Previous Article | Next Article 
Journal of Virology, October 1998, p. 8143-8149, Vol. 72, No. 10
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Persistent Infection of Epstein-Barr Virus-Positive B Lymphocytes
by Human Herpesvirus 8
Stefanie
Kliche,1
Elisabeth
Kremmer,2
Wolfgang
Hammerschmidt,3
Ulrich
Koszinowski,1 and
Jürgen
Haas1,*
Max-von-Pettenkofer Institut, Genzentrum,
Universität München, 81377 Munich,1
and
Institut für Immunologie2
and
Institut für Klinische Molekularbiologie und
Tumorgenetik,3 GSF Forschungszentrum, 80377 Munich, Germany
Received 17 April 1998/Accepted 2 July 1998
 |
ABSTRACT |
In patients with Kaposi's sarcoma (KS), human herpesvirus 8 (HHV-8) can invariably be detected in KS tumor tissue and, at a lower
frequency, in prostate tissue and peripheral blood B lymphocytes. Whereas the majority of KS spindle cells are latently infected by
HHV-8, linear HHV-8 genomes characteristic for lytic infection are
found predominantly in the peripheral blood cells of KS patients. In
this study, we show that HHV-8 can stably infect B lymphocytes in vitro
in the presence of Epstein-Barr virus (EBV). We were able to generate
immortalized HHV-8+/EBV+ lymphoblastoid cell
lines (LCLs) derived from peripheral blood mononuclear cells (PBMC) of
EBV
and EBV+ donors. In
HHV-8+/EBV+ LCLs, which have the phenotype
of activated B lymphocytes (CD19+, surface
immunoglobulin M, CD23+, CD30+,
CD80+), HHV-8 was still present after more than 25 passages
(more than 9 months of culture). Latent viral transcripts and proteins
were present in nonstimulated HHV-8+/EBV+ LCLs.
After induction by phorbol ester and n-butyrate,
HHV-8+/EBV+ LCLs expressed lytic HHV-8
transcripts and proteins. Moreover, HHV-8 could be serially passaged
from HHV-8+/EBV+ LCLs to fresh PBMC.
| |
INTRODUCTION |
Human herpesvirus 8 (HHV-8) was
recently detected in Kaposi's sarcoma (KS) (11, 18, 30) and
B-cell lymphomas (5, 39, 45), as well as in other
malignancies and in healthy individuals. HHV-8 is a type 2 gammaherpesvirus (genus Rhadinovirus) with sequence similarity to Epstein-Barr virus (EBV), herpesvirus saimiri (HVS), equine herpesvirus 2, murine herpesvirus 68, and two recently identified herpesviruses causing retroperitoneal fibromatosis in
macaques (34, 40, 41, 48). Although seroprevalence data
indicated that HHV-8 is more widespread and not restricted to KS, HHV-8
is suspected of possessing transforming activity similar to EBV and
HVS, which cause tumors in their natural hosts and in experimental
animals (2, 15, 16, 19, 24, 27, 44). In most cell lines
established from KS tissue, HHV-8 is lost during continuous
propagation. Several cell lines derived from primary effusion lymphoma
(PEL) and KS, however, are stably infected by latent HHV-8 and can be
induced to undergo lytic viral replication and virus production
(6, 38, 42). Serial propagation of HHV-8 on primary cells or
cultured cell lines has not been possible thus far. In vitro, HHV-8
could be transferred to several cell lines and primary cells including
293 (13, 37) and B lymphocytes (25); however,
this did not result in stable virus infection. In vivo, HHV-8 was
detected in biopsy specimens of KS lesions (11, 18, 30) but
also in prostate tissue (28), semen (28),
saliva (47), peripheral blood B lymphocytes (1, 10), and lymphoid tissue (4) of KS patients. Human B
lymphocytes can also be infected by EBV, the nearest relative of HHV-8
that is pathogenic to humans. EBV is able to transform B cells in vitro to permanent lymphoblastoid cell lines (LCLs) (20).
EBV-induced B-cell transformation leads to a sequential expression of
at least 11 latent EBV genes (EBNAs, LMPs, and EBERs), entry into the
cell cycle and continuous cell proliferation, RNA synthesis, and
expression of activation (e.g., transferrin receptor, major
histocompatibility complex class II, CD21, CD23, CD39, CD40 and CD44)
and adhesion (e.g., ICAM1, LFA1, and LFA3) molecules, resulting in a
phenotype similar to stimulated B cells. Thus far, there has been no
experimental evidence that infectious HHV-8 particles can stably infect
and transform either primary cells or cell lines in vitro. In this study, we present evidence that HHV-8 persistently infects peripheral blood B lymphocytes and that LCLs continuously infected with HHV-8 can
be established.
| |
MATERIALS AND METHODS |
Blood donors.
Peripheral blood mononuclear cells
(PBMC) were isolated from EDTA-treated blood of four EBV-negative
and EBV-positive healthy individuals by Ficoll-Hypaque discontinuous
gradient centrifugation (Lymphoflot; Biotest AG, Dreieich, Germany)
as specified by the manufacturer. Blood donors were not from HHV-8 risk
groups. EBV serologic testing was performed with the following
commercial kits detecting virus capsid antigen (VCA) immunoglobulin G
(IgG) (Fresenius, Bad Homburg, Germany) and IgM (Viramed, Martinsried, Germany) and Epstein-Barr virus nuclear antigen (EBNA) IgG antibodies (Biotest, Dreieich, Germany). EBV-positive individuals were
positive for VCA IgG and EBNA IgG antibodies but negative for VCA IgM
antibodies. EBV-negative individuals were negative for VCA IgG, VCA
IgM, and EBNA IgG.
Cell culture and EBV and/or HHV-8 infection.
BCBL-1
(38), BC-1 (35), B95-8 (CRL1612), Raji (CCL 86),
and LCLs were cultured in RPMI (Life Technologies, Paisley, Scotland) supplemented with 20% heat-inactivated fetal calf serum (FCS; Life
Technologies), 100 IU of penicillin (Life Technologies) per ml, 100 mg
of streptomycin (Life Technologies) per ml, 2 mM
L-glutamine (Life Technologies), and 0.05 mM
2-mercaptoethanol (Sigma, St. Louis, Mo.). For cells at low density,
the 2-mercaptoethanol was replaced by 20 mM bathocuproine
disulfonic acid (Sigma), 50 µm 
-thioglycerol (Sigma), and 1 mM
sodium pyruvate (Life Technologies). To induce the expression of lytic
viral proteins, cells were treated with 20 ng of phorbol 12-myristate
13-acetate (TPA; Sigma) per ml and 3 mM sodium n-butyrate
(Sigma) for 24 h.
Supernatants of either BCBL-1, BC-1, B95-8, or Raji cells grown at very
high densities (5 × 105 per ml) were used to infect
PBMC. Supernatants were filtered through 0.4-µm filters and serially
diluted with cell culture medium in 96-well plates, and PBMC were added
to 104 cells per well. For serial virus passage,
supernatants of ABEH-1, ABE-1, GMEH-1, and GME-1 cells were generated
similarly and added to 104 PBMC from an EBV+
donor.
Isolation of cellular DNA and detection of viral DNA by PCR.
Total cellular DNA was prepared from 106 cells by the
method of Miller et al. (26). The primer used to amplify
HHV-8 DNA flanked the K12 open reading frame (K12for, 5'
cggaattcatggatagaggcttaacg 3'; K12rev, 5'
cgctcgagtcagtgcgcgcccgttgc 3'). The length of the expected
amplified product is 196 bp. The primers used to amplify EBV DNA from
the BALF5 open reading frame were Epolfor (5' aggttggcggggctcagggc 3') and Epolrev (5' agcacaggctagccggcctg 3'), and the
amplified product was 343 bp in size. Each reaction mixture contained
500 ng of cellular DNA, 100 ng of each primer, and 5 U of
Taq polymerase (Perkin-Elmer Cetus, Branchburg, N.J.). The
mixture was cycled in a DNA thermal cycler 2400 (Perkin-Elmer) for 30 cycles of amplification (96°C for 1 min; 60°C for 1 min; 72°C for
1 min). One-tenth of the PCR products were analyzed on 2% agarose-40
mM Tris acetate-1 mM EDTA and visualized after ethidium bromide
staining. As negative and positive PCR controls, water and plasmid DNAs
of EBV polymerase and K12 cloned into pBluescript KS II+
were used, respectively.
Preparation of RNA and RT-PCR.
RNA was extracted from
106 cells with Tri Reagent (Molecular Research Center,
Cincinnati, Ohio) as specified by the manufacturer. A 5-µg portion of
total RNA in 10 µl of water and 1 µg of oligo(dT)18 primer were heated to 70°C for 10 min and then cooled to 4°C on ice. A 10-µl volume of reaction mixture (100 mM Tris-HCl [pH 8.3], 6 mM MgCl2, 150 mM KCl, 1 mM each deoxynucleoside
triphosphate (Boehringer, Mannheim, Germany), 30 U of RNase inhibitor
[MBI Fermentas, Vilnius, Lithuania], 200 U of Superscript [Life
Technologies]) was added, and the mixture was incubated at 37°C for
1.5 h and heated to 67°C for 15 min. A 2-µl volume of the
reverse transcription reaction mixture was amplified with gene-specific
primers in a 100-µl PCR mixture containing 10 mM Tris-HCl (pH 8.3),
1.5 mM MgCl2, 0.2 mM each deoxynucleoside triphosphate, 100 ng of each primer, and 5 U of Taq polymerase. The mixture
was cycled in a DNA thermal cycler 2400 for 30 cycles of amplification
(96°C for 1 min; 60°C for 1 min; 72°C for 1 min). One-tenth of
the PCR mixtures were analyzed on 1 or 2% agarose-40 mM
Tris-acetate-1 mM EDTA and visualized after ethidium bromide staining.
The oligonucleotide primers used in this study were K12for,
K12rev, VP23for (5' cgcgggtctagaatcgcactcgacaagagtata 3'),
VP23rev (5' cgcggggaattctttagcgtggggaataccaacagga 3'),
Actfor (5' cgcgaatccccccagtgtgacatgg 3'), and Actrev
(5' cgcggatcccagccaggtccagacg 3').
As negative controls for these experiments, reverse
transcription-PCR (RT-PCR) was performed with 1 µg of total
RNA. As negative and positive PCR controls, water and plasmid
DNAs of full-length cDNA of VP23, actin, and K12 cloned into
pBluescript KS II+ were used, respectively.
Flow cytometry.
To analyze the surface phenotype of LCLs,
BC-1 and BCBL-1 cells (5 × 105) were washed in
phosphate-balanced saline (PBS) and FACS buffer (PBS
containing 2.5% FCS and 0.02% sodium azide) and stained directly with
anti-CD3-phycoerythrin (PE), anti-CD14-PE, anti-CD16-PE, anti-CD19-PE, anti-CD56-PE (Pharmingen, Hamburg, Germany),
anti-IgG-fluorescein isothiocynate (FITC), and anti-IgM-FITC
(Sigma). Isotype controls were included in each assay. For indirect
staining, cells were incubated first with mouse anti-CD19, anti-CD20,
anti-CD23, or anti-CD30 (Dako Diagnostika, Hamburg, Germany) and
then with goat anti-mouse IgG-FITC (Dianova, Hamburg, Germany). As
the negative control, only goat anti-mouse IgG-FITC was used in each
assay. The cells were washed three times and analyzed on a FACScan with Cellquest software (Becton Dickinson, San Jose, Calif.).
Immunofluorescence and confocal microscopy.
After
stimulation for 24 h with TPA and n-butryate as
described above, the cells were dried on
poly-L-lysine-coated coverslips (Marienfeld, Bad
Mergentheim, Germany), fixed with acetone, and blocked for 1 h
with 5% FCS in PBS. After incubation for 1 h with monoclonal
antibody (MAb) vp4G2 (anti-HHV-8 VP23), kap5C4 (anti-HHV-8 K12), or 817 (anti-EBV VCA) (Chemicon, Temecula, Calif.) diluted in 5% FCS in PBS,
the cells were incubated for 2 h with Cy3-conjugated goat anti-rat
IgG or goat anti-mouse IgG (Sigma) diluted 1:200 in 5% FCS in PBS.
MAbs vp4G2 (23a) and kap5C4 (21a) were generated as described elsewhere. The cells were washed and examined under a TNT
confocal microscope DMIRB (Leica, Bensheim, Germany).
| |
RESULTS |
Immortalization of PBMC and persistent viral infection by EBV and
HHV-8.
Supernatants of BCBL-1 (HHV-8+ PEL cell line),
BC-1 (HHV-8+ EBV+ PEL cell line), B95-8
(EBV+ marmoset cell line), and Raji (human EBV-transformed
cell line with a deletion in the EBV genome resulting in an inability
to release virus) cells were used to infect PBMC from four
EBV and four EBV+ individuals. Incubation of
PBMC with control supernatant or supernatant of Raji cells did not
result in the outgrowth of LCLs, independent of EBV status, indicating
that the EBV present in PBMC from EBV+ individuals was not
sufficient to transform B cells under the conditions used (Table
1). Incubation with supernatants of B95-8 resulted in the outgrowth of LCLs in PBMC of each individual, again
independent of EBV status. Supernatants of HHV-8+ BCBL-1
cells resulted in the outgrowth of LCLs if PBMC were derived from
EBV+ but not from EBV individuals.
Interestingly, supernatants of HHV-8+ and
EBV+ BC-1 cells resulted in the immortalization of PBMC
from both EBV and EBV+ individuals. Since
supernatants from BCBL-1 cells (HHV-8+ EBV)
immortalized PBMC from EBV+ but not EBV
donors, we hypothesized that HHV-8 either provides a cofactor promoting
the immortalization of EBV-transformed B cells or itself has
transforming activity if EBV or EBV-derived cofactors are present.
Since supernatants of BCBL-1 cells did not promote the immortalization of B lymphocytes derived from EBV donors
in the assay system we used, we thus far have no hints for the latter.
Initially, six cell lines were established from PBMC of each donor and
supernatant. PBMC from one donor were used twice, with
a similar
outcome. Thus, a total of 54 cell lines were established
by using
either BCBL-1 or BC-1 supernatant. HHV-8
+
EBV
+ LCLs were tested after various passages for the
presence of EBV
and HHV-8 DNA by PCR (Fig.
1). Both EBV and HHV-8 were present
in
all cell lines derived from PBMC of EBV
+ donors infected
with supernatant of the HHV-8
+ cell lines BC-1 and BCBL-1,
as well as in cell lines derived
from EBV
donors infected
with supernatant of BC-1 cells. In the experiment
in Fig.
1, two
LCLs, ABEH-1 and GMEH-1, were tested after 3, 6,
9, 12, 15, 18, and 21 passages and found to be positive for both
EBV and HHV-8 with no
apparent decline in viral load. Four immortalized
HHV-8
+
EBV
+ cell lines are continuously kept in culture for
currently more
than 25 passages and longer than 9 months. The other
HHV-8
+ EBV
+ cell lines were frozen in liquid
nitrogen since they appeared
to be similar. Once the
HHV-8
+ EBV
+ cell lines were established,
there was no difference in terms
of the efficiency of long-term culture
in comparison to EBV
+ LCLs. All four cell lines kept in
continuous cell culture for
more than 9 months were found to be
positive for both EBV and
HHV-8. Furthermore, none of the
HHV-8
+ EBV
+ LCLs have become negative for
either HHV-8 or EBV thus far.
View larger version (39K):
[in this window]
[in a new window]
|
FIG. 1.
Persistent infection of LCLs by HHV-8 and EBV. Viral
DNAs in the LCLs ABEH-1 and GMEH-1 were detected by PCR from passages 3 to 21 by using either EBV (BALF5, 343 bp)- or HHV-8 (K12, 196 bp)-specific primers. Cellular DNA was extracted after the indicated
number of passages, and 500 ng of each DNA preparation was used in an
unnested PCR of 30 cycles. One-tenth of the PCR mixture was applied to
a 2% agarose gel and visualized after ethidium bromide staining.
|
|
Phenotypic analysis of EBV+ HHV-8+
LCLs.
Next, we determined the phenotype of the immortalized
cell lines. All HHV-8+ EBV+ LCLs tested
were positive for CD19 (B-lymphocyte antigen) but negative for CD3
(T-lymphocyte marker), CD14 (monocytes/macrophages), and CD16 (NK
cells) (Fig. 2), indicating that these
cells are of B-lymphocyte origin. Moreover, HHV-8+
EBV+ LCLs expressed surface IgM, as well as B-cell
activation markers CD23, CD30, and CD80 similarly to EBV-transformed
LCLs (Table 2). Surface IgG, CD20, and
CD56 were not found on these cells. The phenotype differed from BCBL-1
and BC-1 cell lines by some markers; e.g., BCBL-1 cells were negative
for CD80, and BC-1 cells were negative for CD30. Intriguingly, the
surface phenotype as well as growth characteristics varied between LCLs
from different donors. Whereas most of the HHV-8+
EBV+ LCLs grow in large conglomerates in suspension similar
to EBV-transformed LCLs, cells of the HHV-8+
EBV+ LCL COEH-1 show semiadherent growth and are spindle
shaped (data not shown).
View larger version (38K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of the B-cell antigen CD19 on
HHV-8+ EBV+ LCLs. HHV-8+
EBV+ LCLs (ABEH-1 and GMEH-1), EBV+
HHV-8 LCLs (ABE-1 and GME-1), BC-1, and BCBL-1 were
stained with anti-CD3, anti-CD14, anti-CD16, and anti-CD19 MAbs.
Isotype controls were included in each assay. Flow cytometry was
performed by gating on 10,000 living cells.
|
|
Latent infection of transformed B-cell lines by HHV-8.
We next
tested HHV-8+ EBV+ LCLs for expression of the
latent viral transcript T0.7, which codes for kaposin. T0.7 was
detected in the noninduced HHV-8+
EBV+ LCL GMEH-1 after 5, 10, and 15 passages by RT-PCR, and
expression could be increased by induction with phorbol ester and
n-butyrate (Fig. 3). The
signal resulting from the amplification of actin mRNA was similar for
all samples tested, indicating that the RNA content was comparable. The
RT-PCR result was confirmed by Northern blot analysis, which revealed
the presence of T0.7 in unstimulated ABEH-1 and GMEH-1 cells after more
than 25 passages. In accordance with the RT-PCR results, kaposin
protein was detected in the noninduced HHV-8+
EBV+ LCLs GMEH-1 and ABEH-1 by immunofluorescence
with the MAb kap5C4 (Fig. 4). Kaposin was
also detected on BCBL-1 cells but not on B95-8 cells.
View larger version (30K):
[in this window]
[in a new window]
|
FIG. 3.
Detection of latent HHV-8 transcripts in noninduced, and
lytic HHV-8 transcripts in induced, HHV-8+ EBV+
LCLs. RT-PCR analysis of EBV+ HHV-8+ LCL GMEH-1
was performed after 5, 10, and 15 passages either with or without
induction by TPA and sodium butyrate. The RT reaction was performed by
oligo(dT) priming followed by PCR with gene-specific primers for the
latent T0.7 transcript (196 bp), the lytic viral mRNA VP23 (917 bp),
and actin mRNA (245 bp) as a control. As negative and positive PCR
controls, water and plasmid DNAs of full-length cDNA of VP23, actin,
and K12 were used, respectively.
|
|
View larger version (59K):
[in this window]
[in a new window]
|
FIG. 4.
Detection of the HHV-8 protein kaposin in noninduced,
lytic HHV-8 minor capsid protein VP23 and the lytic VCA of EBV in
induced HHV-8+ EBV+ ABEH-1 LCLs.
EBV+ HHV-8+ LCL ABEH-1 (a to f), BCBL-1 (g to
l), and B95-8 (m to r) were either stained with MAb kap5C4 (b, h, and
n), MAb Vp234G2 (d, j, and p) or MAb directed to VCA of EBV (f, l, and
r) after fixation with acetone. Cells stained with kap5C4 were
noninduced, whereas cells stained with MAb VP234G2 or anti-VCA of EBV
were induced with TPA and sodium butyrate. Bound antibodies were
visualized with Cy3-conjugated goat anti-rat IgG or goat anti-mouse IgG
and examined under a Leica TNT confocal microscope.
|
|
Induction of lytic viral proteins in HHV-8+
EBV+ LCLs.
We next investigated whether latent HHV-8
can be reactivated in HHV-8+ EBV+ LCLs. GMEH-1
and ABEH-1 LCLs after 5, 10, and 15 culture passages were stimulated
with phorbol ester and n-butyrate and subsequently tested
for lytic viral transcripts coding for VP23 by RT-PCR (Fig. 3). In all
immortalized HHV-8+ EBV+ LCLs tested, lytic
HHV-8 mRNA was detected after induction by phorbol ester and
n-butyrate, similar to BC-1 and BCBL-1 cells. In accordance
with the RT-PCR results, the viral capsid protein VP23 was detected
by immunofluorescence with the MAb vp4G2 in cells of the
HHV-8+ EBV+ LCL ABEH-1 and in BCBL-1 cells. No
reactivity was seen with B95-8 (Fig. 4) and EBV+ LCLs of
the same donors (data not shown), indicating that there was no
cross-reactivity with EBV proteins. Reactivity against EBV VCA was
detected in B95-1 and in ABEH-1 cells but not in BCBL-1 cells.
Serial passage of HHV-8 from HHV-8+ EBV+
LCLs.
Since lytic HHV-8 genes could be induced in
HHV-8+ EBV+ LCLs, we hypothesized that
HHV-8+ EBV+ LCLs are able to produce infectious
viral particles and infect new cells. PBMC of an EBV+ donor
were incubated with supernatants of HHV-8+ EBV+
and EBV+ LCLs (Table 3). As
anticipated, supernatants of the EBV+ LCLs ABE-1 and GME-1
immortalized B cells. Intriguingly, incubation with supernatants of
HHV-8+ EBV+ LCLs also promoted the outgrowth of
cell lines, whereas control supernatant of Raji cells or culture
medium had no such effect. Six second-generation cell lines were
established for each supernatant, and one second-generation cell line
of each supernatant was tested by immunofluorescence analysis after two
passages. Cell lines that were derived from PBMC incubated with
supernatant of ABE-1 and GME-1 cells were found to be positive for EBV
VCA and negative for HHV-8 kaposin. Cell lines that were derived from
PBMC incubated with supernatant of cells of the HHV-8+
EBV+ LCLs ABEH-1 and GMEH-1 were positive for both HHV-8
kaposin and EBV VCA, indicating that HHV-8 has been transferred to
these cells.
| |
DISCUSSION |
In this study, we were able to show that (i) peripheral blood B
lymphocytes can be persistently infected by HHV-8 in vitro, (ii) HHV-8
supports transforming activity of EBV on B cells, and (iii) infection
leads to the outgrowth of permanent HHV-8+
EBV+ LCLs. Infection of PBMC with EBV in vitro results in
the immortalization of B cells and the generation of EBV+
LCLs. In vivo, EBV infection causes a primary infection known as
mononucleosis followed by a lifelong persistence of EBV in a latent
state in B lymphocytes. The frequency of EBV-infected B cells in the
peripheral blood was reported to be between 1 in 104 and 1 in 106 (43). EBV present
in isolated PBMC can lead to the spontaneous outgrowth of
immortalized cells without the addition of EBV-containing supernatants; however, a minimal number of cells must be used (22,
23). In the experiments shown here, the number of cells used was
not sufficient for spontaneous outgrowth of EBV+ LCLs
(Table 1). In PBMC of none of the eight donors tested did culture
medium or Raji cell supernatant (Raji cells contain EBV genomes but
cannot produce infectious EBV) alone lead to the outgrowth of
immortalized B-cell lines. In contrast, supernatants of BCBL-1 cells containing HHV-8 induced the outgrowth of LCLs in PBMC of all
four EBV+ donors but not in PBMC of EBV
donors.
The LCLs were persistently HHV-8 and EBV infected and possessed the
phenotype of activated B cells, similar to EBV+ LCLs. HHV-8
could also be transferred to PBMC from EBV donors, but
only if BC-1 supernatants containing HHV-8 and EBV were used. Thus,
HHV-8 infects EBV+ B cells and favors the outgrowth of
immortalized LCLs containing both viruses. Intriguingly, infection of
PBMC with BC-1 supernatant did not result in the outgrowth of
EBV+ but, rather, resulted in the outgrowth of
HHV-8+ EBV+ LCLs, which might indicate that
there is a selection for infection with both viruses. Moreover, we
cloned two HHV-8+ EBV+ cell lines and tested
eight clones of one of them for the presence of HHV-8 and EBV by PCR.
All eight clones were HHV-8+ EBV+, indicating
that none of the clones had lost either virus. Thus, there are several
lines of evidence suggesting that cells infected with both viruses
possess a growth advantage and that HHV-8 perhaps has an intrinsic
transforming potential. This is supported by the fact that many BCBL
cell lines are infected with both viruses. It is formally possible that
either of the two viruses is the primary transforming agent in
HHV-8+ EBV+ LCLs whereas the other virus
provides an essential or nonessential (growth-promoting) cofactor. If
HHV-8 is a transforming virus for B lymphocytes, it appears to depend
on an EBV-derived cofactor, at least under the conditions we used.
An alternative explanation might be a two-step transformation process,
divided into an initiating step and a maintaining step. In this case,
the virus supplying the initiating step should be lost at least in some
cell lines, since there is no selection for it. At the moment, however,
we have no evidence for this explanation. Interestingly, HHV-8 has no
homologs to EBNAs, LMPs, and EBERs; however, there are several other
candidates for transforming genes like v-IL6 (29, 33), cc-chemokines (21), G-protein-coupled receptor (3,
12), v-cyclin (7, 8, 17), K1 (14),
interferon regulatory factor (29, 31), kaposin
(32), v-FLIP (46), LANA (36), and
v-bcl2 (9). Thus, the mechanism by which HHV-8
supports transformation might be different from that for EBV.
It is known that peripheral blood B lymphocytes can be infected by
HHV-8 in vivo in KS patients and healthy individuals (1, 10,
25). At present, there is no evidence that these cells are doubly
infected by HHV-8 and EBV in vivo (4). In contrast, almost
all of the PEL tumors are positive for both EBV and HHV-8, implying
that double infection could play a causal role in this entity. In KS,
only a minority of tumors are positive for EBV. Thus, it is unlikely
that both viruses in concert play a role in tumorigenesis of KS. The
primary target cell of HHV-8 infection is not yet known. This study
provides some evidence that B cells could be the primary reservoir and
the place of latency in HHV-8-infected individuals with and without KS.
It presents a model system of HHV-8 infection in vitro and might give
some clues about the role of B-cell infection in the pathogenesis of
HHV-8.
| |
ACKNOWLEDGMENTS |
We acknowledge the expert technical assistance of C. Atzler. Cell
lines BC-1 and BCBL-1 were kindly provided by Patrick Moore and Don
Ganem, respectively.
S.K. was supported in part by a scholarship from the Graduiertenkolleg
"Infektion und Immunität" of the Deutsche
Forschungsgemeinschaft.
| |
FOOTNOTES |
*
Corresponding author. Mailing address:
Max-von-Pettenkofer Institut, Genzentrum, Universität
München, Feodor-Lynen-Str. 25, 81377 Munich, Germany.
Phone: 49 89 74017 201. Fax: 49 89 74017 250. E-mail:
haas{at}lmb.uni-muenchen.de.
| |
REFERENCES |
| 1.
|
Ambroziak, J. A.,
D. J. Blackbourn,
B. G. Herndier,
R. G. Glogau,
J. H. Gullett,
A. R. McDonald,
E. T. Lennette, and J. A. Levy.
1995.
Herpes-like sequences in HIV-infected and uninfected Kaposi's sarcoma patients.
Science
268:582-583[Free Full Text]. (Letter.)
|
| 2.
|
Andre, S.,
O. Schatz,
J. R. Bogner,
H. Zeichhardt,
M. M. Stoffler,
H. U. Jahn,
R. Ullrich,
A. K. Sonntag,
R. Kehm, and J. Haas.
1997.
Detection of antibodies against viral capsid proteins of human herpesvirus 8 in AIDS-associated Kaposi's sarcoma.
J. Mol. Med.
75:145-152[Medline].
|
| 3.
|
Arvanitakis, L.,
R. E. Geras,
A. Varma,
M. C. Gershengorn, and E. Cesarman.
1997.
Human herpesvirus KSHV encodes a constitutively active G-protein-coupled receptor linked to cell proliferation.
Nature
385:347-350[Medline].
|
| 4.
|
Bigoni, B.,
R. Dolcetti,
L. de Lellis,
A. Carbone,
M. Boiocchi,
E. Cassai, and D. di Luca.
1996.
Human herpesvirus 8 is present in the lymphoid system of healthy persons and can reactivate in the course of AIDS.
J. Infect. Dis.
173:542-549[Medline].
|
| 5.
|
Cesarman, E.,
Y. Chang,
P. S. Moore,
J. W. Said, and D. M. Knowles.
1995.
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas.
N. Engl. J. Med.
332:1186-1191[Abstract/Free Full Text].
|
| 6.
|
Cesarman, E.,
P. S. Moore,
P. H. Rao,
G. Inghirami,
D. M. Knowles, and Y. Chang.
1995.
In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus-like (KSHV) DNA sequences.
Blood
86:2708-2714[Abstract/Free Full Text].
|
| 7.
|
Cesarman, E.,
R. G. Nador,
F. Bai,
R. A. Bohenzky,
J. J. Russo,
P. S. Moore,
Y. Chang, and D. M. Knowles.
1996.
Kaposi's sarcoma-associated herpesvirus contains G protein-coupled receptor and cyclin D homologs which are expressed in Kaposi's sarcoma and malignant lymphoma.
J. Virol.
70:8218-8223[Abstract].
|
| 8.
|
Chang, Y.,
P. S. Moore,
S. J. Talbot,
C. H. Boshoff,
T. Zarkowska,
K. Godden,
H. Paterson,
R. A. Weiss, and S. Mittnacht.
1996.
Cyclin encoded by KS herpesvirus.
Nature
382:410[Medline]. (Letter.)
|
| 9.
|
Cheng, E. H.,
J. Nicholas,
D. S. Bellows,
G. S. Hayward,
H. G. Guo,
M. S. Reitz, and J. M. Hardwick.
1997.
A Bcl-2 homolog encoded by Kaposi sarcoma-associated virus, human herpesvirus 8, inhibits apoptosis but does not heterodimerize with Bax or Bak.
Proc. Natl. Acad. Sci. USA
94:690-694[Abstract/Free Full Text].
|
| 10.
|
Decker, L. L.,
P. Shankar,
G. Khan,
R. B. Freeman,
B. J. Dezube,
J. Lieberman, and L. D. Thorley.
1996.
The Kaposi sarcoma-associated herpesvirus (KSHV) is present as an intact latent genome in KS tissue but replicates in the peripheral blood mononuclear cells of KS patients.
J. Exp. Med.
184:283-288[Abstract/Free Full Text].
|
| 11.
|
Dupin, N.,
M. Grandadam,
V. Calvez,
I. Gorin,
J. T. Aubin,
S. Havard,
F. Lamy,
M. Leibowitch,
J. M. Huraux,
J. P. Escande, et al.
1995.
Herpesvirus-like DNA sequences in patients with Mediterranean Kaposi's sarcoma.
Lancet
345:761-762[Medline].
|
| 12.
|
Eliopoulos, A. G.,
C. W. Dawson,
G. Mosialos,
J. E. Floettmann,
M. Rowe,
R. J. Armitage,
J. Dawson,
J. M. Zapata,
D. J. Kerr,
M. J. Wakelam,
J. C. Reed,
E. Kieff, and L. S. Young.
1996.
CD40-induced growth inhibition in epithelial cells is mimicked by Epstein-Barr virus-encoded LMP1: involvement of TRAF3 as a common mediator.
Oncogene
13:2243-2254[Medline].
|
| 13.
|
Foreman, K. E.,
J. Friborg,
W. P. Kong,
C. Woffendin,
P. J. Polverini,
B. J. Nickoloff, and G. J. Nabel.
1997.
Propagation of a human herpesvirus from AIDS-associated Kaposi's sarcoma.
N. Engl. J. Med.
336:163-171[Abstract/Free Full Text].
|
| 14.
|
Ganem, D.
1997.
KSHV and Kaposi's sarcoma: the end of the beginning?
Cell
91:157-160[Medline].
|
| 15.
|
Gao, S. J.,
L. Kingsley,
D. R. Hoover,
T. J. Spira,
C. R. Rinaldo,
A. Saah,
J. Phair,
R. Detels,
P. Parry,
Y. Chang, and P. S. Moore.
1996.
Seroconversion to antibodies against Kaposi's sarcoma-associated herpesvirus-related latent nuclear antigens before the development of Kaposi's sarcoma.
N. Engl. J. Med.
335:233-241[Abstract/Free Full Text].
|
| 16.
|
Gao, S. J.,
L. Kingsley,
M. Li,
W. Zheng,
C. Parravicini,
J. Ziegler,
R. Newton,
C. R. Rinaldo,
A. Saah,
J. Phair,
R. Detels,
Y. Chang, and P. S. Moore.
1996.
KSHV antibodies among Americans, Italians and Ugandans with and without Kaposi's sarcoma.
Nat. Med.
2:925-928[Medline].
|
| 17.
|
Godden-Kent, D.,
S. J. Talbot,
C. Boshoff,
Y. Chang,
P. Moore,
R. A. Weiss, and S. Mittnacht.
1997.
The cyclin encoded by Kaposi's sarcoma-associated herpesvirus stimulates cdk6 to phosphorylate the retinoblastoma protein and histone H1.
J. Virol.
71:4193-4198[Abstract].
|
| 18.
|
Huang, Y. Q.,
J. J. Li,
M. H. Kaplan,
B. Poiesz,
E. Katabira,
W. C. Zhang,
D. Feiner, and K. A. Friedman.
1995.
Human herpesvirus-like nucleic acid in various forms of Kaposi's sarcoma.
Lancet
345:759-761[Medline].
|
| 19.
|
Kedes, D. H.,
E. Operskalski,
M. Busch,
R. Kohn,
J. Flood, and D. Ganem.
1996.
The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission.
Nat. Med.
2:918-924[Medline]. (Erratum, 2:1041.)
|
| 20.
|
Kieff, E.
1998.
Epstein Barr virus and its replication, p. 2343-2396.
In
B. N. Fields, D. M. Knipe, P. M. Howley, R. M. Chanock, J. L. Melnick, T. P. Monath, B. Roizman, and S. E. Straus (ed.), Virology, 3rd ed. Lippincott-Raven, Philadelphia, Pa.
|
| 21.
|
Kledal, T. N.,
M. M. Rosenkilde,
F. Coulin,
G. Simmons,
A. H. Johnsen,
S. Alouani,
C. A. Power,
H. R. Luttichau,
J. Gerstoft,
P. R. Clapham,
L. I. Clark,
T. C. Wells, and T. W. Schwartz.
1997.
A broad-spectrum chemokine antagonist encoded by Kaposi's sarcoma-associated herpesvirus.
Science
277:1656-1659[Abstract/Free Full Text].
|
| 21a.
| Kliche, S., et al. Unpublished data.
|
| 22.
|
Kohler, G., and C. Milstein.
1975.
Continuous cultures of fused cells secreting antibody of predefined specificity.
Nature
256:495-497[Medline].
|
| 23.
|
Kremmer, E.,
K. Ohst,
J. Kiefer,
N. Brewis, and G. Walter.
1997.
Separation of PP2A core enzyme and holoenzyme with monoclonal antibodies against the regulatory A subunit: abundant expression of both forms in cells.
Mol. Cell. Biol.
17:1692-1701[Abstract].
|
| 23a.
| Kremmer, E., et al. Unpublished data.
|
| 24.
|
Lennette, E. T.,
D. J. Blackbourn, and J. A. Levy.
1996.
Antibodies to human herpesvirus type 8 in the general population and in Kaposi's sarcoma patients.
Lancet
348:858-861[Medline].
|
| 25.
|
Mesri, E. A.,
E. Cesarman,
L. Arvanitakis,
S. Rafii,
M. A. Moore,
D. N. Posnett,
D. M. Knowles, and A. S. Asch.
1996.
Human herpesvirus-8/Kaposi's sarcoma-associated herpesvirus is a new transmissible virus that infects B cells.
J. Exp. Med.
183:2385-2390[Abstract/Free Full Text].
|
| 26.
|
Miller, G.,
L. Heston,
E. Grogan,
L. Gradoville,
M. Rigsby,
R. Sun,
D. Shedd,
V. M. Kushnaryov,
S. Grossberg, and Y. Chang.
1997.
Selective switch between latency and lytic replication of Kaposi's sarcoma herpesvirus and Epstein-Barr virus in dually infected body cavity lymphoma cells.
J. Virol.
71:314-324[Abstract].
|
| 27.
|
Miller, G.,
M. O. Rigsby,
L. Heston,
E. Grogan,
R. Sun,
C. Metroka,
J. A. Levy,
S. J. Gao,
Y. Chang, and P. Moore.
1996.
Antibodies to butyrate-inducible antigens of Kaposi's sarcoma-associated herpesvirus in patients with HIV-1 infection.
N. Engl. J. Med.
334:1292-1297[Abstract/Free Full Text].
|
| 28.
|
Monini, P.,
L. L. de Lellis,
M. Fabris,
F. Rigolin, and E. Cassai.
1996.
Kaposi's sarcoma-associated herpesvirus DNA sequences in prostate tissue and human semen.
N. Engl. J. Med.
334:1168-1172[Abstract/Free Full Text].
|
| 29.
|
Moore, P. S.,
C. Boshoff,
R. A. Weiss, and Y. Chang.
1996.
Molecular mimicry of human cytokine and cytokine response pathway genes by KSHV.
Science
274:1739-1744[Abstract/Free Full Text].
|
| 30.
|
Moore, P. S., and Y. Chang.
1995.
Detection of herpesvirus-like DNA sequences in Kaposi's sarcoma in patients with and without HIV infection.
N. Engl. J. Med.
332:1181-1185[Abstract/Free Full Text].
|
| 31.
|
Moorthy, R. K., and L. D. Thorley.
1993.
Biochemical, genetic, and functional analyses of the phosphorylation sites on the Epstein-Barr virus-encoded oncogenic latent membrane protein LMP-1.
J. Virol.
67:2637-2645[Abstract/Free Full Text].
|
| 32.
|
Muralidhar, S.,
A. M. Pumfery,
M. Hassani,
M. R. Sadaie,
N. Azumi,
M. Kishishita,
J. N. Brady,
J. Doniger,
P. Medveczky, and L. J. Rosenthal.
1998.
Identification of kaposin (open reading frame K12) as a human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus) transforming gene.
J. Virol.
72:4980-4988[Abstract/Free Full Text].
|
| 33.
|
Neipel, F.,
J. C. Albrecht,
A. Ensser,
Y. Q. Huang,
J. J. Li,
K. A. Friedman, and B. Fleckenstein.
1997.
Human herpesvirus 8 encodes a homolog of interleukin-6.
J. Virol.
71:839-842[Abstract].
|
| 34.
|
Neipel, F.,
J. C. Albrecht, and B. Fleckenstein.
1997.
Cell-homologous genes in the Kaposi's sarcoma-associated rhadinovirus human herpesvirus 8: determinants of its pathogenicity?
J. Virol.
71:4187-4192[Medline].
|
| 35.
|
Orenstein, J. M.,
S. Alkan,
A. Blauvelt,
K. T. Jeang,
M. D. Weinstein,
D. Ganem, and B. Herndier.
1997.
Visualization of human herpesvirus type 8 in Kaposi's sarcoma by light and transmission electron microscopy.
AIDS
11:F35-F45[Medline].
|
| 36.
|
Rainbow, L.,
G. M. Platt,
G. R. Simpson,
R. Sarid,
S. J. Gao,
H. Stoiber,
C. S. Herrington,
P. S. Moore, and T. F. Schulz.
1997.
The 222- to 234-kilodalton latent nuclear protein (LNA) of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) is encoded by orf73 and is a component of the latency-associated nuclear antigen.
J. Virol.
71:5915-5921[Abstract].
|
| 37.
|
Renne, R.,
D. Blackbourn,
D. Whitby,
J. Levy, and D. Ganem.
1998.
Limited transmission of Kaposi's sarcoma-associated herpesvirus in cultured cells.
J. Virol.
72:5182-5188[Abstract/Free Full Text].
|
| 38.
|
Renne, R.,
W. Zhong,
B. Herndier,
M. McGrath,
N. Abbey,
D. Kedes, and D. Ganem.
1996.
Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture.
Nat. Med.
2:342-346[Medline].
|
| 39.
|
Rettig, M. B.,
H. J. Ma,
R. A. Vescio,
M. Pold,
G. Schiller,
D. Belson,
A. Savage,
C. Nishikubo,
C. Wu,
J. Fraser,
J. W. Said, and J. R. Berenson.
1997.
Kaposi's sarcoma-associated herpesvirus infection of bone marrow dendritic cells from multiple myeloma patients.
Science
276:1851-1854[Abstract/Free Full Text].
|
| 40.
|
Rose, T. M.,
K. B. Strand,
E. R. Schultz,
G. Schaefer,
G. W. Rankin, Jr.,
M. E. Thouless,
C. C. Tsai, and M. L. Bosch.
1997.
Identification of two homologs of the Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in retroperitoneal fibromatosis of different macaque species.
J. Virol.
71:4138-4144[Abstract].
|
| 41.
|
Russo, J. J.,
R. A. Bohenzky,
M. C. Chien,
J. Chen,
M. Yan,
D. Maddalena,
J. P. Parry,
D. Peruzzi,
I. S. Edelman,
Y. Chang, and P. S. Moore.
1996.
Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8).
Proc. Natl. Acad. Sci. USA
93:14862-14867[Abstract/Free Full Text].
|
| 42.
|
Said, J. W.,
K. Chien,
S. Takeuchi,
T. Tasaka,
H. Asou,
S. K. Cho,
S. de Vos,
E. Cesarman,
D. M. Knowles, and H. P. Koeffler.
1996.
Kaposi's sarcoma-associated herpesvirus (KSHV or HHV-8) in primary effusion lymphoma: ultrastructural demonstration of herpesvirus in lymphoma cells.
Blood
87:4937-4943[Abstract/Free Full Text].
|
| 43.
|
Sarid, R.,
O. Flore,
R. A. Bohenzky,
Y. Chang, and P. S. Moore.
1998.
Transcription mapping of the Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) genome in a body cavity-based lymphoma cell line (BC-1).
J. Virol.
72:1005-1012[Abstract/Free Full Text].
|
| 44.
|
Simpson, G. R.,
T. F. Schulz,
D. Whitby,
P. M. Cook,
C. Boshoff,
L. Rainbow,
M. R. Howard,
S. J. Gao,
R. A. Bohenzky,
P. Simmonds,
C. Lee,
A. de Ruiter,
A. Hatzakis,
R. S. Tedder,
I. V. Weller,
R. A. Weiss, and P. S. Moore.
1996.
Prevalence of Kaposi's sarcoma associated herpesvirus infection measured by antibodies to recombinant capsid protein and latent immunofluorescence antigen.
Lancet
348:1133-1138[Medline].
|
| 45.
|
Soulier, J.,
L. Grollet,
E. Oksenhendler,
P. Cacoub,
H. D. Cazals,
P. Babinet,
M. F. d'Agay,
J. P. Clauvel,
M. Raphael,
L. Degos, et al.
1995.
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease.
Blood
86:1276-1280[Abstract/Free Full Text].
|
| 46.
|
Thome, M.,
P. Schneider,
K. Hofmann,
H. Fickenscher,
E. Meinl,
F. Neipel,
C. Mattmann,
K. Burns,
J. L. Bodmer,
M. Schroter,
C. Scaffidi,
P. H. Krammer,
M. E. Peter, and J. Tschopp.
1997.
Viral FLICE-inhibitory proteins (FLIPs) prevent apoptosis induced by death receptors.
Nature
386:517-521[Medline].
|
| 47.
|
Vieira, J.,
M. L. Huang,
D. M. Koelle, and L. Corey.
1997.
Transmissible Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in saliva of men with a history of Kaposi's sarcoma.
J. Virol.
71:7083-7087[Abstract].
|
| 48.
|
Virgin, H. W.,
P. Latreille,
P. Wamsley,
K. Hallsworth,
K. E. Weck,
C. A. Dal, and S. H. Speck.
1997.
Complete sequence and genomic analysis of murine gammaherpesvirus 68.
J. Virol.
71:5894-5904[Abstract].
|
Journal of Virology, October 1998, p. 8143-8149, Vol. 72, No. 10
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Subramanian, R., D'Auvergne, O., Kong, H., Kousoulas, K. G.
(2008). The Cytoplasmic Terminus of Kaposi's Sarcoma-Associated Herpesvirus Glycoprotein B Is Not Essential for Virion Egress and Infectivity. J. Virol.
82: 7144-7154
[Abstract]
[Full Text]
-
Rappocciolo, G., Hensler, H. R., Jais, M., Reinhart, T. A., Pegu, A., Jenkins, F. J., Rinaldo, C. R.
(2008). Human Herpesvirus 8 Infects and Replicates in Primary Cultures of Activated B Lymphocytes through DC-SIGN. J. Virol.
82: 4793-4806
[Abstract]
[Full Text]
-
Chen, L., Lagunoff, M.
(2005). Establishment and Maintenance of Kaposi's Sarcoma-Associated Herpesvirus Latency in B Cells. J. Virol.
79: 14383-14391
[Abstract]
[Full Text]
-
Gasperini, P., Barbierato, M., Martinelli, C., Rigotti, P., Marchini, F., Masserizzi, G., Leoncini, F., Chieco-Bianchi, L., Schulz, T. F., Calabro, M. L.
(2005). Use of a BJAB-Derived Cell Line for Isolation of Human Herpesvirus 8. J. Clin. Microbiol.
43: 2866-2875
[Abstract]
[Full Text]
-
Staudt, M. R., Kanan, Y., Jeong, J. H., Papin, J. F., Hines-Boykin, R., Dittmer, D. P.
(2004). The Tumor Microenvironment Controls Primary Effusion Lymphoma Growth in Vivo. Cancer Res.
64: 4790-4799
[Abstract]
[Full Text]
-
Luna, R. E., Zhou, F., Baghian, A., Chouljenko, V., Forghani, B., Gao, S.-J., Kousoulas, K. G.
(2004). Kaposi's Sarcoma-Associated Herpesvirus Glycoprotein K8.1 Is Dispensable for Virus Entry. J. Virol.
78: 6389-6398
[Abstract]
[Full Text]
-
Jeong, J. H., Orvis, J., Kim, J. W., McMurtrey, C. P., Renne, R., Dittmer, D. P.
(2004). Regulation and Autoregulation of the Promoter for the Latency-associated Nuclear Antigen of Kaposi's Sarcoma-associated Herpesvirus. J. Biol. Chem.
279: 16822-16831
[Abstract]
[Full Text]
-
Gao, S.-J., Deng, J.-H., Zhou, F.-C.
(2003). Productive Lytic Replication of a Recombinant Kaposi's Sarcoma-Associated Herpesvirus in Efficient Primary Infection of Primary Human Endothelial Cells. J. Virol.
77: 9738-9749
[Abstract]
[Full Text]
-
Bechtel, J. T., Liang, Y., Hvidding, J., Ganem, D.
(2003). Host Range of Kaposi's Sarcoma-Associated Herpesvirus in Cultured Cells. J. Virol.
77: 6474-6481
[Abstract]
[Full Text]
-
Jeong, J. H., Hines-Boykin, R., Ash, J. D., Dittmer, D. P.
(2002). Tissue Specificity of the Kaposi's Sarcoma-Associated Herpesvirus Latent Nuclear Antigen (LANA/orf73) Promoter in Transgenic Mice. J. Virol.
76: 11024-11032
[Abstract]
[Full Text]
-
Zhou, F.-C., Zhang, Y.-J., Deng, J.-H., Wang, X.-P., Pan, H.-Y., Hettler, E., Gao, S.-J.
(2002). Efficient Infection by a Recombinant Kaposi's Sarcoma-Associated Herpesvirus Cloned in a Bacterial Artificial Chromosome: Application for Genetic Analysis. J. Virol.
76: 6185-6196
[Abstract]
[Full Text]
-
Zoeteweij, J. P., Moses, A. V., Rinderknecht, A. S., Davis, D. A., Overwijk, W. W., Yarchoan, R., Orenstein, J. M., Blauvelt, A.
(2001). Targeted inhibition of calcineurin signaling blocks calcium-dependent reactivation of Kaposi sarcoma-associated herpesvirus. Blood
97: 2374-2380
[Abstract]
[Full Text]
-
Jeong, J., Papin, J., Dittmer, D.
(2001). Differential Regulation of the Overlapping Kaposi's Sarcoma-Associated Herpesvirus vGCR (orf74) and LANA (orf73) Promoters. J. Virol.
75: 1798-1807
[Abstract]
[Full Text]
-
Krithivas, A., Young, D. B., Liao, G., Greene, D., Hayward, S. D.
(2000). Human Herpesvirus 8 LANA Interacts with Proteins of the mSin3 Corepressor Complex and Negatively Regulates Epstein-Barr Virus Gene Expression in Dually Infected PEL Cells. J. Virol.
74: 9637-9645
[Abstract]
[Full Text]
-
Pica, F., Volpi, A., Serafino, A., Fraschetti, M., Franzese, O., Garaci, E.
(2000). Autocrine nerve growth factor is essential for cell survival and viral maturation in HHV-8-infected primary effusion lymphoma cells. Blood
95: 2905-2912
[Abstract]
[Full Text]
-
Aguirre, A. J., Robertson, E. S.
(2000). Epstein-Barr Virus Recombinants from BC-1 and BC-2 Can Immortalize Human Primary B Lymphocytes with Different Levels of Efficiency and in the Absence of Coinfection by Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
74: 735-743
[Abstract]
[Full Text]
-
Dittmer, D., Stoddart, C., Renne, R., Linquist-Stepps, V., Moreno, M.E., Bare, C., McCune, J.M., Ganem, D.
(1999). Experimental Transmission of Kaposi's Sarcoma-Associated Herpesvirus (Kshv/Hhv-8) to Scid-Hu Thy/Liv Mice. JEM
190: 1857-1868
[Abstract]
[Full Text]
-
Szekely, L., Kiss, C., Mattsson, K., Kashuba, E., Pokrovskaja, K., Juhasz, A., Holmvall, P., Klein, G.
(1999). Human herpesvirus-8-encoded LNA-1 accumulates in heterochromatin-associated nuclear bodies. J. Gen. Virol.
80: 2889-2900
[Abstract]
[Full Text]
Top
Abstract
Introduction
