Previous Article | Next Article 
Journal of Virology, October 1998, p. 8205-8213, Vol. 72, No. 10
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Cleavage Susceptibility of Reovirus Attachment
Protein
1 during Proteolytic Disassembly of Virions Is
Determined by a Sequence Polymorphism in the
1 Neck
James D.
Chappell,1,2
Erik S.
Barton,2,3
Trent H.
Smith,1
Geoffrey S.
Baer,2,3
David T.
Duong,1
Max L.
Nibert,4 and
Terence S.
Dermody1,2,3,*
Departments of
Pediatrics1 and
Microbiology and
Immunology3 and
Elizabeth B. Lamb Center
for Pediatric Research,2 Vanderbilt University
School of Medicine, Nashville, Tennessee 37232, and
Institute
for Molecular Virology, University of Wisconsin, Madison, Wisconsin
537064
Received 6 March 1998/Accepted 18 June 1998
 |
ABSTRACT |
A requisite step in reovirus infection of the murine intestine is
proteolysis of outer-capsid proteins to yield infectious subvirion
particles (ISVPs). When converted to ISVPs by intestinal proteases,
virions of reovirus strain type 3 Dearing (T3D) lose 90% of their
original infectivity due to cleavage of viral attachment protein
1.
In an analysis of eight field isolate strains of type 3 reovirus, we
identified one additional strain, type 3 clone 31 (T3C31), that loses
infectivity and undergoes
1 cleavage upon conversion of virions to
ISVPs. We examined the
1 deduced amino acid sequences of T3D and the
eight field isolate strains for a correlation between sequence
variability and
1 cleavage. The
1 proteins of T3D and T3C31
contain a threonine at amino acid position 249, whereas an isoleucine
occurs at this position in the
1 proteins of the remaining strains.
Thr249 occupies the d position of a heptad
repeat motif predicted to stabilize
1 oligomers through
-helical
coiled-coil interactions. This region of sequence comprises a portion
of the fibrous tail domain of
1 known as the neck. Substitution of
Thr249 with isoleucine or leucine resulted in resistance to
cleavage by trypsin, whereas replacement with asparagine did not affect cleavage susceptibility. These results demonstrate that amino acid
position 249 is an independent determinant of T3D
1 cleavage susceptibility and that an intact heptad repeat is required to confer
cleavage resistance. We performed amino-terminal sequence analysis on
the
1 cleavage product released during trypsin treatment of T3D
virions to generate ISVPs and found that trypsin cleaves
1 after
Arg245. Thus, the sequence polymorphism at position 249 controls cleavage at a nearby site in the neck region. The relevance of
these results to reovirus infection in vivo was assessed by treating
virions with the contents of a murine intestinal wash under conditions that result in generation of ISVPs. The pattern of
1 cleavage susceptibility generated by using purified protease was reproduced in
assays using the intestinal wash. These results provide a mechanistic explanation for
1 cleavage during exposure of virions to intestinal proteases and may account for certain strain-dependent patterns of
reovirus pathogenesis.
 |
INTRODUCTION |
Following oral inoculation into
newborn mice, mammalian reoviruses undergo primary replication in
intestinal tissue and spread to the central nervous system
(64). However, not all reovirus strains are capable of
productive infection in intestinal tissue. Prototype type 3 reovirus
strain Dearing (T3D) grows poorly in the murine intestine after oral
inoculation. In contrast, prototype type 1 reovirus strain Lang (T1L)
grows well in intestinal tissue and is capable of systemic spread
(9, 32, 35, 54). Proteolytic processing of reovirus virions
in the intestinal lumen (6, 10) or in the endocytic
compartment (3, 11, 15, 56, 59) results in generation of
infectious subvirion particles (ISVPs) (48) and is
required for reovirus to establish productive infection of either
animal hosts (1, 6) or cultured cells (3, 19,
59). Under conditions that result in generation of ISVPs,
treatment of T3D virions in vitro with either chymotrypsin or trypsin
is associated with cleavage of viral attachment protein
1 and a
10-fold decrease in viral infectivity (46). Identical treatment of T1L is not associated with
1 cleavage or reduced infectivity. Strain-dependent differences in ISVP infectivity loss and
1 cleavage cosegregate in genetic analyses with the
1-encoding S1
gene, which indicates that cleavage susceptibility of T3D
1 protein
is an intrinsic property of this molecule and that infectivity loss
experienced by T3D ISVPs is causally linked to
1 cleavage
(46). Furthermore, studies of T1L × T3D reassortant viruses show that the S1 gene is the primary determinant of
strain-specific differences in growth of reovirus in the murine
intestine (9). These findings suggest that the infectivity
loss experienced by T3D following oral inoculation results from
susceptibility of its
1 protein to cleavage by intestinal proteases.
The
1 protein is a fibrous protein with a head-and-tail morphology
(4, 14, 24, 25). In virions,
1 exists as an oligomer
(7, 39, 58) located at the vertices of the virion icosahedron (20, 25). Results from genetic and biochemical studies of
1 protein suggest the presence of two discrete
receptor-binding domains in
1 of type 3 reovirus. A domain in the
tail is important for binding sialic acid (16, 17, 46, 55),
and a domain in the head is important for binding an unidentified
receptor on L cells (21, 45, 60, 67, 70) and determining
viral tropism within the murine central nervous system (8,
33). Binding of sialic acid by
1 is the basis for
hemagglutination (HA) by type 3 reovirus (2, 17, 26, 27, 49,
50) and growth of type 3 reovirus in murine erythroleukemia cells
(16, 55).
Following treatment of T3D virions with chymotrypsin to generate ISVPs,
monoclonal antibody (MAb) G5, which binds the T3D
1 head
(8), is markedly diminished in its capacity to bind viral
particles and neutralize infectivity (46). This result suggests that the
1 head is released from the viral particle following protease treatment of T3D virions. However, T3D ISVPs retain
the ability to bind cell surface sialic acid (46), which suggests that the
1 tail domain remains associated with ISVPs. Studies using protease treatment of
1 purified from virions
(70) and expressed
1 protein (22) indicate the
presence of a highly protease-sensitive region near the middle of
1
primary sequence. Based on predictions of
1 secondary structure
(47) and image reconstructions of
1 protein visualized by
electron microscopy (24), the protease-sensitive sequences
are proposed to represent a head-proximal flexible portion of the tail
termed the neck. These results have been reconciled in a model of T3D
ISVP formation in which
1 is cleaved within the neck region between
receptor-binding domains in the head and tail (46). However,
the site of
1 cleavage on T3D ISVPs has not been identified, and the
mechanism of cleavage sensitivity is unknown.
In this study, we performed experiments to determine the mechanism of
1 susceptibility to cleavage by intestinal proteases during
generation of ISVPs. Our results suggest that
1 cleavage sensitivity
is influenced by subunit interactions in the
1 oligomer. Furthermore, results from these studies strongly support the existence of discontiguous receptor-binding domains in the
1 head and tail (16, 46).
 |
MATERIALS AND METHODS |
Cells and viruses.
Spinner culture-adapted L cells were
grown in either suspension or monolayer cultures, using Joklik's
modified Eagle's minimal essential medium (Irvine Scientific, Santa
Ana, Calif.) supplemented to contain 5% fetal bovine serum (Summit
Biotechnology, Fort Collins, Colo.), 2 mM L-glutamine, and
100 U of penicillin, 100 µg of streptomycin, and 0.25 µg of
amphotericin per ml (Irvine). Spodoptera frugiperda (Sf21)
insect cells were grown in either suspension or monolayer cultures,
using Grace's medium (Gibco, Grand Island, N.Y.) supplemented to
contain 10% fetal bovine serum plus 100 U of penicillin, 100 µg of
streptomycin, and 0.25 µg of amphotericin per ml. Reovirus strain T3D
is a laboratory stock. Field isolate strains type 3 clone 9 (T3C9),
type 3 clone 18 (T3C18), type 3 clone 31 (T3C31), type 3 clone 43 (T3C43), type 3 clone 44 (T3C44), type 3 clone 45 (T3C45), type 3 clone
84 (T3C84), and type 3 clone 93 (T3C93) were obtained originally from
the collection of Leon Rosen (18, 51-53). Purified virion
preparations were made from second- and third-passage L-cell lysate
stocks of twice-plaque-purified reovirus as previously described
(25). To obtain purified virions containing 35S-labeled proteins, Easy Tag Express-[35S]
protein labeling mix (NEN, Boston, Mass.) was added to cell suspensions
(~12.5 µCi per ml) at the initiation of infection.
Baculovirus vector strains were derived from Autographa
californica nuclear polyhedrosis virus (AcMNPV;
Clontech Laboratories, Palo Alto, Calif.). Recombinant baculoviruses
containing wild-type and mutant S1 gene cDNAs were generated by cloning
into pBacPAK8 and pBacPAK9 baculovirus transfer vectors (Clontech),
followed by lipofection-mediated cotransfer of plasmid recombinants and linearized BacPAK6 AcMNPV DNA (Clontech) into Sf21 cells
according to the supplier's instructions. After 5 days of incubation,
recombinant virus clones were isolated by plaque purification on
monolayers of Sf21 cells and amplified by two passages in Sf21 cells.
Digestion of reovirus virions with intestinal proteases.
Purified reovirus virions at a concentration of 2 × 1012 particles per ml in virion storage buffer (150 mM
NaCl, 10 mM MgCl2, 10 mM Tris [pH 7.5]) were digested at
37°C with 200 µg of N
-p-tosyl-L-lysine chloromethyl ketone (TLCK)-treated bovine
-chymotrypsin (Sigma Chemical Co., St. Louis, Mo.) per ml for various intervals. Digestion reactions were stopped by adding 5 mM phenylmethylsulfonyl fluoride (Sigma) to the treatment mixtures and cooling at 0°C.
Determination of virus titer after protease treatment of reovirus
virions.
Virus titer after protease treatment of virions was
determined by plaque assay as previously described (62).
SDS-PAGE of reovirus structural proteins.
Discontinuous
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
was performed as previously described (37). In preparation
for electrophoresis, 35S-labeled viral particles in virion
storage buffer were mixed 1:1 with 2× sample buffer (250 mM Tris [pH
6.8], 4% 2-mercaptoethanol, 2% SDS, 0.02% bromophenol blue) and
incubated at 65°C for 5 min. Samples then were loaded into wells of a
10% polyacrylamide gel and electrophoresed at 25-mA constant current
until the dye front reached the bottom of the gel. Gels were dried onto
filter paper (Bio-Rad Laboratories, Hercules, Calif.) under vacuum and
exposed to Biomax MR film (Eastman Kodak Co., Rochester, N.Y.).
HA assay.
HA assays using virions and ISVPs were performed
as previously described (46).
Cloning and mutagenesis of S1 gene cDNAs.
The
1-encoding
S1 gene cDNAs of strains T3D, T3C9, and T3C84 were generated by using
reverse transcription-PCR (36) and cloned into the pCR2.1
vector (Invitrogen, San Diego, Calif.). S1 genes were amplified with
primers specific for the noncoding regions of the T3D S1 gene.
Site-directed mutants of the T3D S1 gene were produced by using the
splice-overlap-extension PCR technique (30). Primers bearing
desired mutations in the S1 gene were used in independent primary
reactions to generate S1 gene fragments having sequence complementarity
over the terminal 20 nucleotides. The complementary primer sets used
for mutagenesis were as follows (nucleotides differing from wild-type
T3D S1 sequence are underlined):
5'AGGCGCAATTGAGCAAAGTT3'/5'AACTTTGCTCAATTGCGCCT3' (Thr249
Ile),
5'AGGCGCACTTGAGCAAAGTT3'/5'AACTTTGCTCAAGTGCGCCT3'
(Thr249
Leu), and
5'AGGCGCAAATGAGCAAAGTT3'/5'AACTTTGCTCATTTGCGCCT3'
(Thr249
Asn). Reaction mixes included 0.5 µg of
recombinant pCR2.1 plasmid template, 0.2 µg of S1-specific primers,
200 µM each deoxynucleoside triphosphate, and 2.5 U of Pfu
DNA polymerase (Stratagene, La Jolla, Calif.) in a total volume of 50 µl of Pfu reaction buffer (Stratagene). Reactions were
subjected to 40 iterations of a thermal cycle consisting of 94°C for
1 min, 55°C for 2 min, and 72°C for 3 min. The final cycle was
followed by incubation at 72°C for 20 min. Primary PCR products were
resolved in a 1% Tris-borate-EDTA agarose gel containing ethidium
bromide, and the desired amplification product was allowed to migrate
onto DE-81 chromatography paper (Whatman, Maidstone, England) inserted
into the gel, followed by elution in a solution of 1 M LiCl, 10 mM Tris
(pH 7.6), and 1 mM EDTA in 20% ethanol. Eluted DNA was concentrated by
ethanol precipitation and reconstituted in water.
Secondary PCR products were amplified in reaction mixtures containing 1 pmol each of the two purified primary PCR products, 0.2 µg of
S1-specific primers complementary to T3D S1 gene segment termini, 200 µM each deoxynucleoside triphosphate, and 5 U of Taq DNA
polymerase (Promega, Madison, Wis.) in a total volume of 50 µl of PCR
Optimizer buffer (Invitrogen) adjusted to pH 9.0 and 2 mM
MgCl2. Thermal cycling parameters were identical to those listed for the primary reactions. Products from the secondary PCR were
gel purified and cloned into the pCR2.1 vector. Sequence fidelity was
confirmed for
1-encoding regions of all S1 gene cDNAs in recombinant
pCR2.1 constructs; nucleotide sequences were determined by automated
analysis using an ABI model 377 (PE-Applied Biosystems, Norwalk, Conn.)
or using phage T7 DNA polymerase (U.S. Biochemical, Cleveland, Ohio)
and [35S]ATP. Error-free S1 gene cDNAs then were cloned
into baculovirus transfer vectors.
Expression and purification of recombinant
1 proteins.
First- or second-passage recombinant baculovirus stocks were used to
infect Sf21 cell monolayers (107 cells) at a multiplicity
of infection of
1 PFU per cell. After 20 h of incubation,
culture medium was replaced with methionine-free Grace's medium
(Gibco) supplemented to contain 10% fetal bovine serum, 100 U of
penicillin, 100 µg of streptomycin, and 0.25 µg of amphotericin per
ml, and 15 µCi of [35S]methionine protein labeling mix
per ml. After an additional 48 h of incubation, cells were
harvested and resuspended in 1 ml of phosphate-buffered saline
containing 5 mM phenylmethylsulfonyl fluoride and Complete, Mini,
EDTA-free protease inhibitor cocktail (Boehringer Mannheim,
Indianapolis, Ind.). Cells were lysed by sonication, and supernatants
were cleared of debris by centrifugation. T1L
1-specific MAb 5C6
(63) conjugated to cyanogen bromide-activated Sepharose
(Pharmacia, Uppsala, Sweden) was used to deplete supernatants of
contaminant proteins that adsorb nonspecifically to antibody. Supernatants then were incubated with type 3
1-specific MAb G5 (13) conjugated to Sepharose. Beads containing adsorbed
1
protein were washed five times with buffer consisting of 50 mM Tris (pH 8), 1.2 M NaCl, 0.4% SDS, 0.2% Triton X-100, and 5 mM EGTA, followed by three washes with a solution of 50 mM triethanolamine (pH 11.6), 0.5 M NaCl, and 0.1% Triton X-100. Beads then were washed three times with
virion storage buffer.
Treatment of expressed
1 proteins with proteases.
Aliquots of
1-containing Sepharose beads in virion storage buffer
were incubated at 10°C with 0, 7.5, 22.5, or 67.5 µg of TLCK-treated bovine
-chymotrypsin per ml for 180 min or at 4°C with 0, 2, 6, or 18 µg N
-p-tosyl-L-sulfonyl
phenylalanyl chloromethyl ketone (TPCK)-treated bovine trypsin (Sigma)
per ml for 60 min. Reactions were mixed 1:1 with modified 2× protein
sample buffer (125 mM Tris [pH 6.8], 4% SDS, 10% 2-mercaptoethanol,
20% glycerol, 80 mM MgCl2, 0.02% bromophenol blue) and
incubated at 100°C for 5 min. Reaction products were resolved in an
SDS-10% polyacrylamide gel and visualized by autoradiography.
Identification of protease cleavage sites in
1 protein of T3D
ISVPs.
Purified virions of T3D at a concentration of 2 × 1013 particles per ml were digested at 15°C with 100 µg
of TPCK-treated bovine trypsin (Sigma) per ml for 30 min in virion
storage buffer supplemented to contain 0.05 mM TPCK. Reactions were
terminated by the addition of TLCK to a final concentration of 0.5 mM.
ISVPs were centrifuged at 125,000 × g for 1 h to
form a pellet. Supernatants containing the
1 cleavage product were
incubated with MAb G5 (1.0 mg of antibody per ml) conjugated to
Sepharose at 4°C overnight. Beads were washed three times in
radioimmunoprecipitation assay buffer (150 mM NaCl, 10 mM Tris [pH
7.4], 0.1% [wt/vol] SDS, 1% [wt/vol] sodium deoxycholate, 1%
[vol/vol] Nonidet P-40) and then incubated at 70°C for 10 min in
sample buffer without 2-mercaptoethanol. Supernatants were subjected to
electrophoresis in an SDS-20% polyacrylamide gel at 25-mA constant
current for 24 h, followed by equilibration of the gel in transfer
buffer (25 mM Tris [pH 8.3], 192 mM glycine) at 4°C for 30 min.
Proteins were electroblotted onto a polyvinylidene difluoride membrane
by using a Mini Transblot apparatus (Bio-Rad) operated at 30-V constant
voltage overnight. Protein bands were visualized by Coomassie blue
staining, and a band migrating at approximately 25 kDa was excised and
subjected to sequence analysis by Edman degradation using a Procise 492 protein sequencer (PE-Applied Biosystems, Foster City, Calif.).
The procedure for isolating a
1 cleavage product also was performed
with purified 35S-labeled T3D virions. In this case, ISVPs
contained in trypsin digests of virions were not removed prior to
addition of MAb G5. Polypeptides recovered with MAb G5 were subjected
to electrophoresis under reducing conditions in an SDS-14%
polyacrylamide gel and subjected to autoradiography. The Coomassie
blue-stained
1 cleavage product on the polyvinylidene difluoride
membrane was verified by comparison with the autoradiogram.
Assessment of
1 cleavage upon treatment of virions with a
murine intestinal wash.
Three-day-old NIH Swiss mice (Harlan
Sprague Dawley) were euthanized, and the entire small and large
intestine was resected. Contents of 20 intestines were harvested in a
total volume of 5 ml of virion storage buffer by repeated flushing
using a 1-ml syringe and 25-gauge needle. Suspended material was
removed by centrifugation at 23,000 × g for 30 min,
and clarified supernatants were used in reactions containing 4 × 1010 purified 35S-labeled reovirus virions.
Virions were digested at 20°C for 3.5 h in a total volume of 12 µl of virion storage buffer containing 0.5, 1.5, or 10 µl of
intestinal wash. Digestion reactions were mixed 1:1 with modified 2×
protein sample buffer, incubated at 100°C for 8 min, and subjected to
electrophoresis in SDS-10% polyacrylamide gels, followed by
autoradiography to visualize viral proteins.
 |
RESULTS |
Type 3 reovirus field isolate strains vary in infectivity and
1
cleavage during treatment with intestinal proteases to generate
ISVPs.
Treatment of virions of reovirus strain T3D with either
chymotrypsin or trypsin under conditions to generate ISVPs results in
approximately a 10-fold loss in infectivity and cleavage of
1
protein (46). To determine whether other type 3 reovirus strains also lose infectivity when converted to ISVPs, purified virions
of eight type 3 field isolate strains were treated with chymotrypsin
under conditions to generate ISVPs, and aliquots of the treatment
mixtures were titrated on L-cell monolayers (Fig. 1). Strain T3C31 was the only strain
other than T3D to exhibit a decrease in infectivity. Similar to ISVPs
of T3D, which lost about 90% of pretreatment infectivity, ISVPs of
T3C31 lost approximately 84% of the original infectivity of virions.
Changes in T3C31 infectivity recapitulated the kinetic profile observed
when chymotrypsin was used to generate ISVPs of T3D (46); a
slight increase in viral titer occurred at early time points of
protease treatment, followed by a rapid decline in titer that
approached its lowest point by 60 min of treatment (Fig.
2). Infectivity of the remaining field isolate strains was slightly (as much as twofold in the cases of T3C18
and T3C43) increased after treatment with chymotrypsin to generate
ISVPs. Consistent with the effect of chymotrypsin on viral infectivity,
strains T3D and T3C31 lost
90% of the original infectivity following
treatment with trypsin (data not shown). Thus, infectivity loss
associated with T3D ISVPs also is common to T3C31 ISVPs but is not a
universal property of type 3 reoviruses.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 1.
Changes in viral infectivity during generation of ISVPs
by using chymotrypsin. Purified virions of T3D, T3C9, T3C18, T3C31,
T3C43, T3C44, T3C45, T3C84, and T3C93 at a concentration of 2 × 1012 particles per ml were treated with chymotrypsin at
37°C for 180 min. Infectious titers of virion preparations before and
after treatment were determined by plaque assay using L cells. Changes
in viral infectivity are expressed as the ratio of log10
viral titer at 180 and 0 min of chymotrypsin treatment. Shown are the
means and standard deviations of three independent experiments.
|
|

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 2.
Time course of change in T3C31 infectivity during
generation of ISVPs by using chymotrypsin. Purified virions of strain
T3C31 at a concentration of 2 × 1012 particles per ml
were treated with chymotrypsin at 37°C. At the times indicated,
reactions were terminated, and infectious titers of virion preparations
were determined by plaque assay using L cells. Changes in viral
infectivity are expressed as the ratio of log10 viral titer
relative to 0 min of chymotrypsin treatment. Shown are the means and
standard deviations of three independent experiments.
|
|
To determine whether differences in viral infectivity of type 3 reovirus strains correlate with differences in susceptibility of their
1 proteins to proteolytic cleavage, viral proteins in chymotrypsin
treatment mixtures were analyzed by SDS-PAGE (Fig. 3). Findings consistent with generation
of ISVPs, loss of outer-capsid protein
3, and appearance of the
stable cleavage product,
, of outer-capsid protein µ1C were
observed in these experiments. Following treatment with chymotrypsin,
bands corresponding to
1 proteins of T3D and T3C31 were lost,
whereas bands corresponding to
1 proteins of the remaining seven
strains were not. Thus, changes in viral infectivity after chymotrypsin
treatment correlate with the status of
1 protein observed by
SDS-PAGE: strains that exhibit decreased infectivity have cleaved
1
proteins. These findings are in agreement with previous studies of
virions and ISVPs of T1L and T3D (46) and demonstrate a
consistent correlation between changes in viral infectivity and
1
cleavage susceptibility during generation of ISVPs.

View larger version (88K):
[in this window]
[in a new window]
|
FIG. 3.
Electrophoretic analysis of viral structural proteins of
type 3 reovirus strains following treatment with chymotrypsin to
generate ISVPs. Purified 35S-labeled virions of T3D, T3C9,
T3C18, T3C31, T3C43, T3C44, T3C45, T3C84, and T3C93 at a concentration
of 2 × 1012 particles per ml were treated with
chymotrypsin (CHT) at 37°C for 60 min. Equal numbers of treated and
untreated viral particles (2 × 1011) were dissociated
in sample buffer and loaded into wells of an SDS-10% polyacrylamide
gel. After electrophoresis, gels were prepared for fluorography and
exposed to film. Viral proteins are labeled.
|
|
Protease treatment of type 3 field isolate strains increases their
capacity to produce HA.
T3D ISVPs demonstrate an increase in HA
titer relative to T3D virions (46, 63), which suggests that
the HA domain in
1 protein is altered by a conformational change in
1 or further exposed by proteolysis of
3 and µ1/µ1C proteins
during generation of ISVPs. However, it is also possible that cleavage
of T3D
1 protein facilitates the enhanced capacity of T3D ISVPs to
produce HA. To determine whether chymotrypsin-mediated cleavage of
1 protein plays a role in increased HA titer, we treated purified virions
of the five HA-positive field isolate strains (T3C9, T3C18, T3C31,
T3C45, and T3C93) with chymotrypsin to generate ISVPs and then tested
the treatment mixtures for their capacity to agglutinate human type O
erythrocytes (Fig. 4). Commensurate with
an increase in T3D HA titer of approximately 10-fold, the HA titer of
the type 3 field isolate strains increased 4- to 16-fold following chymotrypsin treatment. Therefore, in contrast to changes in viral infectivity, the increased capacity of type 3 ISVPs to produce HA
relative to virions is independent of
1 cleavage status. These data
suggest that a domain of
1 protein important for HA is altered with
respect to conformation or environment during conversion of virions to
ISVPs.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 4.
Changes in viral HA capacity during generation of ISVPs
by using chymotrypsin. Purified virions of T3D, T3C9, T3C18, T3C31,
T3C45, and T3C93 at a concentration of 2 × 1012
particles per ml were treated with chymotrypsin at 37°C for 180 min.
HA activity of virion preparations was determined by endpoint titration
using human type O erythrocytes and serial dilutions of virus. Changes
in HA activity are expressed as the ratio of log2 HA titer
at 180 and 0 min of chymotrypsin treatment. Shown are the means and
standard deviations of three independent experiments.
|
|
Comparison of the deduced amino acid sequences of
1 proteins
link infectivity loss and
1 cleavage to amino acid 249.
The
correlation of sequence variability with biologic polymorphisms has
provided important information about structure-function relationships
in reovirus
1 protein (16, 17, 68). We previously determined the deduced
1 amino acid sequences of the eight field isolate strains used in this study and found a high degree of conservation among these strains and T3D (85 to 99% sequence
identity in pairwise sequence comparisons [18]).
Therefore, to identify sequences in
1 associated with infectivity
loss and
1 cleavage, we examined the
1 amino acid sequences of
T3D and the field isolate strains for residues unique to the
chymotrypsin-sensitive strains. The
1 sequences of six of these
strains, T3D, T3C43, T3C44, T3C45, T3C84, and T3C93, are very similar,
showing variation at only 19 of 455 total amino acid positions in
1
(18). Given that only T3D among these strains exhibits
chymotrypsin-mediated infectivity loss and
1 cleavage, we examined
the six
1 sequences for residues unique to T3D. Val22,
Ile88, Thr249, and Thr408 were
found to be unique to T3D, compared to Ile22,
Thr88, Ile249, and Ala408 in the
other strains; thus, one or more of these residues were considered
likely to be associated with chymotrypsin sensitivity of T3D
1. When
1 sequences of the more distantly related group of strains, T3C9,
T3C18, and T3C31, were examined, we noted that the
1 protein of
chymotrypsin-sensitive strain T3C31 has a threonine at amino acid
position 249; strains T3C9 and T3C18 possess an isoleucine at that
position, as do strains T3C43, T3C44, T3C45, T3C84, and T3C93 (Fig.
5). Thus, Thr249 is unique to
T3D and T3C31, which suggests that the amino acid residue at position
249 determines susceptibility of
1 protein to proteolytic cleavage.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 5.
Identification of residues important for infectivity
loss and 1 cleavage of reovirus strains T3D and T3C31. (A) Model of
1 structure. Predicted 1 secondary structure (47) and
morphologic domains of 1 [T(i), T(ii), T(iii), T(iv), and H]
described previously (24) are shown and scaled
proportionally to the domains identified in electron microscopic images
of 1 isolated from virions (24). Amino acid positions are
scaled according to their predicted relationships to individual 1
morphologic domains (47). (B) Alignment of 1 amino acid
sequences. Deduced 1 amino acid sequences of strains T3D and T3C31
were aligned with those of T3C9, T3C18, T3C43, T3C44, T3C45, T3C84, and
T3C93 (18) and examined for correlation of sequence
variability with viral infectivity changes and 1 cleavage
susceptibility during the generation of ISVPs by using chymotrypsin.
The 1 proteins of T3D and T3C31 contain a threonine residue at
position 249, whereas all other 1 proteins contain an isoleucine at
that position. Shown is an alignment of amino acid residues 239 through
252, which are proposed to form -helical coiled coil comprising a
portion of the 1 neck (47). In the alignment of 1
sequences, residues in boxes are found in the a or
d position of a heptad repeat motif characteristic of
-helical coiled coils (42). The mean (±standard
deviation) ratio of log10 viral titer at 180 and 0 min of
chymotrypsin treatment is shown for each strain.
|
|
Analysis of cleavage susceptibility of expressed
1 proteins
altered at amino acid position 249.
The importance of amino acid
residue 249 in cleavage of
1 by intestinal proteases was assessed
using baculovirus-expressed, purified T3D
1 proteins modified by
site-directed mutagenesis. Consistent with the chymotrypsin sensitivity
of virion-associated T3D
1 protein (Fig. 3), expressed wild-type T3D
1 protein was cleaved by chymotrypsin, resulting in the accumulation
of cleavage products of
30 kDa as assessed by SDS-PAGE (Fig.
6A). Mutant
1 proteins in which
Thr249 was replaced with isoleucine, leucine, or asparagine
also were cleaved by chymotrypsin. To determine whether chymotrypsin
sensitivity is a feature of type 3
1 proteins expressed and tested
under conditions used in this study, expressed
1 proteins of strains T3C9 and T3C84 were tested in protease assays using chymotrypsin and
trypsin (Fig. 7). Neither T3C9 nor T3C84
virions lose infectivity upon conversion to ISVPs by using chymotrypsin
(Fig. 1), and their
1 proteins are resistant to cleavage (Fig. 3).
However, expressed T3C9 and T3C84
1 proteins were cleaved following
treatment with chymotrypsin. These results indicate that cleavage of
the Thr249
Ile and Thr249
Leu mutant T3D
1 proteins by chymotrypsin is an inherent property of expressed
1
protein and that the role of amino acid position 249 in cleavage of
1 by chymotrypsin cannot be addressed using this experimental
system.

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 6.
Cleavage susceptibility of expressed T3D 1 protein
altered by site-directed mutagenesis. Wild-type (wt) and mutant
35S-labeled 1 proteins of T3D were expressed in Sf21
insect cells by using baculovirus vectors and purified by using
anti- 1 MAb G5. The threonine residue at amino acid position 249 of
T3D 1 was substituted with isoleucine (T249I), leucine (T249L), or
asparagine (T249N). (A) MAb G5-conjugated Sepharose containing
expressed 1 protein was treated with various concentrations of
chymotrypsin (CHT) at 10°C for 180 min. Treatment mixtures were
heated at 100°C in sample buffer and subjected to electrophoresis in
an SDS-10% polyacrylamide gel. Digestion products were visualized by
autoradiography. Positions of molecular weight standards (in
kilodaltons) are shown. Bands corresponding to full-length 1 are
indicated. , 0 to 67.5 µg
of chymotrypsin per ml. (B) MAb G5-conjugated Sepharose containing
expressed 1 protein was treated with various concentrations of
trypsin (TRY) at 4°C for 60 min. Treatment mixtures were processed as
described for panel A. , 0 to
18 µg of trypsin per ml.
|
|

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 7.
Cleavage susceptibility of expressed T3C9 and T3C84 1
proteins. 35S-labeled 1 proteins of T3C9 and T3C84 were
expressed in Sf21 insect cells by using baculovirus vectors and
purified by using anti- 1 MAb G5. MAb G5-conjugated Sepharose
containing expressed 1 protein was treated with various
concentrations of either chymotrypsin (CHT) at 10°C for 180 min or
trypsin (TRY) at 4°C for 60 min. Treatment mixtures were heated at
100°C in sample buffer and subjected to electrophoresis in an
SDS-10% polyacrylamide gel. Digestion products were visualized by
autoradiography. Positions of molecular weight standards (in
kilodaltons) are shown. Bands corresponding to full-length 1 are
indicated. , 0 to 67.5 µg
of chymotrypsin per ml or 0 to 18 µg of trypsin per ml.
|
|
ISVPs of T3D generated by using trypsin exhibit the properties of viral
infectivity loss and
1 cleavage characteristic of ISVPs generated by
using chymotrypsin (46). Therefore, we tested the effect of
trypsin on expressed
1 proteins, examining first the control
proteins, T3C9
1 and T3C84
1 (Fig. 7). These
1 proteins
exhibited resistance to cleavage by trypsin, which indicated that this
enzyme would be suitable to test the role of position 249 in
1
protease susceptibility. Wild-type T3D
1 protein was cleaved by
trypsin into two major fragments in the range of 25 kDa (Fig. 6B).
These stable cleavage products most likely represent the amino-terminal
25/26-kDa and carboxy-terminal 23/24-kDa fragments observed previously
following trypsin treatment of T3D
1 proteins purified from virions
(70) or expressed by recombinant baculovirus (22). Upon replacement of Thr249 with Ile, which
is found at position 249 in the seven chymotrypsin-resistant
1
proteins, T3D
1 was resistant to cleavage by trypsin, showing very
little loss in band intensity at the highest concentration of enzyme
used (18 µg per ml). In contrast, only a small fraction of intact
wild-type
1 remained at the lowest enzyme concentration (2 µg per
ml), and a full-length
1 band was barely detectable at higher
concentrations. Thus, an isoleucine at amino acid position 249 confers
resistance to
1 cleavage by the intestinal protease, trypsin.
We next ascertained whether there exists an absolute requirement for
isoleucine to confer protease resistance. Thr249 was
substituted with the isoleucine isomer, leucine. Like the Thr249
Ile mutant
1 protein, the
Thr249
Leu mutant was resistant to cleavage by trypsin
and underwent only moderate proteolysis at the highest concentration of
enzyme used (Fig. 6B). These results suggest that the critical
determinant of protease resistance is the presence of an apolar residue
at position 249. To test this hypothesis, we used an additional
1 mutant substituted at position 249 with the polar amino acid, asparagine. When treated with trypsin, the Thr249
Asn
mutant exhibited a cleavage profile virtually indistinguishable from
that of wild-type
1 (Fig. 6B). Thus, our findings suggest that
susceptibility of T3D
1 to proteolytic cleavage depends on the type
of amino acid at position 249, where apolar and polar residues
respectively confer cleavage resistance and sensitivity.
Identification of a cleavage site in the
1 protein of T3D ISVPs
generated by protease treatment of virions.
The site at which
trypsin cleaves T3D
1 during the generation of ISVPs was determined
by amino-terminal sequence analysis of the
1 cleavage product
liberated by protease treatment of purified virions. Virions were
treated with trypsin, and the carboxy-terminal fragment of
1 was
captured by using MAb G5, which binds the virion-distal head domain
(8) (Fig. 8A). Trypsin
treatment of T3D virions resulted in the loss of
3 protein and
appearance of the µ1C cleavage product,
, consistent with the
formation of ISVPs. A single
1 cleavage product of approximately 25 kDa was purified from the digestion reaction using MAb G5 and subjected
to eight cycles of Edman microsequencing. This analysis revealed the
unambiguous amino acid sequence Ile-Gly-Ala-Thr-Glu-Gln-Ser-Tyr,
which corresponds exactly to T3D
1 amino acid residues 246 to
253 (Fig. 8B). An arginine residue occupies amino acid position 245 of
T3D
1, and cleavage at this site is congruous with the action of
trypsin at the carboxy-terminal side of basic residues (12).
The sequence contained in residues 246 to 253 is not repeated elsewhere
in T3D
1. Therefore, results from amino-terminal sequence analysis indicate that virion-associated
1 protein is cleaved by trypsin between Arg245 and Ile246, which are proposed
to form a portion of the
1 neck (47).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 8.
Amino-terminal sequence analysis of 1 cleavage
products liberated during the generation of T3D ISVPs by using trypsin.
(A) Isolation of a 1 cleavage product by using anti- 1 MAb G5.
Purified 35S-labeled virions of T3D at a concentration of
2 × 1013 particles per ml were treated with 100 µg
of trypsin per ml at 15°C for 30 min. Cleavage products were purified
by using MAb G5-conjugated Sepharose, resolved in an SDS-14%
polyacrylamide gel, and visualized by autoradiography. Lane 1, 4 × 1011 untreated viral particles; lane 2, 4 × 1011 viral particles treated with trypsin; lane 3, supernatant from trypsin digest (shown in lane 2) after incubation with
MAb G5-conjugated Sepharose; lane 4, trypsin-generated virion cleavage
products (from a total of 2 × 1012 viral particles)
bound to MAb G5-conjugated sepharose. Viral proteins are labeled.
Positions of molecular weight standards (in kilodaltons) are indicated.
An arrow indicates the 1 cleavage product (lane 4) isolated by using
MAb G5-conjugated Sepharose. This band was used as a reference to
identify the Coomassie blue-stained 1 cleavage product (see
Materials and Methods) subjected to amino-terminal sequence analysis.
(B) Identification of the trypsin cleavage site in virion-associated
T3D 1 protein. Amino-terminal residues 1 through 8 of the
trypsin-generated 1 cleavage product are aligned with a region of
sequence proposed to form the 1 neck, amino acids 239 to 259 (47). Residues in boxes occur in the a or
d position of a heptad repeat motif characteristic of
-helical coiled coils (42). This alignment indicates that
trypsin cleaves 1 between Arg245 and Ile246
during the generation of ISVPs. The cleavage site in 1 primary
sequence is indicated by an arrow.
|
|
Use of a murine intestinal wash to test the stability of type 3
1 protein during proteolytic conversion of virions to ISVPs.
To
determine whether a natural milieu of intestinal enzymes would
reproduce the pattern of
1 cleavage susceptibility observed after
treatment of type 3 reovirus virions with purified chymotrypsin, virions were treated with the contents of an intestinal lavage from
newborn mice. As a control for resistance of
1 protein to proteolytic cleavage, we first treated virions of strain T1L with the
intestinal wash (Fig. 9). The
1
protein of this strain was shown previously to remain intact when ISVPs
are generated in vitro by using chymotrypsin or trypsin (46)
and when ISVPs are generated in the intestinal lumen of newborn mice
(10). SDS-PAGE analysis of viral proteins showed that
purified virions of T1L were converted to ISVPs upon treatment with the
intestinal wash. The
1 protein of these particles appeared fully
intact, which indicates that ISVPs generated by this method are
suitable for study of
1 susceptibility to proteolysis. Purified
virions of T3D, T3C9, T3C31, and T3C84 also were converted to ISVPs
upon treatment with the intestinal wash (Fig. 9). Bands corresponding to full-length T3C9 and T3C84
1 proteins were not significantly different from those of untreated virions, even at the highest concentration of intestinal wash (~83% [vol/vol]). However, the
1 proteins of T3D and T3C31 were very susceptible to cleavage under
these conditions;
1 protein bands of these strains were not
detectable at the lowest concentration of intestinal wash tested
(~4% [vol/vol]). Other than loss of
1 protein, there were no
remarkable differences between the ISVP protein profiles of the
1-unstable and
1-stable type 3 strains. The same cleavage profiles were observed when ISVPs were recovered in intestinal washes
following intragastric inoculation of newborn mice with 35S-labeled virions (data not shown). These results
mirror those obtained in assays using purified intestinal enzymes and
strongly suggest that strain-specific differences in
1 stability
observed in assays using in vitro-generated ISVPs are also exhibited in the intestinal lumen.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 9.
Analysis of viral structural proteins following
generation of ISVPs by using a murine intestinal wash. Purified
35S-labeled virions of T1L, T3D, T3C9, T3C31, or T3C84 at a
concentration of 3.3 × 1012 particles per ml were
treated with various concentrations of a murine intestinal wash (int.
wash) at 20°C for 3.5 h. Aliquots of 12 µl were heated at
100°C in sample buffer and subjected to electrophoresis in an
SDS-10% polyacrylamide gel, followed by autoradiography to visualize
viral proteins. Viral proteins are labeled. The 1 protein is
indicated by an arrow. , 0 to
83% (vol/vol) intestinal wash.
|
|
 |
DISCUSSION |
We report here the identification of an amino acid residue in the
neck region of T3D
1 protein, Thr249, that determines
susceptibility of
1 to proteolytic cleavage during ISVP formation.
Thr249 is not the site of protease action; rather, this
residue mediates cleavage at a nearby site, Arg245.
Algorithms to predict secondary structure suggest that the
1 neck
region is composed of sequences that form a four-stranded cross
sheet flanked by two short segments of
-helical coiled coil
(47), with Thr249 occupying a position expected
to stabilize interhelical contacts through hydrophobic interactions
(Fig. 5). The pattern of
1 protease sensitivity exhibited by type 3 reovirus ISVPs generated by using purified chymotrypsin was
recapitulated when ISVPs were generated by using the contents of a
murine intestinal wash. Our findings show that cleavage susceptibility
of T3D
1 protein is controlled indirectly by amino acid 249, perhaps
through an effect on subunit interactions. Furthermore, these results
establish a molecular model to explain viral infectivity loss in vitro
(46) and in vivo (9, 32).
Identification of an amino acid residue in T3D
1 protein that
determines susceptibility to cleavage by protease.
The
identification of a sequence polymorphism that correlates with
1
cleavage susceptibility was facilitated by the characterization of type
3 reovirus strains that vary in infectivity loss and cleavage of
1
following protease treatment of virions to generate ISVPs. By comparing
deduced
1 amino acid sequences of these strains, we found that both
infectivity loss and
1 cleavage exhibited by strains T3D and T3C31
are correlated with sequence polymorphism at a single amino acid
position in
1, residue 249 (Fig. 5). This correlation strongly
suggests that amino acid 249 is the sole determinant of type 3
1
cleavage by protease but does not exclude the potential contribution of
other amino acid positions where sequence similarity (as opposed to
sequence identity) is correlated with cleavage sensitivity. In
concordance with the sequence correlation, expressed
1 protein
substituted at Thr249 with an isoleucine was not cleaved by
trypsin, despite nearly complete cleavage of wild-type protein (Fig.
6B). This result confirms that the amino acid residue at position 249 is an independent determinant of
1 cleavage by protease.
Though conferring resistance to cleavage by trypsin, the
Thr249
Ile replacement did not prevent cleavage by
chymotrypsin (Fig. 6A). This result was unexpected since field isolate
reovirus strains containing an isoleucine residue at
1 amino acid
position 249 have chymotrypsin-resistant
1 proteins. However, our
results do not necessarily suggest different mechanisms of
1
cleavage sensitivity with respect to trypsin and chymotrypsin. It is
possible that baculovirus-expressed type 3
1 protein adopts a
conformation slightly different from that of virion-associated
1 and
that this conformation confers sensitivity to chymotrypsin cleavage by
a mechanism unrelated to sequence polymorphism at position 249. Alternatively, resistance of type 3
1 protein to cleavage by
chymotrypsin may require association of
1 with other proteins of the
reovirus virion, such as outer-capsid protein
3 or core-spike protein
2, both of which likely interact with
1 (20, 29, 34,
38, 63).
Sites of
1 cleavage during protease treatment of T3D virions to
generate ISVPs.
We determined the site of
1 cleavage on T3D
ISVPs to better understand properties of receptor binding by virion and
subvirion particles and to ascertain how amino acid position 249 influences
1 cleavage susceptibility. An approximately 25-kDa
trypsin-generated
1 fragment, purified with a monoclonal antibody
that binds the
1 head (8), was found to contain an
isoleucine residue at its amino terminus corresponding to
Ile246 (Fig. 8B). Arg245 is most likely the
singular site of trypsin cleavage since trypsin was found to cleave at
this exact position in expressed T3D
1 protein (22) and
additional processing of the trypsin-generated carboxy-terminal
fragment was not observed for expressed T3D
1 protein (21,
22, 40; Fig. 6B) or
1 purified from virions (70). Therefore, results of this analysis argue that
trypsin cleaves virion-associated
1 between Arg245 and
Ile246 and that the particle-associated
1 cleavage
product consists of amino acids 1 to 245.
We attempted to determine the site of
1 cleavage on ISVPs by
chymotrypsin. However, it was not possible to isolate a stable chymotrypsin cleavage product of
1 (5). This result is in agreement with the outcome of experiments using expressed
1 protein in which we observed an array of cleavage products after chymotrypsin treatment, unlike the two stable fragments generated by trypsin (Fig. 6
and 7). A different set of experimental conditions will be necessary to
identify the site of chymotrypsin cleavage in virion-associated
1.
Relationship of the neck region to receptor-binding domains in type
3
1 protein.
In studies of attachment by T3D ISVPs, we found
that following
1 cleavage, sequences in
1 that bind sialic acid
remain particle associated despite loss of a receptor-binding domain in
the
1 head (46). Residues in
1 shown to determine the
capacity of type 3 reovirus to bind sialylated receptors,
Asn198, Arg202, and Pro204, are
contained in a region of predicted cross
sheet in the
1 tail
immediately amino terminal to the neck (16, 17). Thus, we
have proposed a model of type 3
1 structure in which the neck region
bridges discrete attachment domains, one in the tail that binds sialic
acid and another in the head that binds an unidentified receptor
(16, 46). This model is supported by results of
amino-terminal sequence analysis of T3D
1 proteolytic cleavage
products liberated during the generation of ISVPs (Fig. 8B). The
cleavage site mapped by using trypsin is carboxy terminal to sequences
in the tail that determine sialic acid binding and amino terminal to
sequences in the head that bind a receptor on L cells (41, 45, 67, 70). Results of the sequence determination are also consistent with the finding that HA titers of T3D and T3C31 ISVPs were not lower
than those of intact virions (Fig. 4). In fact,
1 sequences that
bind sialic acid appear to be more accessible to sialylated ligands on
the erythrocyte surface since the HA titer increased when type 3 reovirus virions were converted to ISVPs by using chymotrypsin. Based
on these results, we conclude that type 3
1 protein possesses a
modular arrangement of receptor-binding domains and that binding of
sialic acid is a function of the tail, perhaps directly involving
sequences predicted to form a
-sheet motif.
Mechanism of type 3
1 protein susceptibility to cleavage by
proteases.
The amino terminal of the two proposed coiled-coil
units in the
1 neck contains three classical heptad repeats in which
apolar residues occupy the first and fourth amino acid positions
(47). Residue 249 is located in the d position of
the second heptad repeat (Fig. 5). Since trypsin and chymotrypsin
preferentially cleave adjacent to basic and bulky aromatic residues,
respectively (12), a threonine at position 249 in T3D
1
is not predicted to be the site of protease action. Concordantly, no
cleavage at this site was indicated by amino-terminal sequence analysis
of T3D
1 cleavage products (Fig. 8B). One plausible mechanism of cleavage sensitivity is that the presence of threonine disrupts hydrophobic contacts between apposed
helices, which then allows protease to attack a neighboring target sequence. Conversely, the
presence of an isoleucine is predicted to favor a more stable interhelical association and thereby shield the protease target site.
This model is supported by the finding that protease resistance could
be engineered by replacement of Thr249 with isoleucine as
well as another hydrophobic amino acid, leucine, but not by replacement
with a polar amino acid, asparagine (Fig. 6B). Additionally, a trypsin
cleavage site (Arg245) in virion-associated T3D
1
protein was identified within four residues of Thr249,
which is consistent with the prediction that interfacial contacts of an
-helical coiled coil would be locally destabilized by the occurrence
of a polar residue in the d position of a heptad repeat. The
1 oligomer has been modeled as either a coiled-coil homotrimer (40, 58) or a pair of parallel coiled-coil homodimers
(24). It is possible that a polar residue at position 249 makes protease cleavage sites accessible by causing a localized
decrease in the compactness of either a dimeric or trimeric coiled coil
or by indirectly perturbing the stable association between pairs of coiled-coil dimers.
Our experiments do not directly address putative conformational
differences in the
1 neck in its cleavage-susceptible and cleavage-resistant states, and it is possible that the effect of
Thr249 is to disrupt intramolecular
1 structure.
Confirmation of the mechanism of
1 cleavage susceptibility will
require further characterization of the neck region by using
biophysical techniques.
Cleavage of
1 protein and reovirus pathogenesis.
The
cleavage status of type 3
1 protein in vivo is unknown. Virions of
T1L orally inoculated into newborn mice are rapidly converted to ISVPs
in the intestinal lumen (10). Furthermore, proteolytic
processing of virions to ISVPs is an obligate step in reovirus
infectivity in the intestine (1, 6). A reasonable inference
from these findings is that the
1 proteins of T3D and T3C31 are
cleaved in the murine intestine. We tested this possibility by treating
virions with the contents of a murine intestinal lavage under
conditions that lead to the generation of ISVPs. Examination of viral
structural proteins by SDS-PAGE showed that the
1 proteins of
both strains were cleaved under these conditions; however, the
1 proteins of strains T3C9 and T3C84 remained intact (Fig. 9). This
pattern of
1 cleavage sensitivity replicates results obtained for
both virions and expressed
1 protein in in vitro cleavage assays
with purified protease (Fig. 3, 6B, and 7). Therefore, these
results indicate that
1 proteins of type 3 reovirus strains are
differentially susceptible to cleavage during the course of natural
infection.
T3D is avirulent when infection is initiated in the intestine (31,
54, 68), even though this virus is neurotropic (23, 61,
65) and highly neurovirulent (23, 31, 44, 57, 62)
following intramuscular or intracranial inoculation. Therefore, cleavage of T3D
1 protein by intraluminal proteases, as shown here,
may contribute to the avirulence of this strain in newborn mice
inoculated orally. This model is supported by linkage of the S1 gene to
differences in T1L and T3D growth and spread following peroral
inoculation (9, 32). Verification of this hypothesis will
require genetic analysis of the in vivo cleavage susceptibility of T3D
1. However, if
1 stability in the intestinal lumen is a virulence
determinant of reovirus, it is not necessarily the predominant
influence on virulence after oral inoculation; 50% lethal doses
reported for type 3 strains (including T3D, T3C9, T3C31, and T3C84)
(68) do not correlate with patterns of
1 cleavage
susceptibility observed in this study. We are conducting studies on a
variant of T3D adapted to growth in murine intestinal tissue
(28) to better understand the precise relationship between
1 stability and reovirus pathogenesis.
Function of the
1 neck domain.
The neck region likely
exhibits considerable flexibility since this portion of the protein is
highly sensitive to proteolysis (22; Fig. 8B) and
shows enhanced curvature in analyses of
1 visualized by electron
microscopy (14, 24, 25). Flexibility in the
1 neck may
optimally orient sequences in the head and tail for receptor engagement
and viral entry. This situation would be similar to attachment by
bacteriophage T4, where the latent receptor-binding domain in the short
tail fiber is repositioned to an active orientation by extension of the
fiber at a proposed hinge (43). Another function of the
1
neck may be to promote intraendosomal virion disassembly by undergoing
conformational adjustments that alter interactions between
1 and
neighboring outer-capsid components, such as the
3 protein (34,
38, 63). Indeed, mutations in both
1 and
3 proteins confer
the ability of virions to bypass blocks to disassembly within the
endosome (66, 69), suggesting a cooperative interaction of
1 with
3 in the dissociation of outer-capsid proteins. Additional
sites in the
1 tail, near the middle and near the virion-proximal
amino terminus, also show evidence of flexibility (24), and
concerted adjustments at these positions and the neck region may
facilitate the dramatic conformational change in
1 observed when the
outer capsid is degraded by protease to produce an ISVP
(25). Functions of the
1 neck in reovirus infection will
become clearer as the structure and conformational dynamics in this
region of
1 are elucidated.
 |
ACKNOWLEDGMENTS |
We thank Mehmet Goral, Patrick Green, and Gerald Stubbs for
critical review of the manuscript. We also thank Joy Duong of the
Elizabeth B. Lamb Center for Pediatric Research and Eric Howard and
Masaaki Tamura of the Protein Chemistry Laboratory, Department of
Biochemistry, Vanderbilt University School of Medicine, for expert
technical assistance.
This research was supported by PHS awards AI39533 (M.L.N.) and AI38296
(J.D.C. and T.S.D.) from the National Institute of Allergy and
Infectious Diseases, PHS award T32 GM07347 from the National Institute
of General Medical Studies for the Vanderbilt Medical-Scientist
Training Program (G.S.B. and D.T.D.), and Vanderbilt Diabetes Research
and Training Center grant P60 DK20593. This work also was supported by
the National Science Foundation and University Research Council,
Vanderbilt University (E.S.B.), an Amos Christie fellowship from the
Department of Pediatrics at Vanderbilt University School of Medicine
(T.H.S.), and the Elizabeth B. Lamb Center for Pediatric Research.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Lamb Center for
Pediatric Research, D7235 MCN, Vanderbilt University School of
Medicine, Nashville, TN 37232. Phone: (615) 343-9943. Fax: (615)
343-9723. E-mail:
terry.dermody{at}mcmail.vanderbilt.edu.
 |
REFERENCES |
| 1.
|
Amerongen, H. M.,
G. A. R. Wilson,
B. N. Fields, and M. R. Neutra.
1994.
Proteolytic processing of reovirus is required for adherence to intestinal M cells.
J. Virol.
68:8428-8432[Abstract/Free Full Text].
|
| 2.
|
Armstrong, G. D.,
R. W. Paul, and P. W. Lee.
1984.
Studies on reovirus receptors of L cells: virus binding characteristics and comparison with reovirus receptors of erythrocytes.
Virology
138:37-48[Medline].
|
| 3.
|
Baer, G. S., and T. S. Dermody.
1997.
Mutations in reovirus outer-capsid protein 3 selected during persistent infections of L cells confer resistance to protease inhibitor E64.
J. Virol.
71:4921-4928[Abstract].
|
| 4.
|
Banerjea, A. C.,
K. A. Brechling,
C. A. Ray,
H. Erikson,
D. J. Pickup, and W. K. Joklik.
1988.
High-level synthesis of biologically active reovirus protein 1 in a mammalian expression vector system.
Virology
167:601-612[Medline].
|
| 5.
| Barton, E. S., and T. S. Dermody.
Unpublished observation.
|
| 6.
|
Bass, D. M.,
D. Bodkin,
R. Dambrauskas,
J. S. Trier,
B. N. Fields, and J. L. Wolf.
1990.
Intraluminal proteolytic activation plays an important role in replication of type 1 reovirus in the intestines of neonatal mice.
J. Virol.
64:1830-1833[Abstract/Free Full Text].
|
| 7.
|
Bassel-Duby, R.,
M. Nibert,
C. Homcy,
B. Fields, and D. Sawutz.
1987.
Evidence that the sigma 1 protein of reovirus serotype 3 is a multimer.
J. Virol.
61:1834-1841[Abstract/Free Full Text].
|
| 8.
|
Bassel-Duby, R.,
D. R. Spriggs,
K. L. Tyler, and B. N. Fields.
1986.
Identification of attenuating mutations on the reovirus type 3 S1 double-stranded RNA segment with a rapid sequencing technique.
J. Virol.
60:64-67[Abstract/Free Full Text].
|
| 9.
|
Bodkin, D. K., and B. N. Fields.
1989.
Growth and survival of reovirus in intestinal tissue: role of the L2 and S1 genes.
J. Virol.
63:1188-1193[Abstract/Free Full Text].
|
<