INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

Epstein-Barr virus (EBV) is a lymphotropic human herpesvirus that latently infects B lymphocytes, resulting in a concomitant growth transformation of the infected cell. Infection is closely associated with several human cancers, including nasopharyngeal carcinoma and African Burkitt's lymphoma and also plays a role in several lymphoproliferative diseases in immunocompromised individuals. In vitro, the transforming potential of EBV is evidenced by its ability to immortalize B lymphocytes to grow indefinitely in culture. Immortalization is achieved through the expression of a relatively small subset of EBV-encoded genes that serve to establish and maintain cellular transformation (for a review, see reference 28).

Propagation of EBV from host to host is dependent upon the activation of an estimated 100 or more viral genes, culminating in the production of infectious virions (28). While these genes remain quiescent during latency, a switch in the genetic program leading to the expression of viral replication-associated genes can be accomplished in vitro by treatment of latently infected B lymphocytes with various reagents, including phorbol esters, butyrate, Ca⁺² ionophores, and anti-immunoglobulin (3, 14, 27, 35, 46, 50). Activation of the lytic cascade by cross-linking surface immunoglobulin or superinfection results initially in the expression of two viral genes, BZLF1 and BRLF1, which exhibit similar induction kinetics (maximal mRNA levels are reached between 2 and 4 h postinduction) (4, 17, 45). The BZLF1 gene product (referred to here as Zta but also called ZEBRA and EB1) has been shown to be a transcriptional activator (6, 8, 15, 20, 21, 32, 40, 47). Expression of Zta and Rta leads to the activation of early genes and ultimately to viral replication. Of all the viral transactivators examined, Zta is unique in that its expression alone can initiate the entire lytic cascade (9, 10, 25, 37), and regulation of Zta expression appears to be central to regulating entry into the lytic cycle.

Zta shares structural similarities with transcription factors of the basic leucine zipper family of proteins and is most closely related to proteins of the fos-jun extended family, and particularly Fos, with which it shares strong homology in the DNA binding domain (6, 15, 18, 22, 29, 31). Zta dimers bind to and activate transcription from AP-1 sites (15, 21, 47) as well as from specialized Z response elements present in the EBV lytic origins of DNA replication (32). In turn, Zta and AP-1-like sites present in the promoter region of BZLF1 play a critical role in the induction of Zta expression in response to anti-surface immunoglobulin antibodies, Ca²⁺ ionophores, or phorbol esters (7, 11, 19, 44, 47).

The BZLF1 promoter (Zp) exhibits very low basal activity which is potently upregulated by inducers of the viral lytic cycle (7, 11, 19, 44, 47). The region from bp 221 to +12 of Zp harbors the necessary cis elements for maintaining low basal activity and activation by lytic cycle-inducing agents (11, 19). Within this sequence, three distinct types of response elements have been defined (see Fig. 1). The first are A+T-rich sequences, termed ZI domains, four copies of which are interspersed in the promoter (ZIA-D). The second is represented by a unique element, ZII, which shares homology with consensus CRE/AP-1 binding sites (1, 12, 26, 30). The third is composed of two sites, termed ZIIIA and ZIIIB, which bind the BZLF1 gene product Zta (20). ZIIIA, but not ZIIIB, is an AP-1 response element (20). Induction of the BZLF1 gene appears to involve two steps: (i) initial activation of the promoter by inducers of the lytic cycle, mediated through the ZI and ZII domains, which results in low-level transcription of the BZLF1 gene; followed by (ii) autoactivation of the BZLF1 promoter, which is mediated through Zta binding to the ZIIIA and ZIIIB domains. It has previously been noted that Zta activation strongly synergizes with induction through the ZI and ZII domains (e.g., triggered by phorbol ester) (20). Thus, it has been proposed that the duration and magnitude of the initial signal may determine whether enough Zta is generated in an appropriate time interval to trigger the entire lytic cascade (20).

The ZI domains in Zp have recently been shown to bind the ubiquitous cellular transcription factors Sp1 and Sp3 (5, 33) and/or the myocyte enhancer factor 2D (MEF2D) (5, 34). The ZIA and ZID domains can bind Sp1, Sp3, or MEF2D, while the ZIB domain binds only MEF2D and the ZIC domain binds only Sp1 and Sp3 (Fig. 1). Notably, we have previously shown that induction of the EBV lytic cycle by cross-linking surface immunoglobulin is inhibited by the immunosuppressants cyclosporin A and FK506 (23), and more recently we have shown that this sensitivity is dependent on the presence of the Zp MEF2 sites (ZIA, ZIB, or ZID) in conjunction with the ZII domain (34). In this paper, we dissect the ZII domain and identify two distinct cis elements within this region, the previously noted CREB/AP-1 motif (16, 20, 42, 48) and a previously unrecognized negative cis element. The latter cis element represses both basal and activated transcription from Zp and is likely to play an important role in regulating reactivation of EBV.

View larger version (31K): [in this window] [in a new window]   FIG. 1.   (A) Schematic illustration of the critical cis elements and known factors binding to these sites with the region from bp 221 to +14 of Zp. Binding of c-Jun and ATFa to the ZII CRE/AP-1 motif has also been reported (48). ZIIR, hypothetical cellular repressor binding to the negative cis element upstream of the CRE/AP-1 motif in the ZII domain (see text). (B) Nucleotide sequence of Zp in the region of the ZID and ZII domains. Shown are the regions protected from DNase I digestion with nuclear extract prepared from EBV-negative BL cell lines (19). Also summarized are the mutations that were introduced into the ZIIR element, with their designated names indicated to the left (see text).

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Cell culture and transfections. The EBV-negative Burkitt's lymphoma B cell line DG75 was grown at 37°C in RPMI 1640 medium supplemented with 10% heat-inactivated fetal calf serum, 100 U of penicillin, and 100 mg of streptomycin per ml. DG75 cells were transfected by DEAE-dextran and dimethyl sulfoxide (DMSO) shock, as previously described (5). Briefly, 10⁷ cells per transfection were washed once with phosphate-buffered saline (PBS), and the cell pellet was resuspended in 0.5 ml of RPMI 1640 medium without serum. Cells were added to 0.5 ml of RPMI 1640 medium with DEAE-dextran (1 mg/ml) and 2 µg of plasmid DNA. After incubation at room temperature for 30 min, cells were subjected to DMSO shock (the addition of 0.5 ml of 20% DMSO for 2 min). Following washing with PBS, cells were resuspended in 10 ml of RPMI 1640 with 10% serum and cultured at 37°C in a 5% CO₂ incubator. For induction by tetradecanoyl phorbol acetate (TPA), ionomycin, or both, the final concentrations of reagents were 20 ng/ml (TPA) and 1 µM (ionomycin). Overexpression of the catalytic subunit of protein kinase A (PKA) was achieved employing a Rous sarcoma virus long terminal repeat-driven expression vector, which has previously been described (36).

CAT and luciferase reporter gene assays. Transfected cells were harvested 48 to 72 h posttransfection and washed once in PBS. For the chloramphenicol acetyltransferase (CAT) assay, cells were suspended in 100 µl of 0.25 M Tris-HCl (pH 7.5) and lysed by freeze-thawing three times. The cell lysate was collected after centrifugation, and the reporter gene assay was carried out as previously described (5, 24). The acetylated species of chloramphenicol were quantitated with a PhosphorImager (Molecular Dynamics). For assessing luciferase activity, cells were resuspended in cell lysis buffer, and the assay was performed according to the manufacturer's protocol (Promega).

Construction of reporter constructs. The 221ZpCAT reporter construct contains the BZLF1 promoter sequences from bp 221 to +12 and was constructed as described previously (5, 19). Artificial promoter constructs, 3×ZIB-ZII-GCAT and 3×ZIC-ZII-GCAT, were generated by cloning the indicated Zp elements upstream of the -globin TATA box driving expression of the CAT reporter gene in the modified pGL2 vector (5). The 3×ZIB element was cloned into the AvaI-XbaI restriction sites, and the ZII element was cloned into the XbaI-BamHI sites. The sequences of the Zp elements were as follows: 3×ZIB, 5'-CCGGGCACCAGCTTATTTTAGACACTTCCACCAGCTTATTTTAGA CACTTCCACCAGCTTATTTTAGACACTTCT-3'; 3×ZIC, 5'-CCGGGCTCCTCCTCTTTTAGAAACTACTCCTCCTCTTTTAGAAACTACTCCTCCT CTTTTAGAAACTAT-3'; and 1×ZII, 5'-CATAGACGTCCCAAACCATGACATCACAGAGGAG-3'. Some of the artificial promoter constructs were also cloned into the pGL-2 luciferase reporter plasmid (Promega).

EMSA. DG75 nuclear extract was prepared as described previously (2, 13), and aliquots were stored at 70°C. Double-stranded oligonucleotide probes for electrophoretic mobility shift assays (EMSA) were labeled with T4 polynucleotide kinase and [-³²P]ATP. EMSA reactions were performed in a total volume of 25 µl [20 mM Tris-HCl (pH 7.9), 10% glycerol, 0.1 M KCl, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, 1 µg of poly(dI-dC)(dI-dC), 5 µg of crude DG75 nuclear extract]. After incubation for 5 min at room temperature, ³²P-labeled probe (25,000 cpm) was added, and the incubation was continued for an additional 25 min. The reaction mixtures were loaded onto a 4% nondenaturing polyacrylamide gel and electrophoresed in 0.5× Tris-borate-EDTA (1× Tris-borate-EDTA is 90 mM Tris, 64.6 mM boric acid, and 2.5 mM EDTA [pH 8.3]). Competition assays were carried out with unlabeled double-stranded DNA oligonucleotides that were added prior to addition of probe. Supershift experiments were performed with 1 µg of antibody against ATF-1, ATF-2, CREB-binding protein, c-Jun, or c-Fos (Santa Cruz Biotechnology, Inc.). The sense strand sequences of the oligonucleotides used in the EMSA were ZII, 5'-ACGTCCCAAACCATGACATCACAGAGGAG-3' and ZIIcm3, 5'-ACGTCCCAAACCATGgtATCACAGAGGAG-3'.

DNase I footprinting. DNase I footprinting was performed basically as previously described (19). Eighty micrograms of nuclear extract was incubated with ³²P-labeled DNA in 10 mM Tris (pH 7.9), 0.5 mM EDTA, 0.5 mM dithiothreitol, 5% glycerol, and 2% polyvinylethanol with 1 µg of poly(dI-dC)(dI-dC) in a total volume of 50 µl. After incubation for 20 min at room temperature, DNase I was added, and the reaction was allowed to incubate for 30 s. Digestion was terminated by the addition of 120 µl of stop buffer (8 M urea, 0.5% sodium dodecyl sulfate, 5 mM EDTA), and the samples were subsequently extracted twice with phenol, twice with phenol-chloroform (1:1), and once with chloroform. The cleaved DNA was recovered by precipitation with ethanol, and the samples were separated on 8% denaturing (7 M urea) acrylamide gels as previously described (2).

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

The CRE/AP-1 site of the ZII domain is a positive cis element that is required for inducibility of Zp. Previous limited mutagenesis of Zp provided evidence that the CRE/AP-1 motif in the ZII domain is essential for induction of Zp by known lytic cycle inducers (11, 19). We have recently reported that the activity of multimerized ZI domains (one to three copies) cloned into an artificial promoter construct containing the -globin TATA box driving expression of the CAT reporter gene is greatly augmented by the presence of a single copy (1×) of the ZII domain (Fig. 2) (5, 7, 33, 34). However, when the ZII domain was multimerized (alone or in conjunction with three copies (3×) of the ZIC domain) and cloned upstream of a minimal promoter (-globin TATA box) driving CAT gene expression (3×ZII-GCAT or 3×ZIC-3×ZII-GCAT), these reporter constructs failed to exhibit any detectable basal or phorbol ester-inducible activity. This observation suggested that the ZII domain may be composed of multiple cis elements, which can lead to either activation or repression of transcription.

View larger version (40K): [in this window] [in a new window]   FIG. 2.   Activities of a series of artificial promoter constructs containing the ZIC and ZII domains, cloned upstream of the rabbit -globin TATA box driving transcription of the CAT gene (5). A representative CAT assay is shown alongside the schematic illustrations of the artificial promoter constructs. The activities of the 1×ZII-gCAT, 1×ZIC-1×ZII-gCAT, and 3×ZIC-1×ZII-gCAT reporter constructs have been previously published (5) and are shown here for comparison with the activities of the reporter constructs containing multiple copies of the ZII domain. The reporter constructs were transiently transfected into the EBV-negative BL cell line DG75, as described in Materials and Methods. As indicated, the activities of each construct were assayed in the absence and presence of TPA (final concentration, 10 ng/ml).

View larger version (21K): [in this window] [in a new window]   FIG. 3.   Impact of mutations in the CRE/AP-1 motif within the ZII domain on TPA and/or ionomycin inducibility of the 3×ZIB-1×ZII-gLuciferase reporter construct. The artificial promoter construct, 3×ZIB-1×ZII-gLuciferase, was generated as described in Materials and Methods. The mutations introduced into the ZII domain are shown in the inset. The EBV-negative BL cell line DG75 was transiently transfected, and cell lysates were collected 48 h posttransfection, as described in Materials and Methods. The final concentrations of TPA and ionomycin were 10 ng/ml and 1 µM, respectively. The fold inductions were calculated based on the activities of the uninduced wt construct. The data shown represented the results from two independent experiments, and the standard errors of the means are indicated.

View larger version (57K): [in this window] [in a new window]   FIG. 4.   EMSA with 32P-labeled probes containing either the wt ZII domain, or the indicated mutation in the ZII CRE/AP-1 motif. Crude nuclear extract from the DG75 cell line was used, as described in Materials and Methods. The nucleotide sequences of the ZII domain mutants are shown in the inset in Fig. 3. EMSA binding reaction conditions were as described in Materials and Methods. The specific complexes formed are indicated by arrows to the left of the gel.

ATF-1 and ATF-2 bind to the CRE/AP-1 site in the ZII domain. To address what cellular factors are bound to the CRE/AP-1 motif in the ZII domain, we demonstrated that an oligonucleotide containing a consensus CRE site could compete for the formation of the complexes observed by EMSA with the wt ZII domain probe (Fig. 5A). In addition, when a pan-CREB rabbit polyclonal antibody (antiserum 244; raised against a peptide containing residues 128 to 162 of the human CREB-1 protein, a region that is well conserved in a number of CREB/ATF family members [49]), was incubated with the EMSA reaction, the lower complex disappeared and a faint supershift above the slower migrating complex was detectable (Fig. 5A). In other assays, this antibody resulted in a stronger supershift, as shown in Fig. 5C (-creb). Incubation of the ZII domain probe with recombinant CREB-1 protein revealed the formation of a complex that migrated similarly to the lower complex observed by EMSA with DG75 nuclear extract (Fig. 5A). Addition of the pan-CREB rabbit polyclonal antibody to the EMSA reaction containing the recombinant CREB-1 protein resulted in a supershift that migrated at a position similar to that of the upper complex observed by EMSA with DG75 nuclear extract. Thus, it is possible that with DG75 nuclear extract, addition of the rabbit polyclonal antibody to the EMSA reaction results in a supershifted lower complex that comigrated with the upper complex, while a supershift of some or all of the upper complex may account for the appearance of the slower migrating supershifted complex.

View larger version (39K): [in this window] [in a new window]   View larger version (64K): [in this window] [in a new window]   FIG. 5.   Analysis of cellular factors binding to the ZII domain. (A) Competition for binding to the ZII DNA probe with wt and cm4 mutant ZII domain oligonucleotides, as well as an oligonucleotide containing a consensus CREB binding site (100 ng of each cold oligonucleotide competitor was added to the EMSA binding reaction). In addition, the ability of a pan-CREB antibody (see text) to supershift the observed complexes is also shown, as well as binding or recombinant CREB protein. Conditions for the EMSA, antibody supershifts, and binding of recombinant CREB protein are described in Materials and Methods. (B and C) Antibody supershifts of specific complexes employing antibodies against specific CREB/ATF or AP-1 family members. For each supershift assay, 1 µg of antibody was added to the EMSA reaction as described in Materials and Methods. All antibodies were purchased from Santa Cruz Biotechnology, Inc.

View larger version (26K): [in this window] [in a new window]   FIG. 6.   Analysis of cAMP inducibility of reporter constructs driven by Zp or the Zp(cm4) mutant. (A) DG75 cells were transiently transfected with the 221ZpLuciferase reporter construct along with a vector driving expression of the catalytic subunit of protein kinase A, as described in Materials and Methods. Transfected cells were treated for the indicated times with TPA (10 ng/ml) and ionomycin (1 µM), followed by assaying firefly luciferase activity on a Tuner Designs luminometer (Promega). The activities observed under each condition are given in relative light units. The data were compiled from six independent experiments and the standard errors of the means are shown. (B) DG75 cells were transiently transfected with either the 221ZpCAT or the equivalent reporter construct containing a mutation in the CRE/AP-1 motif [221Zp(cm4)CAT] as described in Materials and Methods. Transfected cells were either not treated or treated for 48 h with the indicated reagents. The cells were harvested 48 h posttransfection and assayed for CAT activity. Fold induction relative to the activity of the uninduced 221ZpCAT reporter construct is shown. CPT-cAMP was used at a final concentration of 0.3 mM. TPA was added to a final concentration of 10 ng/ml, and ionomycin was added to a final concentration of 1 µM. The data are compiled from three independent experiments and standard errors of the means are shown.

Mutations upstream of the ZII domain CRE/AP-1 motif reveal a potent negative cis element. To identify other cis elements that might be present within the ZII domain, we introduced a series of 3-bp mutations (m1 through m3; see Fig. 7) upstream of the CRE/AP-1 motif. As described above, these mutations were cloned into the artificial promoter construct composed of three copies of the ZIB domain linked to a single copy of either the wt or mutated ZII domain upstream of the minimal -globin TATA box. Surprisingly, all three mutations introduced upstream of the CRE/AP-1 motif strongly enhanced Zp inducibility with the m2 mutation having the largest impact (>15-fold enhancement of TPA-plus-ionomycin-induced activity; Fig. 7). To ensure that this was not the result of unwittingly generating a binding site for a transcriptional activator, a distinct mutation (m2a; Fig. 1B) was introduced into the ZII domain. The activity of the m2a mutant was nearly indistinguishable from that of the m2 mutant (data not shown). The m4 mutation, which disrupts the CRE/AP-1 motif (this mutation is the same as the previously reported MII mutation [19]), nearly completely abrogated inducibility of the artificial promoter (Fig. 7).

View larger version (20K): [in this window] [in a new window]   FIG. 7.   Impact of mutations in the region upstream of the CRE/AP-1 motif in the ZII domain on the induction by TPA and/or ionomycin. The mutations shown in the inset were introduced into the ZII domain in the context of the 3×ZIB-1×ZII-gCAT reporter construct. The transfections were performed in DG75 cells, and the cell lysates were collected 48 to 72 h posttransfection for CAT assays. Their relative inductions of mutant 3×ZIB-ZII-CAT constructs are presented relative to the TPA-ionomycin-induced activity of the wt 3×ZIB-ZII. The data presented were compiled from four independent transfection and CAT assays, and standard errors of the means are shown.

View larger version (37K): [in this window] [in a new window]   FIG. 8.   Mutation of the ZIIR element in the context of the 221ZpCAT reporter construct. The mutation introduced into the ZIIR element (ZIIRm) is shown in Fig. 1. (A) The wt (221ZpCAT) and mutant reporter construct (221ZpRmCAT) were transiently transfected into the DG75 cell line, and CAT activity was assessed as described in Materials and Methods. Transfected cells were cultured in the presence or absence of TPA (20 ng/ml) and/or ionomycin (1 µM), as indicated. Activity is given relative to the TPA-plus-ionomycin-induced activity of the wt 221ZpCAT reporter construct. The inset shows the impact of the ZIIRm mutation on the basal, TPA-, and ionomycin-induced activities. The average induction by TPA plus ionomycin of the 221ZpCAT construct relative to the uninduced activity was 444-fold, while the average induction of the 221ZpRmCAT construct relative to the uninduced activity of the 221ZpCAT construct was 5,722-fold. The data presented represent four independent experiments, and the standard errors of the means are shown. (B) The activities of the wt (221ZpCAT) and mutant (221ZpRmCAT) reporter constructs were assessed in the EBV-positive BL cell line clone 16 (Cl-16) and the EBV-negative T-cell line Jurkat. Transfected cells were cultured in the presence of TPA (20 ng/ml) and ionomycin (1 µM). The ratios of the TPA-plus-ionomycin-induced activities of the mutant and wt reporter constructs are indicated. The data represent at least two independent experiments, and the standard errors of the means are shown.

Repression of promoter activity by the ZIIR cis element is context sensitive. To determine whether ZIIR can inhibit the activity of heterologous promoters, one and three copies of this cis element were cloned upstream of either the SV40 early promoter (Fig. 9A) or the herpes simplex virus thymidine kinase promoter (data not shown). In both cases, no repression of promoter activity was observed in the presence or absence of phorbol ester. As a negative control, three copies of the mutated ZIIR element (ZIIRm) were also cloned upstream of these heterologous promoters, and again no impact on promoter activity was observed (Fig. 9A and data not shown). Taken together, these data indicated that the position of ZIIR within a promoter may be critical for its function.

View larger version (28K): [in this window] [in a new window]   FIG. 9.   (A) Inability of the ZIIR element to repress transcription from the SV40 early promoter. One or three copies of the ZIIR element were cloned upstream of the enhancerless SV40 promoter as described in Materials and Methods. In addition, as a control, three copies of the mutated ZIIR element (ZIIRm; see Fig. 1) were also cloned upstream of the SV40 promoter. These reporter constructs were transiently transfected into the DG75 cell line, and uninduced and TPA induced activities were determined. The activities are presented as relative light units (rlu). The data represent the average of two independent experiments, and the standard errors of the means are shown. (B) Impact of mutating the ZIIR element in the context of the 3×ZIC-ZII-gCAT reporter construct. The 3×ZIC-ZII-gCAT reporter construct has been previously described (5). The data shown represent three independent assays, and the standard errors of the means are shown. The fold inductions were derived relative to the activity of the uninduced reporter construct.

View larger version (32K): [in this window] [in a new window]   FIG. 10.   Derepression observed by mutating the ZIIR element requires a functional CRE/AP-1 motif and/or functional MEF2D binding sites. Artificial promoter constructs containing various combinations of wt and mutant ZIB and ZII domains were transfected into the DG75 cell line, followed by induction with TPA (10 ng/ml) and ionomycin (1.0 µM). The activities of the reporter constructs are shown relative to the activity of the 3×ZIB-gCAT reporter construct, which was defined as 1.0. The activity of the 3×ZIB-1×ZIIm2-gCAT reporter construct is not shown (relative activity, >2,000). The data presented were compiled from two independent experiments, and the standard errors of the means are shown.

The relative positions of the MEF2D and CRE/AP-1 elements on the DNA helix affect TPA and ionomycin inducibility and are independent of the ZIIR domain. To determine whether the distance and orientation of the ZIB elements upstream of the ZII domain have an impact on activity and ZIIR function, several modified 3×ZIB-ZII-gCAT and 3×ZIB-ZIIm2-gCAT reporter constructs were generated. The distance between the ZII domain and the 3×ZIB cassette was increased by either 4, 10, or 15 bp. For both the 3×ZIB-ZII-gCAT (Fig. 11) and the 3×ZIB-ZIIm2-gCAT (data not shown) increasing the distance between the ZIB domains and the ZII domain by either 4 or 15 bp resulted in a dramatic reduction in the TPA, ionomycin, and TPA plus ionomycin inducibility. However, increasing the distance between these domains by 10 bp resulted in a slight enhancement in the inducibility of these constructs. This indicates that the phasing of the MEF2D and CRE/AP-1 cis elements on the DNA helix has a profound impact on the synergy observed. As depicted in Fig. 11, the original artificial promoter constructs were designed such that the cis elements were oriented on the same side of the helix (5).

View larger version (30K): [in this window] [in a new window]   FIG. 11.   Effect of alterations in the phasing of the MEF2D sites relative to the CRE/AP-1 motif. The 3×ZIB-ZII-gCAT reporter construct and derivatives containing a spacer between the ZII domain and the ZIB domains of the indicated length were transiently transfected into the DG75 cell line as described in Materials and Methods. Transfected cells were either untreated or induced with TPA (10 ng/ml) and/or ionomycin (1.0 µM). The activities were calculated relative to the TPA-plus-ionomycin-induced activity of the parent reporter construct (no spacer), which was defined as 1.0. The data represent the average of four independent experiments, and standard errors of the means are shown.

Characterization of cellular protein binding to the ZII domain fails to identify a specific complex formed with the ZIIR element. Based on the behavior of the ZIIR element, it seems likely that it functions through binding a cellular repressor. However, repeated attempts by EMSA have failed to identify a specific protein-DNA complex that is dependent on the ZIIR element. It should be noted that our original analysis of protein binding to Zp, by using DNase I footprinting with crude B-cell nuclear extracts, demonstrated at least partial protection of the ZIIR element (summarized in Fig. 1B) (19). Thus, to assess the possibility that the DNase I footprinting analyses detected binding of a cellular factor which cannot be readily identified by EMSA, DNase I footprinting employing both wt and mutant template and DG75 nuclear extract was carried out (Fig. 12). Surprisingly, mutation of ZIIR (ZIIrm) did not abrogate the protection of this region observed with DG75 nuclear extract (Fig. 12). This result suggests that the binding of MEF2D to the ZID domain and of CREB/ATF factors to the ZII domain is sufficient to prevent DNase I cleavage within the ZIIR element. Thus, neither EMSA nor DNase I footprinting analyses was able to provide direct evidence of cellular factor binding to ZIIR, leaving unresolved the mechanism by which this cis element functions.

View larger version (73K): [in this window] [in a new window]   FIG. 12.   DNase I protection analysis of the wt 221Zp and the ZIIRm mutant (221ZpRm) employing crude nuclear extract prepared from the DG75 cell. Protection of both the sense strand [Zp(+)] and the antisense strand [Zp()] was analyzed, as described in Materials and Methods. The positions of the ZII and ZID domains are indicated. Ext., DG75 nuclear extract present; No Ext., nuclear extract absent.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

In this report, we have dissected the functional elements within the ZII domain, a region previously identified as essential for Zp inducibility (5, 7, 11, 19, 20). A clearly recognizable CRE/AP-1 motif has been noted by a number of investigators, and in our original characterization of Zp we demonstrated that a mutation (MII) that disrupted this motif severely diminished TPA inducibility (19). More recently, two independent analyses of the ZII domain have been published (42, 48). Ruf and Rawlins (42) reported the characterization of a complex which they refer to as ZIIBC. This complex was reported to be composed of 26- and 36-kDa proteins and was shown to bind the ZII CRE/AP-1 motif. However, these investigators were unable, using antibody reagents against a wide panel of CREB and AP-1 family members, to identify the components of this complex. A detailed analysis of the factors binding to the ZII domain was also reported by Wang et al. (48), who identified 12 distinct DNA-protein complexes. These investigators were able to identify the presence of ATFa, ATF-1, ATF-2, and c-Jun in some of these complexes. In addition, they demonstrated that overexpression of ATF-1 led to activation of a Zp driven reporter construct. Notably, formation of some of the observed complexes was independent of the CRE/AP-1 motif, and may reflect binding to the ZIIR element.

In the analysis presented here, we identified two major complexes by EMSA and were able to demonstrate the presence of ATF-1, and perhaps CREB-1, in the lower complex and ATF-2 in the upper complex. Based on the results obtained by Wang et al. (48), it seems likely that the faster migrating complex we observe corresponds to the four closely migrating complexes which they refer to as group II, two of which they show contain ATF-1. Similarly, the upper complex we observed by EMSA likely correlates with the three closely migrating complexes that Wang et al. (48) refer to as group I, two of which they demonstrate contain ATF-2. Somewhat surprisingly, we failed to detect the apparently abundant complexes present in group IV. This may reflect differences in preparation of nuclear extracts or a failure to resolve these complexes from free probe in the gel. Notably, Wang et al. were not able to identify any of the cellular factors involved in forming the complexes present in either group III or group IV (fastest migrating complexes). At this point, it is unclear which cellular factor(s) is important for Zp function in vivo, although these investigators did demonstrate that overexpression of ATF-1 activated Zp (48) suggesting that ATF-1 may be important for Zp activity.

A number of negative cis elements have been identified in the region upstream of the BZLF1 gene transcription initiation site (38). Three binding sites for the cellular repressor YY1 have been identified in the region from bp 300 to 450 (38). Deletion of the two distal YY1 binding sites resulted in significant upregulation of promoter activity, while overexpression of YY1 was shown to downregulate Zp activity. In addition, five H1 motifs, which have been reported to function as negative cis elements, have been identified (43). Four of these map in the region from ca. bp 280 to 450 while the fifth maps just downstream of the ZII domain. Of the distal H1 motif, two overlap with identified YY1 binding sites (38). These investigators reported that binding to the distal H1 motifs was abrogated upon induction of the viral lytic cycle, suggesting that they are important for downregulating Zp activity during latency (43). Notably, with the exception of the H1 motif mapping downstream of the ZII domain, all the identified negative cis elements map upstream of bp 221. Thus, these distal negative cis elements cannot account for the extremely low basal activity exhibited by Zp driven reporter constructs containing sequences from bp 221 to +12.

In this paper, we have identified a potent negative cis element, ZIIR, which is likely to play an important role in downregulating transcription from Zp during latency. It is likely that ZIIR binds a cellular repressor, but to date we have failed to detect a specific protein complex binding to this domain. Alternatively, it is possible that one of the complexes that binds the CRE/AP-1 motif serves to repress transcription and that binding of this complex is sensitive to mutations in the region upstream of the CRE/AP-1 motif. If the latter is true, this complex either cannot be distinguished from the other CREB/ATF complexes observed by EMSA or cannot be detected by EMSA. DNase I footprinting of the ZpRm mutant indicated that the region of ZIIR is protected from DNase I digestion by B-cell nuclear extract, although methylation interference assays failed to identify any contacts within this region (data not shown). It is possible that in vivo footprinting may help illuminate this issue. In addition, generation of an EBV strain harboring the ZIIRm mutation will help provide definitive insight into the role of this negative cis element in regulating viral latency.