild-type p73 proteins in considerable amounts while the p53 transcript was mutated (14). Nonetheless, it remains possible that p73 quantities and activities vary between tissues. In this case, p73 may represent a differentiation factor in certain tissues rather than a general "guardian of the genome," as suggested for p53 (17).
Based on the differential interaction with viral oncoproteins, we propose that p53 has activities that cannot be performed by p73 and that are essential for tumor suppression in at least a subset of cells whereas p73 inactivation seems dispensable for oncogene-mediated tumor induction. What could be the mechanistic nature of such an activity that is unique to p53? One possibility is that some p53-responsive promoters cannot be activated by p73. However, we and others have not found such a differential responsiveness in the promoters tested so far. Alternatively, the activity residing in the proline-rich region of the protein (28, 29, 35), or growth-suppressing functions of p53 that might be unrelated to transcriptional activation (12), may not be maintained in the p73 proteins. Such activities may thus represent critical functions by which the p53 protein plays its role as a protector from tumor development.
To date, it cannot be regarded as certain that p73 fulfils all the criteria of a tumor suppressor gene product (4, 22) or whether it acts so in all cell types. However, should p73 not turn out to play a role as central as p53 in tumorigenesis, its differences from p53 might serve as guidelines to identify as yet unknown p53 functions that are crucial for tumor suppression.
| |
ACKNOWLEDGMENTS |
|---|
We thank H.-D. Klenk and R. Arnold for their generous support, and we thank M. Kaghad, D. Caput, and W. G. Kaelin for plasmids.
This work was supported by the German Research Foundation, the P. E. Kempkes Foundation, the Fazit Foundation (scholarship to C. König), the Hoechst Scholarship Foundation (to S. Wienzek), and the German Cancer Research Center (Stipendium für Infektionsbiologie to M.D.).
| |
ADDENDUM IN PROOF |
|---|
While this article was under review, it was reported that the E6
protein of an oncogenic human papillomavirus mediates intracellular degradation of p53 but not p73 (N. S. Prabhu, K. Somasundaram, K. Satyamoorty, M. Iterlyn, and W. S. El-Deiry, Int. J. Oncol. 13:5-9, 1998).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Institut für Virologie, Zentrum für Mikrobiologie und Hygiene, Philipps-Universität Marburg, Robert Koch Str. 17, 35037 Marburg, Germany. Phone: 49 6421 28 3302. Fax: 49 6421 28 8962. E-mail: dobbelst{at}mailer.uni-marburg.de.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. |
Babiss, L. E.,
H. S. Ginsberg, and J. E. Darnell, Jr.
1985.
Adenovirus E1B proteins are required for accumulation of late viral mRNA and for effects on cellular mRNA translation and transport.
Mol. Cell. Biol.
5:2552-2558 |
| 2. | Blair Zajdel, M. E., and G. E. Blair. 1988. The intracellular distribution of the transformation-associated protein p53 in adenovirus-transformed rodent cells. Oncogene 2:579-584[Medline]. |
| 3. |
Buckbinder, L.,
R. Talbott,
B. R. Seizinger, and N. Kley.
1994.
Gene regulation by temperature-sensitive p53 mutants: identification of p53 response genes.
Proc. Natl. Acad. Sci. USA
91:10640-10644 |
| 4. |
Dickman, S.
1997.
First p53 relative may be a new tumor suppressor.
Science
277:1605-1606 |
| 5. |
Dietrich, C.,
T. Bartsch,
F. Schanz,
F. Oesch, and R. J. Wieser.
1996.
p53-dependent cell cycle arrest induced by N-acetyl-L-leucinyl-L-leucinyl-L-norleucinal in platelet-derived growth factor-stimulated human fibroblasts.
Proc. Natl. Acad. Sci. USA
93:10815-10819 |
| 6. | Dobbelstein, M., A. K. Arthur, S. Dehde, K. van Zee, A. Dickmanns, and E. Fanning. 1992. Intracistronic complementation reveals a new function of SV40 T antigen that co-operates with Rb and p53 binding to stimulate DNA synthesis in quiescent cells. Oncogene 7:837-847[Medline]. |
| 7. | Dobbelstein, M., J. Roth, W. T. Kimberly, A. J. Levine, and T. Shenk. 1997. Nuclear export of the E1B 55-kDa and E4 34-kDa adenoviral oncoproteins mediated by a rev-like signal sequence. EMBO J. 16:4276-4284[Medline]. |
| 8. | Dobner, T., N. Horikoshi, S. Rubenwolf, and T. Shenk. 1996. Blockage by adenovirus E4orf6 of transcriptional activation by the p53 tumor suppressor. Science 272:1470-1473[Abstract]. |
| 9. | Gonen, H., D. Shkedy, S. Barnoy, N. S. Kosower, and A. Ciechanover. 1997. On the involvement of calpains in the degradation of the tumor suppressor protein p53. FEBS Lett. 406:17-22[Medline]. |
| 10. |
Halbert, D. N.,
J. R. Cutt, and T. Shenk.
1985.
Adenovirus early region 4 encodes functions required for efficient DNA replication, late gene expression, and host cell shutoff.
J. Virol.
56:250-257 |
| 11. | Haupt, Y., R. Maya, A. Kazaz, and M. Oren. 1997. Mdm2 promotes the rapid degradation of p53. Nature 387:296-299[Medline]. |
| 12. | Haupt, Y., S. Rowan, E. Shaulian, A. Kazaz, K. Vousden, and M. Oren. 1997. p53 mediated apoptosis in HeLa cells: transcription dependent and independent mechanisms. Leukemia 11(Suppl. 3):337-339. |
| 13. | Jost, C. A., M. C. Marin, and W. G. Kaelin, Jr. 1997. p73 is a human p53-related protein that can induce apoptosis. Nature. 389:191-194[Medline]. |
| 14. | Kaghad, M., H. Bonnet, A. Yang, L. Creancier, J. C. Biscan, A. Valent, A. Minty, P. Chalon, J. M. Lelias, X. Dumont, P. Ferrara, F. McKeon, and D. Caput. 1997. Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell 90:809-819[Medline]. |
| 15. | Kao, C. C., P. R. Yew, and A. J. Berk. 1990. Domains required for in vitro association between the cellular p53 and the adenovirus 2 E1B 55K proteins. Virology 179:806-814[Medline]. |
| 16. | Kubbutat, M. H., S. N. Jones, and K. H. Vousden. 1997. Regulation of p53 stability by Mdm2. Nature 387:299-303[Medline]. |
| 17. | Lane, D. P. 1992. p53, guardian of the genome. Nature 358:15-16[Medline]. |
| 18. |
Lin, J.,
J. Chen,
B. Elenbaas, and A. J. Levine.
1994.
Several hydrophobic amino acids in the p53 amino-terminal domain are required for transcriptional activation, binding to mdm-2 and the adenovirus 5 E1B 55-kD protein.
Genes Dev.
8:1235-1246 |
| 19. |
Maki, C. G.,
J. M. Huibregtse, and P. M. Howley.
1996.
In vivo ubiquitination and proteasome-mediated degradation of p53(1).
Cancer Res.
56:2649-2654 |
| 20. |
Moore, M.,
N. Horikoshi, and T. Shenk.
1996.
Oncogenic potential of the adenovirus E4orf6 protein.
Proc. Natl. Acad. Sci. USA
93:11295-11301 |
| 21. |
Nevels, M.,
S. Rubenwolf,
T. Spruss,
H. Wolf, and T. Dobner.
1997.
The adenovirus E4orf6 protein can promote E1A/E1B-induced focus formation by interfering with p53 tumor suppressor function.
Proc. Natl. Acad. Sci. USA
94:1206-1211 |
| 22. | Oren, M. 1997. Lonely no more: p53 finds its kin in a tumor suppressor haven. Cell 90:829-832[Medline]. |
| 23. | Pariat, M., S. Carillo, M. Molinari, C. Salvat, L. Debussche, L. Bracco, J. Milner, and M. Piechaczyk. 1997. Proteolysis by calpains: a possible contribution to degradation of p53. Mol. Cell. Biol. 17:2806-2815[Abstract]. |
| 24. |
Pilder, S.,
M. Moore,
J. Logan, and T. Shenk.
1986.
The adenovirus E1B-55K transforming polypeptide modulates transport or cytoplasmic stabilization of viral and host cell mRNAs.
Mol. Cell. Biol.
6:470-476 |
| 25. | Querido, E., R. C. Marcellus, A. Lai, R. Charbonneau, J. G. Teodoro, G. Ketner, and P. E. Branton. 1997. Regulation of p53 levels by the E1B 55-kilodalton protein and E4orf6 in adenovirus-infected cells. J. Virol. 71:3788-3798[Abstract]. |
| 25a. | Roth, J. Unpublished observations. |
| 26. |
Roth, J.,
D. Dittmer,
D. Rea,
J. Tartaglia,
E. Paoletti, and A. J. Levine.
1996.
p53 as a target for cancer vaccines: recombinant canarypox virus vectors expressing p53 protect mice against lethal tumor cell challenge.
Proc. Natl. Acad. Sci. USA
93:4781-4786 |
| 26a. | Roth, J., and M. Dobbelstein. Unpublished observations. |
| 27. | Roth, J., M. Dobbelstein, D. A. Freedman, T. Shenk, and A. J. Levine. 1998. Nucleo-cytoplasmic shuttling of the hdm2 oncoprotein regulates the levels of the p53 protein via a pathway used by the human immunodeficiency virus rev protein. EMBO J. 17:554-564[Medline]. |
| 28. |
Ruaro, E. M.,
L. Collavin,
G. Del Sal,
R. Haffner,
M. Oren,
A. J. Levine, and C. Schneider.
1997.
A proline-rich motif in p53 is required for transactivation-independent growth arrest as induced by Gas1.
Proc. Natl. Acad. Sci. USA
94:4675-4680 |
| 29. | Sakamuro, D., P. Sabbatini, E. White, and G. C. Prendergast. 1997. The polyproline region of p53 is required to activate apoptosis but not growth arrest. Oncogene 15:887-898[Medline]. |
| 30. | Sarnow, P., Y. S. Ho, J. Williams, and A. J. Levine. 1982. Adenovirus E1b-58kd tumor antigen and SV40 large tumor antigen are physically associated with the same 54 kd cellular protein in transformed cells. Cell 28:387-394[Medline]. |
| 31. | Sarnow, P., C. A. Sullivan, and A. J. Levine. 1982. A monoclonal antibody detecting the adenovirus type 5-E1b-58Kd tumor antigen: characterization of the E1b-58Kd tumor antigen in adenovirus-infected and -transformed cells. Virology 120:510-517[Medline]. |
| 32. | Scheffner, M., B. A. Werness, J. M. Huibregtse, A. J. Levine, and P. M. Howley. 1990. The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63:1129-1136[Medline]. |
| 33. | Steegenga, W. T., N. Riteco, A. G. Jochemsen, F. J. Fallaux, and J. L. Bos. 1998. The large E1B protein together with the E4orf6 protein target p53 for active degradation in adenovirus infected cells. Oncogene 16:349-357[Medline]. |
| 34. | Tanaka, M., and W. Herr. 1990. Differential transcriptional activation by Oct-1 and Oct-2: interdependent activation domains induce Oct-2 phosphorylation. Cell 60:375-386[Medline]. |
| 35. |
Walker, K. K., and A. J. Levine.
1996.
Identification of a novel p53 functional domain that is necessary for efficient growth suppression.
Proc. Natl. Acad. Sci. USA
93:15335-15340 |
| 35a. | Wienzek, S. Unpublished data. |
| 36. | Yew, P. R., and A. J. Berk. 1992. Inhibition of p53 transactivation required for transformation by adenovirus early 1B protein. Nature 357:82-85[Medline]. |
| 37. | Zantema, A., J. A. Fransen, A. Davis-Olivier, F. C. Ramaekers, G. P. Vooijs, B. DeLeys, and A. J. Van der Eb. 1985. Localization of the E1B proteins of adenovirus 5 in transformed cells, as revealed by interaction with monoclonal antibodies. Virology 142:44-58[Medline]. |
Journal of Virology, November 1998, p. 8510-8516, Vol. 72, No. 11
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Dallaire, F., Blanchette, P., Branton, P. E.
(2009). A Proteomic Approach To Identify Candidate Substrates of Human Adenovirus E4orf6-E1B55K and Other Viral Cullin-Based E3 Ubiquitin Ligases. J. Virol.
83: 12172-12184
[Abstract] [Full Text] -
Dallaire, F., Blanchette, P., Groitl, P., Dobner, T., Branton, P. E.
(2009). Identification of Integrin {alpha}3 as a New Substrate of the Adenovirus E4orf6/E1B 55-Kilodalton E3 Ubiquitin Ligase Complex. J. Virol.
83: 5329-5338
[Abstract] [Full Text] -
Miller, D. L., Rickards, B., Mashiba, M., Huang, W., Flint, S. J.
(2009). The Adenoviral E1B 55-Kilodalton Protein Controls Expression of Immune Response Genes but Not p53-Dependent Transcription. J. Virol.
83: 3591-3603
[Abstract] [Full Text] -
Schwartz, R. A., Lakdawala, S. S., Eshleman, H. D., Russell, M. R., Carson, C. T., Weitzman, M. D.
(2008). Distinct Requirements of Adenovirus E1b55K Protein for Degradation of Cellular Substrates. J. Virol.
82: 9043-9055
[Abstract] [Full Text] -
Blanchette, P., Kindsmuller, K., Groitl, P., Dallaire, F., Speiseder, T., Branton, P. E., Dobner, T.
(2008). Control of mRNA Export by Adenovirus E4orf6 and E1B55K Proteins during Productive Infection Requires E4orf6 Ubiquitin Ligase Activity. J. Virol.
82: 2642-2651
[Abstract] [Full Text] -
Luo, K., Ehrlich, E., Xiao, Z., Zhang, W., Ketner, G., Yu, X.-F.
(2007). Adenovirus E4orf6 assembles with Cullin5-ElonginB-ElonginC E3 ubiquitin ligase through an HIV/SIV Vif-like BC-box to regulate p53. FASEB J.
21: 1742-1750
[Abstract] [Full Text] -
Blanchette, P., Cheng, C. Y., Yan, Q., Ketner, G., Ornelles, D. A., Dobner, T., Conaway, R. C., Conaway, J. W., Branton, P. E.
(2004). Both BC-Box Motifs of Adenovirus Protein E4orf6 Are Required To Efficiently Assemble an E3 Ligase Complex That Degrades p53. Mol. Cell. Biol.
24: 9619-9629
[Abstract] [Full Text] -
Hobom, U., Dobbelstein, M.
(2004). E1B-55-Kilodalton Protein Is Not Required To Block p53-Induced Transcription during Adenovirus Infection. J. Virol.
78: 7685-7697
[Abstract] [Full Text] -
Mohammadi, E. S., Ketner, E. A., Johns, D. C., Ketner, G.
(2004). Expression of the adenovirus E4 34k oncoprotein inhibits repair of double strand breaks in the cellular genome of a 293-based inducible cell line. Nucleic Acids Res
32: 2652-2659
[Abstract] [Full Text] -
Feng, P., Scott, C. W., Cho, N.-H., Nakamura, H., Chung, Y.-H., Monteiro, M. J., Jung, J. U.
(2004). Kaposi's Sarcoma-Associated Herpesvirus K7 Protein Targets a Ubiquitin-Like/Ubiquitin-Associated Domain-Containing Protein To Promote Protein Degradation. Mol. Cell. Biol.
24: 3938-3948
[Abstract] [Full Text] -
Zhao, L. Y., Liao, D.
(2003). Sequestration of p53 in the Cytoplasm by Adenovirus Type 12 E1B 55-Kilodalton Oncoprotein Is Required for Inhibition of p53-Mediated Apoptosis. J. Virol.
77: 13171-13181
[Abstract] [Full Text] -
Roth, J., Lenz-Bauer, C., Contente, A., Lohr, K., Koch, P., Bernard, S., Dobbelstein, M.
(2003). Reactivation of Mutant p53 by a One-Hybrid Adaptor Protein. Cancer Res.
63: 3904-3908
[Abstract] [Full Text] -
Fontemaggi, G., Kela, I., Amariglio, N., Rechavi, G., Krishnamurthy, J., Strano, S., Sacchi, A., Givol, D., Blandino, G.
(2002). Identification of Direct p73 Target Genes Combining DNA Microarray and Chromatin Immunoprecipitation Analyses. J. Biol. Chem.
277: 43359-43368
[Abstract] [Full Text] -
Harada, J. N., Shevchenko, A., Shevchenko, A., Pallas, D. C., Berk, A. J.
(2002). Analysis of the Adenovirus E1B-55K-Anchored Proteome Reveals Its Link to Ubiquitination Machinery. J. Virol.
76: 9194-9206
[Abstract] [Full Text] -
Lober, C., Lenz-Stoppler, C., Dobbelstein, M.
(2002). Adenovirus E1-transformed cells grow despite the continuous presence of transcriptionally active p53. J. Gen. Virol.
83: 2047-2057
[Abstract] [Full Text] -
Nakagawa, T., Takahashi, M., Ozaki, T., Watanabe, K.-i., Todo, S., Mizuguchi, H., Hayakawa, T., Nakagawara, A.
(2002). Autoinhibitory Regulation of p73 by {Delta}Np73 To Modulate Cell Survival and Death through a p73-Specific Target Element within the {Delta}Np73 Promoter. Mol. Cell. Biol.
22: 2575-2585
[Abstract] [Full Text] -
Gonzalez, R. A., Flint, S. J.
(2002). Effects of Mutations in the Adenoviral E1B 55-Kilodalton Protein Coding Sequence on Viral Late mRNA Metabolism. J. Virol.
76: 4507-4519
[Abstract] [Full Text] -
Song, Y.-J., Stinski, M. F.
(2002). Effect of the human cytomegalovirus IE86 protein on expression of E2F-responsive genes: A DNA microarray analysis. Proc. Natl. Acad. Sci. USA
10.1073/pnas.052010099v1
[Abstract] [Full Text] -
Koch, P., Gatfield, J., Lober, C., Hobom, U., Lenz-Stoppler, C., Roth, J., Dobbelstein, M.
(2001). Efficient Replication of Adenovirus Despite the Overexpression of Active and Nondegradable p53. Cancer Res.
61: 5941-5947
[Abstract] [Full Text] -
Irwin, M. S., Kaelin, W. G.
(2001). p53 Family Update: p73 and p63 Develop Their Own Identities. Cell Growth Differ.
12: 337-349
[Full Text] -
Shen, Y., Kitzes, G., Nye, J. A., Fattaey, A., Hermiston, T.
(2001). Analyses of Single-Amino-Acid Substitution Mutants of Adenovirus Type 5 E1B-55K Protein. J. Virol.
75: 4297-4307
[Abstract] [Full Text] -
El-Naggar, A. K., Lai, S., Clayman, G. L., Mims, B., Lippman, S. M., Coombes, M., Luna, M. A., Lozano, G.
(2001). p73 gene alterations and expression in primary oral and laryngeal squamous carcinomas. Carcinogenesis
22: 729-735
[Abstract] [Full Text] -
Doronin, K., Kuppuswamy, M., Toth, K., Tollefson, A. E., Krajcsi, P., Krougliak, V., Wold, W. S. M.
(2001). Tissue-Specific, Tumor-Selective, Replication-Competent Adenovirus Vector for Cancer Gene Therapy. J. Virol.
75: 3314-3324
[Abstract] [Full Text] -
Querido, E., Morisson, M. R., Chu-Pham-Dang, H., Thirlwell, S. W.-L., Boivin, D., Branton, P. E.
(2001). Identification of Three Functions of the Adenovirus E4orf6 Protein That Mediate p53 Degradation by the E4orf6-E1B55K Complex. J. Virol.
75: 699-709
[Abstract] [Full Text] -
Cathomen, T., Weitzman, M. D.
(2000). A Functional Complex of Adenovirus Proteins E1B-55kDa and E4orf6 Is Necessary To Modulate the Expression Level of p53 but Not Its Transcriptional Activity. J. Virol.
74: 11407-11412
[Abstract] [Full Text] -
Nevels, M., Rubenwolf, S., Spruss, T., Wolf, H., Dobner, T.
(2000). Two Distinct Activities Contribute to the Oncogenic Potential of the Adenovirus Type 5 E4orf6 Protein. J. Virol.
74: 5168-5181
[Abstract] [Full Text] -
Kang, M.-J., Park, B.-J., Byun, D.-S., Park, J.-I., Kim, H.-J., Park, J.-H., Chi, S.-G.
(2000). Loss of Imprinting and Elevated Expression of Wild-Type p73 in Human Gastric Adenocarcinoma. Clin. Cancer Res.
6: 1767-1771
[Abstract] [Full Text] -
Levrero, M, De Laurenzi, V, Costanzo, A, Gong, J, Wang, J., Melino, G
(2000). The p53/p63/p73 family of transcription factors: overlapping and distinct functions. J. Cell Sci.
113: 1661-1670
[Abstract] -
Wienzek, S., Roth, J., Dobbelstein, M.
(2000). E1B 55-Kilodalton Oncoproteins of Adenovirus Types 5 and 12 Inactivate and Relocalize p53, but Not p51 or p73, and Cooperate with E4orf6 Proteins To Destabilize p53. J. Virol.
74: 193-202
[Abstract] [Full Text] -
Weigel, S., Dobbelstein, M.
(2000). The Nuclear Export Signal within the E4orf6 Protein of Adenovirus Type 5 Supports Virus Replication and Cytoplasmic Accumulation of Viral mRNA. J. Virol.
74: 764-772
[Abstract] [Full Text] -
Roth, J., Dobbelstein, M.
(1999). Failure of viral oncoproteins to target the p53-homologue p51A. J. Gen. Virol.
80: 3251-3255
[Abstract] [Full Text] -
Ozaki, T., Naka, M., Takada, N., Tada, M., Sakiyama, S., Nakagawara, A.
(1999). Deletion of the COOH-Terminal Region of p73{{alpha}} Enhances Both Its Transactivation Function and DNA-binding Activity but Inhibits Induction of Apoptosis in Mammalian Cells. Cancer Res.
59: 5902-5907
[Abstract] [Full Text] -
Fang, L., Lee, S. W., Aaronson, S. A.
(1999). Comparative Analysis of P73 and P53 Regulation and Effector Functions. JCB
147: 823-830
[Abstract] [Full Text] -
McPake, C. R., Shetty, S., Kitchingman, G. R., Harris, L. C.
(1999). Wild-Type p53 Induction Mediated by Replication-deficient Adenoviral Vectors. Cancer Res.
59: 4247-4251
[Abstract] [Full Text] -
Zimmermann, H., Degenkolbe, R., Bernard, H.-U., O'Connor, M. J.
(1999). The Human Papillomavirus Type 16 E6 Oncoprotein Can Down-Regulate p53 Activity by Targeting the Transcriptional Coactivator CBP/p300. J. Virol.
73: 6209-6219
[Abstract] [Full Text] -
Tannapfel, A., Wasner, M., Krause, K., Geissler, F., Katalinic, A., Hauss, J., Mossner, J., Engeland, K., Wittekind, C.
(1999). Expression of p73 and Its Relation to Histopathology and Prognosis in Hepatocellular Carcinoma. JNCI J Natl Cancer Inst
91: 1154-1158
[Abstract] [Full Text] -
Harada, J. N., Berk, A. J.
(1999). p53-Independent and -Dependent Requirements for E1B-55K in Adenovirus Type 5 Replication. J. Virol.
73: 5333-5344
[Abstract] [Full Text] -
Zaika, A. I., Kovalev, S., Marchenko, N. D., Moll, U. M.
(1999). Overexpression of the Wild Type p73 Gene in Breast Cancer Tissues and Cell Lines. Cancer Res.
59: 3257-3263
[Abstract] [Full Text] -
Chi, S.-G., Chang, S.-G., Lee, S.-J., Lee, C.-H., Kim, J. I., Park, J.-H.
(1999). Elevated and Biallelic Expression of p73 Is Associated with Progression of Human Bladder Cancer. Cancer Res.
59: 2791-2793
[Abstract] [Full Text] -
Steegenga, W. T., Shvarts, A., Riteco, N., Bos, J. L., Jochemsen, A. G.
(1999). Distinct Regulation of p53 and p73 Activity by Adenovirus E1A, E1B, and E4orf6 Proteins. Mol. Cell. Biol.
19: 3885-3894
[Abstract] [Full Text] -
Kaelin, W. G. Jr.
(1999). The Emerging p53 Gene Family. JNCI J Natl Cancer Inst
91: 594-598
[Abstract] [Full Text] -
Higashino, F., Pipas, J. M., Shenk, T.
(1998). Adenovirus E4orf6 oncoprotein modulates the function of the p53-related protein, p73. Proc. Natl. Acad. Sci. USA
95: 15683-15687
[Abstract] [Full Text] -
Boyer, J. L., Ketner, G.
(2000). Genetic Analysis of a Potential Zinc-binding Domain of the Adenovirus E4 34k Protein. J. Biol. Chem.
275: 14969-14978
[Abstract] [Full Text] -
Zaika, A., Irwin, M., Sansome, C., Moll, U. M.
(2001). Oncogenes Induce and Activate Endogenous p73 Protein. J. Biol. Chem.
276: 11310-11316
[Abstract] [Full Text] -
Strano, S., Munarriz, E., Rossi, M., Castagnoli, L., Shaul, Y., Sacchi, A., Oren, M., Sudol, M., Cesareni, G., Blandino, G.
(2001). Physical Interaction with Yes-associated Protein Enhances p73 Transcriptional Activity. J. Biol. Chem.
276: 15164-15173
[Abstract] [Full Text] -
Lemasson, I., Nyborg, J. K.
(2001). Human T-cell Leukemia Virus Type I Tax Repression of p73beta Is Mediated through Competition for the C/H1 Domain of CBP. J. Biol. Chem.
276: 15720-15727
[Abstract] [Full Text] -
Warnick, C. T., Dabbas, B., Ford, C. D., Strait, K. A.
(2001). Identification of a p53 Response Element in the Promoter Region of the hMSH2 Gene Required for Expression in A2780 Ovarian Cancer Cells. J. Biol. Chem.
276: 27363-27370
[Abstract] [Full Text] -
Song, Y.-J., Stinski, M. F.
(2002). Effect of the human cytomegalovirus IE86 protein on expression of E2F-responsive genes: A DNA microarray analysis. Proc. Natl. Acad. Sci. USA
99: 2836-2841
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»