Previous Article | Next Article 
Journal of Virology, October 1998, p. 8384-8391, Vol. 72, No. 10
Medical Clinic III,
Received 17 February 1998/Accepted 12 June 1998
We previously described that type B retrovirus-like particles
released from the human mammary carcinoma cell line T47D are pseudotypes and package retroviral RNA of different origins (W. Seifarth, H. Skladny, F. Krieg-Schneider, A. Reichert, R. Hehlmann, and
C. Leib-Mösch, J. Virol. 69:6408-6416, 1995). One
preferentially packaged retroviral sequence, ERV-MLN, has now been used
to isolate the corresponding full-length provirus from a human genomic
library. The 9,315-bp proviral genome comprises a complete retroviral
structure except for a 3' long terminal repeat (LTR) truncation. A
lysine tRNA primer-binding site and phylogenetic analyses assign this human endogenous retroviral element, now called HERV-K-T47D, to the
HML-4 subgroup of the HERV-K superfamily. The gag,
prt, pol, and env genes exhibit 40 to 60% amino acid identity to HERV-K10. HERV-K-T47D is located on
human chromosome 10, with five closely related elements on chromosomes
8, 9, 15, 16, and 19 and several hundred HERV-K-T47D-related solitary
LTRs dispersed over the human genome. HERV-K-T47D-related sequences are
detected in the genomes of higher primates and Old World monkeys but
not in those of New World monkeys. High HERV-K-T47D transcription
levels were observed in human placenta tissue, whereas transcription in
T47D cells was strictly steroid dependent.
Human endogenous retroviral
sequences (HERVs) are inherited genomic elements with structural
features of integrated retroviruses. To date, HERVs are estimated to
comprise at least 1% of the human genome (for reviews, see references
14, 16, and 44). The biologically
most active HERVs are members of the HERV-K superfamily (for a review,
see reference 20). Members of this family are characterized by the presence of primer binding sites (PBSs) for lysine
tRNA, hence the designation K. They represent about 70 to 100 elements
and a large number of solitary long terminal repeats (LTRs) in the
human genome. These elements are related to type A, B, and D
retroviruses and have been classified by alignments of short stretches
of the reverse transcriptase (RT) domain into six different groups
(HML-1 to -6) (23). The members within a subgroup are more
than 85% identical, whereas the intersubgroup similarity does not
exceed 75%. To date, full-length proviral elements from only subgroups
HML-2 and -6 have been isolated and completely sequenced.
The group HERV-K(HML-6), which is the least closely related to mouse
mammary tumor virus, comprises about 30 to 40 members with 40 to 68%
nucleotide sequence similarity to mouse mammary tumor virus and
intracisternal type A particles of the mouse and hamster
(24). In addition to proviral sequences, about 50 solitary HML-6-related LTRs are found per haploid genome.
The HERV-K(HML-2) group consists of approximately 30 members with
full-length genomes, a few elements with large deletions (23, 25,
31), and an estimated 10,000 to 25,000 solitary LTRs distributed
throughout the human genome (15). The prototype HERV-K(HML-2) provirus is HERV-K10, which to date is the only completely sequenced full-length provirus of this group
(31). HERV-K10 and most HERV-K10-related proviruses harbor a
characteristic deletion of 292 nucleotides (nt) leading to a defective
genome with a polymerase gene fused to the envelope gene. However,
transcripts of other HERV-K-related proviruses with uninterrupted
pol and env open reading frames have been
detected in human teratocarcinoma cell lines (18, 19, 42),
and gag and pol gene products of HERV-K(HML-2)
family members have been demonstrated to be enzymatically active
(12, 28, 37). The env gene of HERV-K-IDDM, which was isolated from patients with acute-onset type I diabetes, was found
to encode an endogenous superantigen (4). These studies suggest that some proviruses of the HERV-K superfamily have the potential to encode functional retroviral enzymes, possibly even with
sufficient genetic information for the formation of retrovirus-like particles, which have been observed in normal human placentas, oocytes,
and fetuses (9, 13, 21, 26), in both malignant and
nonmalignant breast tissue samples (1, 10, 11, 27), and in
germ cell tumors or cell lines derived from these tissues (17). However, there remain many questions with regard to
the biological significance or function of these particles,
particularly since they appear to be generated by complementation
between several expressed HERVs, resulting in pseudotype particles with
retroviral RNA of different types (2, 32, 38). Such
packaging mechanisms could lead to unforeseen consequences in the use
of retroviral vectors in gene therapy or following interspecies organ
transplants.
Previously, using degenerate primers from a conserved region of
retroviral pol genes (39), we repeatedly
amplified three different retroviral sequences from particles released
by the human mammary carcinoma-derived cell line T47D (38).
One predominant sequence showed about 65% sequence identity to
HERV-K10 within the RT region. By screening a human genomic library
with the amplified product, we isolated a proviral pol
sequence which we preliminarily termed ERV-MLN. The question was
whether ERV-MLN is derived from an endogenous provirus with functional
retroviral gene products, particularly with the packaging capabilities
of Gag proteins. Therefore, we completely analyzed its proviral
structure and genomic organization. Sequence comparisons assigned this
novel HERV to the HML-4 subgroup of HERV-K elements. We also determined
the chromosomal location and expression pattern of the provirus, now called HERV-K-T47D.
Classification of the HERV-K-T47D provirus.
We previously
isolated and cloned a human endogenous retroviral RT-related sequence
from particles released by the human breast cancer cell line T47D. This
pol fragment was used to isolate from a human genomic
library, as described previously, a number of hybridizing
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Proviral Structure, Chromosomal Location, and
Expression of HERV-K-T47D, a Novel Human Endogenous Retrovirus Derived
from T47D Particles
ABSTRACT
Top
Abstract
Text
References
TEXT
Top
Abstract
Text
References
clones
(38) that were entirely sequenced by the dideoxy chain
termination method (36). Two overlapping clones now
revealed that this element, previously termed ERV-MLN, comprises an
almost full-length proviral structure with an overall length of 9,315 bp (Fig. 1). Next to the 5' LTR (nt 1 to
943) is a putative tRNA PBS (nt 946 to 963) which, despite a 3-bp
mismatch, is most closely related to the complementary sequence of the
3' end of human lysine tRNA (CUU anticodon) (Fig.
2A). The
putative PBS is identical to that found in HERV-KC4 (6) and
is closely related to the PBSs of other HERV elements belonging to the
HERV-K superfamily. Therefore, ERV-MLN, a human endogenous retrovirus
with lysine tRNA as the most likely primer for reverse transcription
originating from retrovirus-like particles released by the T47D cell
line, is now referred to as HERV-K-T47D.
View larger version (10K):
[in a new window]
FIG. 1.
Proviral organization of HERV-K-T47D, locations of
hybridization probes, and regions of amino acid identity to HERV-K10.
DNA fragments used as hybridization probes are shown as black bars
(LTR, probe 1, 229 bp; pol, probe 2, 2.9-kb
HindIII-HindIII fragment). Six regions
with amino acid identity to HERV-K10 were identified and are depicted
as shaded boxes A to F. Abbreviations: du, dUTPase; prt, protease; pol,
polymerase; env, envelope. HERV-K-T47D fragments (BB1.2, nt 25 to 1243, 1,218 bp; SH1.5gag, nt 1062 to 2517, 1,455 bp) employed for the
construction of recombinant pBL luciferase reporter plasmids used in
transient transfection experiments are shown as open bars at the top of
the figure. LTR 
indicates the truncated 3' LTR.
View larger version (100K):
[in a new window]
View larger version (91K):
[in a new window]
View larger version (28K):
[in a new window]
FIG. 2.
(A) Nucleotide sequence of HERV-K-T47D proviral DNA.
LTRs are enclosed in brackets, and the inverted termini TGT and ACA are
indicated by arrows. Transcriptional regulatory sequences, i.e., c/EBP,
Gfi-1, AP-1, Ik-1, a glucocorticoid-responsive element (GRE),
enhancer-like elements, a putative TATA box, a polyadenylation signal,
and polyadenylation sites (CA and TA), are underlined once and labeled
above. PBS and the polypurine tract (ppt) are double underlined.
Sequence complementary to the 3' end of human lysine tRNA is depicted
below the PBS sequence, with lowercase letters being used for
mismatches. Translated amino acid sequences with significant homology
to HERV-K10 (31), shown under the nucleotide sequence in the
six shaded boxes A to F, are those of gag (box A, 40%
identity; box B, 49% identity), dUTPase-protease (box C, 59%
identity), RT-RNase H (box D, 59% identity), integrase (box E, 59%
identity), and env (box F, 58% identity). Frameshifts in
the amino acid sequence are indicated with slashes; asterisks
correspond to stop codons. Conserved zinc finger motifs (type
CX2CX4HX4C) in the NC (box B)
region are marked by underlining of the corresponding amino acids. (B)
Alignment of putative regulatory elements of the HERV-K-T47D 5' LTR
with corresponding elements from solitary HERV-K-T47D-related LTRs of
higher primates (33). Asterisks indicate binding sites which
would not have been found with the default parameters of MathInspector
(34). However, they were found when a lower threshold was
used. Dots and dashes show identical and missing nucleotides,
respectively. Under the binding site designations are search string
variables used by the program MathInspector. IR, inverted repeat.
Genomic organization and coding regions. Since a full-length HML-4 group provirus has not yet been identified, we used the well-characterized HERV-K10 (31), a member of the HML-2 subgroup, for alignments with a computer-assisted translation of the complete nucleotide sequence of HERV-K-T47D in order to analyze its genomic organization and identify putative reading frames. At the amino acid level, this revealed an HERV-K-T47D retroviral structure, comprising gag, prt, pol, and env genes (Fig. 2A), with six regions exhibiting significant protein similarity to HERV-K10, ranging from 40 to 60% homology (boxes A to F in Fig. 1 and 2A). Within the HERV-K-T47D gag gene, which tentatively extends from nt 1095, based on comparison with HERV-K10 and the location of a suitable methionine, to nt 3480, two regions with significant amino acid similarity to HERV-K10 were found (box A, nt 1058 to 1385, 40% homology; and box B, nt 2416 to 3308, 49% homology). As shown in Fig. 2A, box A corresponds to the amino-terminal part of the matrix protein, whereas box B comprises the carboxy-terminal half of the capsid (CA) protein and almost the entire nucleocapsid (NC) protein. These regions are separated by 1,235 nt displaying no significant nucleotide (or, hence, amino acid) identity to the corresponding region of HERV-K10, which is shorter and comprises only 627 nt. FASTA database searches based on the differing 608 nt of this sequence revealed an 89% nucleotide homology in a 203-bp overlap with a human CpG island (5). Within the NC protein of HERV-K-T47D, two Zn finger domains of the CX2CX4HX4C type were identified (nt 3114 to 3155 and nt 3237 to 3275). The first motif is defective, lacking the initial Cys, whereas the second Zn finger is intact. A third conserved HERV-K-T47D region (box C in Fig. 1 and 2A) extends from nt 3510 to 4250. It exhibits 59% amino acid identity to the corresponding region of HERV-K10 and comprises the complete retroviral dUTPase (nt 3510 to 3883) and part of the retroviral protease (nt 3884 to 4340).
Retroviral pol genes are generally the most conserved sequences among retroviruses (22). This concurs with our observation that a 2.5-kb stretch of HERV-K-T47D pol (nt 4320 to 6998) shows a 60% overall amino acid identity to HERV-K10 (Fig. 2A, boxes D and E). The RT (nt 4341 to 5184) exhibits 65% identity, including some short stretches with almost absolute identity, while the tether region (nt 5185 to 5672), which connects the RT and RNase H protein domains, is less conserved (47% amino acid identity). RNase H (nt 5673 to 6086) shows 50% identity to HERV-K10, including a common feature of retroviral RNase H proteins, the DEDD motif. The env gene of HERV-K-T47D shows the least homology to HERV-K10, with the exception of the transmembrane domain (TM). At the amino terminus of the HERV-K-T47D TM, a region with 59% amino acid identity to HERV-K10 is found (Fig. 1 and 2A, box F, nt 8347 to 8991). Specifically, two clusters of hydrophobic amino acids (nt 8401 to 8478 and 8931 to 8970) are highly conserved (86% identity). The 3' end of HERV-K-T47D env is followed by a polypurine tract (nt 9046 to 9059), which is a conserved motif of the retroviral env-LTR border. Despite their well-defined structure, the coding regions of HERV-K-T47D are interrupted by nonsense and frameshift mutations. The putative LTRs of HERV-K-T47D were defined by aligning the sequences flanking the proviral coding regions at the 5' and 3' ends. Sequence repeats of 254 bp which differ from one another in 23 positions (91% homology) were identified. However, database searches revealed that the 943-bp region from the 5' end of HERV-K-T47D exhibits 70% homology to a solitary retroviral LTR sequence at the human RNU2 locus on chromosome 17q21 (33). This LTR can be traced back to a complete retroviral element of 6 kb which still exists in the corresponding chromosomal locus of the baboon. During primate evolution, excision of the provirus by homologous recombination created the solitary LTR now found in the genomes of the chimpanzee, gorilla, orangutan, and human (33). This LTR is considered to be associated with the concerted evolution of the tandem array encoding U2 snRNA. Direct sequence alignment of this solitary RNU2 LTR with the ends of HERV-K-T47D revealed that its 5' LTR is intact whereas the 3' LTR is truncated after nt 254. The 5' LTR is bordered by short inverted repeats (TGT...ACA) and is followed by an untranslated leader sequence of 150 bp (nt 944 to 1094) containing the PBS (nt 946 to 963). Several potential regulatory elements were identified by using the program ModelInspector (8). Putative binding sites for transcription factors C/EBP, Gfi-1, AP1, and Ik-1 were detected within the U3 region (Fig. 2A and B) by using the program MathInspector (34). These sequences were found to be conserved in solitary human and various solitary primate RNU2 LTRs (Fig. 2B). However, a putative TATA box at position 462 of HERV-K-T47D is not present in those solitary LTRs. A glucocorticoid-responsive element and two enhancer-like structures were also tentatively assigned (29). A polyadenylation signal [poly(A)] was detected in the 5' LTR but not in the 3' LTR, which is truncated in this region. Therefore, a poly(A) signal located either within the coding region of the provirus or within 3' cellular flanking sequences may be used to generate HERV-K-T47D mRNA. To examine these possibilities, we screened a cDNA library from steroid-induced T47D cells with an HERV-K-T47D LTR probe (Fig. 1, probe 1) generated by PCR with forward primer CCGAGGCAAGAGACTGAAGGCAC (nt 25 to 47) and reverse primer ACTTCTCACAATGTCCCTTCAGC (nt 232 to 254). We were not able to isolate an HERV-K-T47D cDNA by this method, but we obtained several clones containing cellular sequences which are polyadenylated by solitary HERV-K-T47D-related LTRs (data not shown). Based on these clones, we identified two possible poly(A) addition sites (CA and TA) within the HERV-K-T47D LTR. The poly(A) addition site observed in the majority of cDNA clones was used to assign the R-U5 border (Fig. 2A).Chromosomal location and evolution of HERV-K-T47D and related elements. Southern blot analysis was performed under high-stringency conditions as described previously (38) to determine the copy number and chromosomal location of HERV-K-T47D and closely related sequences in the human genome. HindIII-digested DNA from a panel of 24 human-rodent monochromosomal hybrid cell lines (mapping panel no. 2; NIGMS Human Genetic Cell Repository, Camden, N.J.) was hybridized to an HERV-K-T47D pol DNA fragment (Fig. 1, probe 2). The observed banding pattern suggests that HERV-K-T47D is located on human chromosome 10. Furthermore, five related elements, probably representing other members of the HERV-K(HML-4) family, could be assigned to chromosomes 8, 9, 15, 16, and 19. Southern blot analysis of human DNA samples digested with a set of restriction enzymes revealed that in addition to those proviral sequences, several hundred solitary HERV-K-T47D LTRs may exist in the human genome (Fig. 3A). As is known from studies of HERV-K(HML-2) (15) and HERV-H elements (7), multiple solitary LTRs are a common feature of HERV families. As evolutionary relics, they reflect high-level retrotransposon activity and subsequent homologous recombination during evolution.
|
Transcription of HERV-K-T47D in human tissues.
Regardless of
whether active, functional proteins are encoded, a crucial role of
HERVs may be their ability to act as promoters of either
immunologically related retroviral antigens or cellular genes or,
conversely, to act as premature transcription terminators. Since the
production and release of T47D particles is steroid dependent (11,
32, 38), T47D cells were treated with 10
9 M
estrogen for 48 h, at which time was added 108 M
progesterone, with subsequent incubation for 24 h (11,
30). Total RNA was prepared from steroid-treated and untreated
cells in accordance with a CsCl ultracentrifugation protocol
(35), separated by denaturing 1% formamide-agarose gel
electrophoresis, transferred to Zeta-Probe membranes (Bio-Rad, Munich,
Germany) by the vacublot procedure (Vacu-Gene XL; Pharmacia/LKB,
Freiburg, Germany), and hybridized with a 32P-labeled
HERV-K-T47D pol fragment (Fig. 1, probe 2) under
high-stringency conditions (5× SSC [1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate], 1% sodium dodecyl sulfate, 5× Denhardt's
solution, and 100 µg of denatured sheared herring sperm DNA per ml
for 16 h at 65°C). Expression of HERV-K-T47D was found
exclusively in steroid-stimulated T47D cells (Fig.
4A), therefore correlating well with the
production and release of HERV-K-T47D particles. The HERV-K-T47D
transcript was about 4.5 kb, which does not match the size of a
full-length or a regular spliced retroviral transcript.
|
) cells was blotted onto Hybond membranes. All
filters were probed with an HERV-K-T47D pol fragment (Fig.
Transcriptional activity of the 5' LTR of HERV-K-T47D. To examine the promoter activity of the putative 5' LTR of HERV-K-T47D in T47D cells, plasmids containing the luciferase reporter gene downstream of an LTR-containing DNA fragment of HERV-K-T47D were constructed (Fig. 1, BB1.2). The BB1.2 fragment was generated by PCR from the proviral sequence by using forward primer GCGGGATCCGAGGCAAGAGACTGAAGGCAC (nt 25 to 47) and reverse primer CGCGGATCCCTCAGTTGGAAACCAAGGGC (nt 1221 to 1243). Employing the newly introduced BamHI restriction sites, BB1.2 was cloned in both the sense (pBL-BB1.2s) and the antisense (pBL-BB1.2as) directions into the multiple cloning site of the luciferase expression vector pBL (Fig. 5A) (kindly provided by Karin Butz, German Cancer Research Center, Heidelberg, Germany). As a negative control, the SH1.5gag fragment was included in the T47D cell transfection experiments. Plasmid pBL-SH1.5gag (sense direction) was constructed by cloning a 1.5-kb SpeI-HindIII DNA fragment (Fig. 1) into pBL. Amplification of this fragment was performed with forward primer GCGACTAGTTGGGCACTCAGAGTATCTCAG (nt 1062 to 1087) and reverse primer GCGAAGCTTCTGCTAAGGATTTTCGGGCGG (nt 2488 to 2517). As a positive control, a transcriptionally active HERV-H LTR was used (7). A 393-bp fragment containing the HERV-H promoter was amplified from clone H6 (kindly provided by D. Mager, Terry Fox Laboratory, Vancouver, British Columbia, Canada), using forward primer CGCGGATCCTGTCAGGCCTCTGAGCCCAA and reverse primer CGCAAGCTTATGTGAGCAACATGGCTGTT, and cloned via BamHI and HindIII restriction sites into pBL. The identity and correct insertion orientation of each construct were verified by nucleotide sequencing.
|
-actin-luciferase construct
used for internal standardization). The total amount of DNA per dish
was adjusted to 6.5 µg with pBluescript SK(+). Incubation was carried
out for 16 to 18 h at 37°C and 5% CO2. T47D cells
were then further incubated in fresh RPMI 1640 medium for 48 h.
T47D cells were treated with estradiol and then progesterone (in
dimethyl sulfoxide solvent), each for 24 h, as described by Keydar
et al. (11), while the control dishes received medium with
dimethyl sulfoxide alone. At 48 h postincubation (37°C, 5% CO2), cells were harvested and lysates were prepared
according to the recommendations of the Enhanced Luciferase Assay Kit
(Berthold Detection Systems, Pforzheim, Germany). Relative HERV
promoter activity was calculated as the ratio between the levels of
luciferase expression of the constructs and the pBL vector. Transient
expression of the constructs in T47D cells revealed that pBL-BB1.2s
displayed about the same relative transcriptional activity as the
active promoter of the HERV-H LTR (pBL-HERV-H). Upon steroid induction of T47D cells, an about twofold enhancement of luciferase activity was
observed (data not shown). This suggests that the 5' LTR of HERV-K-T47D
contains regulatory elements that are steroid dependent and can mediate
efficient transcriptional activity of HERV-K-T47D or other sequences in
T47D cells.
In conclusion, our results show that HERV-K-T47D is actively
transcribed in T47D cells in a steroid-dependent manner, and this
active transcription is easily accounted for by the promoter activity
and the presence of a number of putative transcription factor binding
sequences found in the 5' LTR. Such activity may also apply to a number
of related solitary LTRs which were also detected, perhaps resulting in
transcriptional activation of disease-associated antigens. However, the
HERV-K-T47D-specific transcript, containing only gag and
pol sequences, does not comprise a full-length proviral sequence but is presumably irregularly spliced or terminated. Since
HERV-K-T47D does not have the coding capacity for full-length structural proteins, the origin of the retroviral proteins responsible for particle formation and the RT activity found associated with T47D
particles (11, 32, 38) is still unclear. Particularly, the
gag gene, which is essential for virus packaging and
particle formation, is inactivated by stop codons and frameshifts in
HERV-K-T47D. As rescue experiments with defective retroviruses lacking
the gag, pol, and env open reading
frames suggest (41), these activities must be provided in
trans by other coding-competent HERV elements. Examples of
such coding-competent HERVs are members of the HERV-K(HML-2) subgroup,
transcripts of which have been detected in some human teratocarcinoma
cell lines (20, 42). Since we were not able to isolate
intact protein-coding HERVs from particle preparations, the packaging
signals of these genomes may be defective in order to prevent the
generation of replication-competent and possibly infective retroviral
particles. Particularly in light of the use of retroviral vectors in
gene therapy or the prospect of xenotransplantation (40,
43), identification of such HERV sequences and understanding the
mechanisms and risks of generating new, infectious retroviral particles
will be of major importance.
Nucleotide sequence accession number. The complete nucleotide sequence of HERV-K-T47D has been deposited in GenBank under accession no. AF020092.
| |
ACKNOWLEDGMENTS |
|---|
We thank Dixie Mager, Terry Fox Laboratories, Vancouver, for providing the HERV-H LTR clone H6 and C. Ross and J. Wienberg, European Cell Bank of Primates, for providing primate fibroblast cell cultures and blood. We further thank A. Arthur-Goettig for critically reading the manuscript.
This work was supported in part by the Commission of the European Union (contracts GENE-CT93-0019 and BIO4-CT95-0226), the Bayerische Forschungsstiftung (FORBIOSICH), and the Faculty of Clinical Medicine Mannheim, University of Heidelberg.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: III Medizinische Klinik, Klinikum Mannheim der Universität Heidelberg, Wiesbadener Strasse 7-11, D-68305 Mannheim, Germany. Phone: (49) 621 383-4103. Fax: (49) 621 383-4201. E-mail: seifarth{at}rumms.uni-mannheim.de.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. | Al-Sumidaie, A. M., C. A. Hart, S. J. Leinster, C. D. Green, and K. McCarthy. 1988. Particles with properties of retroviruses in monocytes from patients with breast cancer. Lancet ii:5-9. |
| 2. |
Boyd, M. T.,
B. Foley, and I. Brodsky.
1997.
Evidence for copurification of HERV-K-related transcripts and a reverse transcriptase activity in human platelets from patients with essential thrombocythemia.
Blood
90:4022-4030 |
| 3. |
Chen, C., and H. Okayama.
1987.
High-efficiency transformation of mammalian cells by plasmid DNA.
Mol. Cell. Biol.
7:2745-2752 |
| 4. | Conrad, B., R. N. Weissmahr, J. Böni, R. Arcari, J. Schüpbach, and B. Mach. 1997. A human endogenous retroviral superantigen as candidate autoimmune gene in type I diabetes. Cell 90:303-313[Medline]. |
| 5. | Cross, S. H., J. A. Charlton, X. Nan, and A. P. Bird. 1994. Purification of CpG islands using a methylated DNA binding column. Nat. Genet. 6:236-244[Medline]. |
| 6. | Dangel, A. W., A. R. Mendoza, B. J. Baker, C. M. Daniel, M. C. Carroll, L. C. Wu, and C. Y. Yu. 1994. The dichotomous size variation of human complement C4 genes is mediated by a novel family of endogenous retroviruses, which also establishes species-specific genomic patterns among Old World primates. Immunogenetics 40:425-436[Medline]. |
| 7. |
Feuchter, A., and D. Mager.
1990.
Functional heterogeneity of a large family of human LTR-like promoters and enhancers.
Nucleic Acids Res.
18:1261-1270 |
| 8. | Frech, K., J. Danescu-Mayer, and T. Werner. A novel method to develop highly specific models for regulatory units detects a new LTR in GenBank which contains a functional promoter. J. Mol. Biol., in press. |
| 9. | Johnson, P. M., T. W. Lyden, and J. M. Mwenda. 1990. Endogenous retroviral expression in the human placenta. Am. J. Reprod. Immunol. 23:115-120. |
| 10. | Keydar, I., L. Chen, S. Karby, F. Weiss, J. Delarea, M. Radu, S. Chaitcik, and H. Brenner. 1979. Establishment and characterization of a cell line of human breast carcinoma origin. Eur. J. Cancer 15:659-670. |
| 11. |
Keydar, I.,
T. Ohno,
R. Nayak,
R. Sweet,
F. Simoni,
F. Weiss,
S. Karby,
R. Mesa-Tejada, and S. Spiegelman.
1984.
Properties of retrovirus-like particles produced by a human breast carcinoma cell line: immunological relationship with mouse mammary tumor virus proteins.
Proc. Natl. Acad. Sci. USA
81:4188-4192 |
| 12. | Kitamura, Y., T. Ayukawa, T. Ishikawa, T. Kanda, and K. Yoshiike. 1996. Human endogenous retrovirus K10 encodes a functional integrase. J. Virol. 70:3302-3306[Abstract]. |
| 13. | Larsson, E., O. B. Nilsson, P. Sundstrom, and S. Widehn. 1981. Morphological and microbiological signs of endogenous C-virus in human oocytes. Int. J. Cancer 18:551-556. |
| 14. | Leib-Mösch, C., R. Brack-Werner, T. Werner, M. Bachmann, O. Faff, V. Erfle, and R. Hehlmann. 1990. Endogenous retroviral elements in human DNA. Cancer Res. 50(Suppl. 1):5636-5642. |
| 15. | Leib-Mösch, C., M. Haltmeier, T. Werner, E.-M. Geigl, R. Brack-Werner, U. Francke, V. Erfle, and R. Hehlmann. 1993. Genome distribution and transcription of solitary HERV-K LTRs. Genomics 18:261-269[Medline]. |
| 16. | Leib-Mösch, C., and W. Seifarth. 1996. Evolution and biological significance of human retroelements. Virus Genes 11:133-145. |
| 17. |
Löwer, J.,
E. M. Wondrak, and R. Kurth.
1987.
Genome analysis and reverse transcriptase activity of human teratocarcinoma-derived retroviruses.
J. Gen. Virol.
68:2807-2815 |
| 18. |
Löwer, R.,
K. Boller,
B. Hasenmaier,
C. Korbmacher,
N. Müller-Lantzsch,
J. Löwer, and R. Kurth.
1993.
Identification of human endogenous retroviruses with complex mRNA expression and particle formation.
Proc. Natl. Acad. Sci. USA
90:4480-4484 |
| 19. | Löwer, R., R. R. Tönjes, C. Korbmacher, R. Kurth, and J. Löwer. 1995. Identification of a Rev-related protein by analysis of spliced transcripts of the human endogenous retroviruses HTDV/HERV-K. J. Virol. 69:141-149[Abstract]. |
| 20. |
Löwer, R.,
J. Löwer, and R. Kurth.
1996.
The viruses in all of us: characteristics and biological significance of human endogenous retrovirus sequences.
Proc. Natl. Acad. Sci. USA
93:5177-5184 |
| 21. | Lyden, T. W., P. M. Johnson, J. M. Mwenda, and N. S. Rote. 1994. Ultrastructural characterization of endogenous retroviral particles isolated from normal human placentas. Biol. Reprod. 51:152-157[Abstract]. |
| 22. |
McClure, M. A.,
M. S. Johnson,
D.-F. Feng, and R. F. Doolittle.
1988.
Sequence comparisons of retroviral proteins: relative rates of change and general phylogeny.
Proc. Natl. Acad. Sci. USA
85:2469-2473 |
| 23. |
Medstrand, P., and J. Blomberg.
1993.
Characterization of novel reverse transcriptase encoding human endogenous retroviral sequences similar to type A and type B retroviruses: differential transcription in normal human tissues.
J. Virol.
67:6778-6787 |
| 24. | Medstrand, P., D. L. Mager, H. Yin, U. Dietrich, and J. Blomberg. 1997. Structure and genomic organization of a novel human endogenous retrovirus family: HERV-K(HML6). J. Gen. Virol. 78:1731-1744[Abstract]. |
| 25. | Meese, E., E. Göttert, K. D. Zang, M. Sauter, S. Schommer, and N. Mueller-Lantzsch. 1996. Human endogenous retroviral element K10 (HERV-K10): chromosomal localization by somatic hybrid mapping and fluorescence in situ hybridization. Cytogenet. Cell Genet. 72:40-42[Medline]. |
| 26. | Mondal, H., and P. H. Hofschneider. 1982. Isolation and characterization of retrovirus-like elements from normal human fetuses. Int. J. Cancer 30:281-287[Medline]. |
| 27. |
Moore, R.,
M. Dixon,
R. Smith,
G. Peters, and C. Dickson.
1987.
Complete nucleotide sequence of a milk-transmitted mouse mammary tumor virus: two frameshift suppression events are required for translation of gag and pol.
J. Virol.
61:480-490 |
| 28. | Müller-Lantzsch, N., M. Sauter, A. Weiskircher, K. Kramer, B. Best, M. Buck, and F. Grässer. 1993. Human endogenous retroviral element K10 (HERV-K10) encodes a full length Gag homologous 73 kD protein and a functional protease. AIDS Res. Hum. Retroviruses 9:343-350[Medline]. |
| 29. |
Ono, M.
1986.
Molecular cloning and long terminal repeat sequences of human endogenous retrovirus genes related to types A and B retrovirus genes.
J. Virol.
58:937-944 |
| 30. |
Ono, M.,
M. Kawakami, and H. Ushikubo.
1987.
Stimulation of expression of the human endogenous retrovirus genome by female steroid hormones in human breast cancer cell line T47D.
J. Virol.
61:2059-2062 |
| 31. |
Ono, M.,
T. Yasunaga,
T. Miyata, and H. Ushikubo.
1986.
Nucleotide sequence of human endogenous retrovirus genome related to the mouse mammary tumor virus genome.
J. Virol.
60:589-598 |
| 32. | Patience, C., G. R. Simpson, A. A. Colletta, H. M. Welch, R. A. Weiss, and M. T. Boyd. 1996. Human endogenous retrovirus expression and reverse transcriptase activity in the T47D mammary carcinoma cell line. J. Virol. 70:2654-2657[Abstract]. |
| 33. | Pavelitz, T., L. Rusche, A. G. Matera, J. M. Scharf, and A. M. Weiner. 1995. Concerted action of the tandem array encoding primate U2 snRNA occurs in situ, without changing the cytological context of the RNU2 locus. EMBO J. 14:169-177[Medline]. |
| 34. |
Quandt, K.,
K. Frech,
H. Karas,
E. Wingender, and T. Werner.
1995.
MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data.
Nucleic Acids Res.
23:4878-4884 |
| 35. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 36. |
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467 |
| 37. | Sauter, M., S. Schommer, E. Kremmer, K. Remberger, G. Dölken, I. Lemm, M. Buck, B. Best, D. Neumann-Haefelin, and N. Mueller-Lantzch. 1995. Human endogenous retrovirus K10: expression of Gag protein and detection of antibodies in patients with seminomas. J. Virol. 69:414-421[Abstract]. |
| 38. | Seifarth, W., H. Skladny, F. Krieg-Schneider, A. Reichert, R. Hehlmann, and C. Leib-Mösch. 1995. Retrovirus-like particles released from the human breast cancer cell line T47-D display type B- and C-related endogenous retroviral sequences. J. Virol. 69:6408-6416[Abstract]. |
| 39. |
Shih, A.,
R. Misra, and M. G. Rush.
1989.
Detection of multiple, novel reverse transcriptase coding sequences in human nucleic acids: relation to primate retroviruses.
J. Virol.
63:64-75 |
| 40. | Stoye, J. P., and J. M. Coffin. 1995. The dangers of xenotransplantation. Nat. Med. 1:1100[Medline]. |
| 41. |
Tchenio, T., and T. Heidmann.
1991.
Defective retroviruses can disperse in the human genome by intracellular transposition.
J. Virol.
65:2113-2118 |
| 42. | Tönjes, R. R., C. Limbach, R. Löwer, and R. Kurth. 1997. Expression of human endogenous retrovirus type K envelope glycoprotein in insect and mammalian cells. J. Virol. 71:2747-2756[Abstract]. |
| 43. | Weiss, R. A. 1998. Transgenic pigs and virus adaptation. Nature 391:327-328[Medline]. |
| 44. | Wilkinson, D. A., D. L. Mager, and J. C. Leong. 1994. Endogenous human retroviruses, p. 465-535. In J. A. Levy (ed.), The Retroviridae, vol. 3. Plenum Press, New York, N.Y. |
Journal of Virology, October 1998, p. 8384-8391, Vol. 72, No. 10
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Contreras-Galindo, R., Kaplan, M. H., Leissner, P., Verjat, T., Ferlenghi, I., Bagnoli, F., Giusti, F., Dosik, M. H., Hayes, D. F., Gitlin, S. D., Markovitz, D. M.
(2008). Human Endogenous Retrovirus K (HML-2) Elements in the Plasma of People with Lymphoma and Breast Cancer. J. Virol.
82: 9329-9336
[Abstract] [Full Text] -
Frank, O., Verbeke, C., Schwarz, N., Mayer, J., Fabarius, A., Hehlmann, R., Leib-Mosch, C., Seifarth, W.
(2008). Variable Transcriptional Activity of Endogenous Retroviruses in Human Breast Cancer. J. Virol.
82: 1808-1818
[Abstract] [Full Text] -
Pichon, J.-P., Bonnaud, B., Cleuziat, P., Mallet, F.
(2006). Multiplex degenerate PCR coupled with an oligo sorbent array for human endogenous retrovirus expression profiling. Nucleic Acids Res
34: e46-e46
[Abstract] [Full Text] -
Seifarth, W., Frank, O., Zeilfelder, U., Spiess, B., Greenwood, A. D., Hehlmann, R., Leib-Mosch, C.
(2005). Comprehensive Analysis of Human Endogenous Retrovirus Transcriptional Activity in Human Tissues with a Retrovirus-Specific Microarray. J. Virol.
79: 341-352
[Abstract] [Full Text] -
Lavie, L., Medstrand, P., Schempp, W., Meese, E., Mayer, J.
(2004). Human Endogenous Retrovirus Family HERV-K(HML-5): Status, Evolution, and Reconstruction of an Ancient Betaretrovirus in the Human Genome. J. Virol.
78: 8788-8798
[Abstract] [Full Text] -
Reus, K., Mayer, J., Sauter, M., Zischler, H., Muller-Lantzsch, N., Meese, E.
(2001). HERV-K(OLD): Ancestor Sequences of the Human Endogenous Retrovirus Family HERV-K(HML-2). J. Virol.
75: 8917-8926
[Abstract] [Full Text] -
Liu, B., Wang, Y., Melana, S. M., Pelisson, I., Najfeld, V., Holland, J. F., Pogo, B. G-T.
(2001). Identification of a Proviral Structure in Human Breast Cancer. Cancer Res.
61: 1754-1759
[Abstract] [Full Text] -
Melana, S. M., Holland, J. F., Pogo, B. G-T.
(2001). Search for Mouse Mammary Tumor Virus-like env Sequences in Cancer and Normal Breast from the Same Individuals. Clin. Cancer Res.
7: 283-284
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»