Previous Article | Next Article 
Journal of Virology, October 1998, p. 7985-7991, Vol. 72, No. 10
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
A Virus-Encoded RNA Polymerase Purified from
Baculovirus-Infected Cells
Linda A.
Guarino,1,2,3,*
Bin
Xu,1
Jianping
Jin,1 and
Wen
Dong2
Departments of Biochemistry and
Biophysics1 and
Entomology2 and
Center of
Advanced Invertebrate Molecular Sciences,3
Texas A&M University, College Station, Texas 77843-2128
Received 16 March 1998/Accepted 25 June 1998
 |
ABSTRACT |
A DNA-dependent RNA polymerase was purified to homogeneity,
starting from insect cells infected with the baculovirus
Autographa californica nuclear polyhedrosis virus (AcNPV).
The purified polymerase supported accurate and specific transcription
from late and very late promoters but was not active on viral early
promoters. Thus, promoter recognition is an integral function of the
purified enzyme. The purified RNA polymerase was composed of only four
equimolar subunits, which makes it the simplest DNA-directed RNA
polymerase from a eukaryotic source described so far. Amino-terminal
protein sequencing, peptide fingerprinting, and immunochemical analyses were used to identify the four subunits, all of which are virus encoded. Overexpression of the four viral proteins (LEF-8, LEF-4, LEF-9, and p47) in baculovirus-infected cells resulted in a significant increase in the levels of RNA polymerase produced in the infected cells. Thus, the overexpression data are consistent with our
identification of the RNA polymerase subunits.
 |
INTRODUCTION |
Autographa californica
nuclear polyhedrosis virus (AcNPV) is the prototype member of the
Baculoviridae, a large family of DNA viruses that are
pathogenic for invertebrates. AcNPV has a circular DNA genome of 134 kb
and potentially encodes 154 proteins (1). Like many DNA
viruses, AcNPV gene expression is temporally regulated. Both
immediate-early and delayed-early genes are expressed before viral DNA
replication, while late and very late gene expression is dependent on
viral DNA replication (4). Unlike other eukaryotic DNA
viruses that replicate in host nuclei, baculoviruses use two different
RNA polymerases for transcription of their genes. The early viral genes
are transcribed by host RNA polymerase II (12, 18), and the
early promoters contain motifs common to RNA polymerase II promoters
(16, 24). The late and very late genes, however, are
transcribed by an RNA polymerase that is resistant to
-amanitin and
is chromatographically distinct from the three host RNA polymerases (15, 31). In addition, the baculovirus late promoters lack motifs characteristic of promoters recognized by all three host polymerases. The nucleotide sequences that are essential for late transcription have been mapped to a conserved 12-bp motif surrounding the start of transcription (16, 25, 26). Taken together, these data suggest that the virus encodes its own RNA polymerase. However, it has proven difficult to purify the virus-induced polymerase to homogeneity (3, 31). Surprising, the complete sequence of
the viral genome failed to reveal proteins with extensive homology to
other DNA-dependent RNA polymerases (1), although limited sequence similarities were noted for two viral proteins, LEF-8 and
LEF-9 (19, 23).
To better understand the mechanisms of transcriptional regulation of
the AcNPV late and very late genes, two approaches have been used. Todd
et al. (29) used a transient expression assay to identify 18 viral proteins involved in the temporal expression of late and very
late genes. Approximately half of these are required for early gene
expression and DNA replication, while the remaining are potential
candidates for the virus-encoded RNA polymerase and associated
transcription factors. We and others (13, 20, 30) have
developed in vitro transcription systems for the AcNPV late promoters.
We constructed transcription templates containing cytidine-free
cassettes linked to either the 39k late promoter or the
polyhedrin (polh) very late promoter (30). Here
we report the use of this template-specific assay to purify the RNA
polymerase responsible for transcription of viral late genes. The RNA
polymerase is a complex of four virus-encoded proteins and has both
promoter recognition and catalytic activities.
 |
MATERIALS AND METHODS |
Preparation of nuclear extracts.
Spodoptera frugiperda
(Sf9) cells were cultured and infected with the E2 strain of AcNPV as
previously described (28). Nuclear extracts were prepared
from AcNPV-infected Sf9 cells at 36 h postinfection, with two
modifications to the previous protocol (30). After Dounce
homogenization, the nuclei were washed twice by low-speed centrifugation in hypotonic buffer containing 6% sucrose and then pelleted through a 30% sucrose cushion by centrifugation at 3,000 × g for 10 min. After centrifugation of the nuclear
extracts at 100,000 × g, the supernatants were frozen
in liquid nitrogen and stored at
80°C.
Purification of the RNA polymerase complex.
All procedures
were carried out at 4°C. Nuclear extracts were prepared from two to
five 1-liter cultures and frozen until a total of 25 liters of infected
cells had been collected. Pooled nuclear extracts were treated with
0.1% polymin P to precipitate nucleic acids. Soluble proteins were
then precipitated with 50% ammonium sulfate. The ammonium sulfate
precipitate was collected by centrifugation, resuspended in 25 ml of
buffer A (50 mM Tris [pH 7.9], 0.1 mM EDTA, 1 mM dithiothreitol)
containing 0.5 M (NH4)2SO4, and
loaded onto a 12-ml phenyl-Sepharose column (Pharmacia) at a rate of 2 ml/min. The column was washed with 50 ml of buffer A-0.5 M
(NH4)2SO4, and bound protein was
eluted with buffer A-300 mM KCl-0.5%
3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS;
Pierce). Fractions (1.8 ml) were collected and assayed for
transcription activity. Active fractions were pooled, dialyzed against
buffer A-300 mM KCl-0.1% CHAPS, and applied at 1 ml/min to a 5-ml
heparin (Bio-Rad) column connected to a Pharmacia FPLC system
previously equilibrated with buffer A-300 mM KCl-0.1% CHAPS. The
column was washed with loading buffer and eluted with a 20-ml linear
gradient from 300 to 500 mM KCl. Peak fractions were pooled, the KCl
concentration was adjusted to 250 mM, and the protein was applied to a
Mono Q HR 5/5 column (Pharmacia) previously equilibrated with buffer
A-200 mM KCl-0.1% CHAPS. The column was washed with 10 ml of loading
buffer and then eluted with a 20-ml linear KCl gradient from 200 to 500 mM. Fractions that contained transcription activity were concentrated
to 200 µl and filtered through a Superose 6 column in buffer A-2 M
KCl-0.1% CHAPS. Fractions (0.5 ml) were individually dialyzed against
buffer A-250 mM KCl-0.1% CHAPS, assayed for transcription activity,
frozen in liquid nitrogen, and stored at
80°C. Protein
concentrations of the crude extract and partially purified fractions
were determined by the method of Bradford (6). The
concentration of the purified complex was determined by UV absorbance
using a molar extinction coefficient of 259,350, predicted by the amino
acid sequences of the four subunits (1).
In vitro transcription assays.
In vitro transcription assays
for AcNPV late and very late promoters were performed by using slight
modifications of conditions previously described (30).
Transcription reaction mixtures contained 50 µg of nuclear extract or
10 µl of column fractions and the following components in a volume of
50 µl: 25 mM Tris (pH 7.9), 100 mM KCl, 2 mM MgCl2, 1 mM dithiothreitol, 1.0 mM each ATP and UTP, 20 µM GTP, 5 µCi of [
-32P]GTP (800 Ci/mmol), 5 U of RNasin, 0.2 U
of inorganic pyrophosphatase, and 1.0 µg each of Polh/CFS and
39kL/CFS (described in Results). Addition of
-amanitin was not
necessary and was not routinely used. As shown by Xu et al.
(30), the host RNA polymerases cannot transcribe the
baculovirus templates used in these assays. Components were added to
the enzyme at the same time, reaction mixtures were incubated for 12 min at 30°C, and then the reaction was stopped by the addition of 150 µl of stop buffer (50 mM Tris [pH 7.5], 1% sodium dodecyl sulfate
[SDS], 5 mM EDTA, 25 µg of tRNA per ml). RNA was extracted once
with phenol-chloroform (1:1), precipitated with ethanol, resuspended in
90% formamide, and resolved on a 6% polyacrylamide-8 M urea gel. For
quantitation of RNA polymerase activity, transcription reaction
mixtures were spotted onto glass fiber filters and precipitated with
trichloroacetic acid. By definition, 1 U of transcription activity
incorporates 1 pmol of GMP into RNA in 30 min at 30°C. The conditions
for in vitro transcription from early viral promoters have been
previously described (32).
Peptide sequencing.
Purified RNA polymerase was
concentrated, loaded into two wells of an SDS-8% polyacrylamide gel,
and then electrophoresed. Proteins were transferred to polyvinylidene
difluoride membranes, stained with Ponceau S, and submitted to the
Protein/Peptide Micro Analytical Laboratory (California Institute of
Technology). Samples were submitted to automated Edman degradation on
an Applied Biosystems 476A sequencer. N-terminal amino acid sequences
were obtained for the two smallest proteins. No useful sequence
information was obtained for the two larger proteins.
Trypsin digestion followed by mass analysis was used for identification
of the second-largest protein. After electrophoresis on an
SDS-polyacrylamide gel (SDS-PAGE), proteins were stained in
0.1% Coomassie blue in water. The protein was excised, and subsequent
digestion with trypsin and mass analysis were conducted at the
Protein/Peptide Micro Analytical Laboratory (California Institute of
Technology). Mass spectrometry was performed on a Perseptive
Biosystems Elite matrix-assisted laser desorption ionization time-of-flight (MALDI TOF) apparatus. Tryptic peptides masses were used
by the MOWSE program to search a peptide mass database constructed from
a theoretical trypsin digest of all proteins in the OWL database
(21). Search parameters used were a molecular weight filter
of 25%, a mass tolerance of 0.1%, and a partial cleavage score factor
of 0.2.
Preparation of LEF-8 antiserum.
The AcNPV lef-8
gene was amplified by PCR using an upstream primer
(5'-AATCGCTTCCATATGACGGACGTGGTTCAAG-3') which
produced an NdeI site (underlined) at the translation
initiation codon of the lef-8 coding sequence and a second
primer (5'-GTTTGCAATCGTGCAAGC-3') that hybridized downstream
of the lef-8 stop codon. The amplified fragment was first
cloned into the pCRII vector (Invitrogen) and then subcloned into the
T7 expression vector pET15b (Novagen). The resulting plasmid, pET-lef8,
was used to express LEF-8 in Escherichia coli BL21(DE3)LysE
cells. Overexpressed LEF-8 protein was purified by SDS-PAGE and used to
generate polyclonal antiserum in mice by using a standard immunization
protocol (17).
Samples for immunoblot analysis were boiled for 3 min and
electrophoresed on an 8% acrylamide gel. The proteins were
electrophoretically
transferred to nitrocellulose sheets by using a
semidry apparatus.
The sheets were reacted with LEF-8 antiserum, and
immune complexes
were detected by using alkaline phosphatase-conjugated
anti-mouse
immunoglobulin G.
Primer extension mapping of lef-9.
Total RNA was
isolated from AcNPV-infected cells by the guanidine
isothiocyanate-cesium chloride method (10). A
lef-9 specific primer (GTGAGGGTCTAATATGAGG) was
radiolabeled at the 5' end and hybridized with 20 µg of RNA. Annealed
primers were extended with avian myeloblastosis virus reverse
transcriptase (27). Reaction products were analyzed on 6%
polyacrylamide-8 M urea gels. Sequencing ladders were generated by
using pPstI-H DNA (14) and the same oligonucleotide primer.
Construction of vBAC-RNApol.
The transfer vector pBAC4x-1
(Novagen) contains two copies of the polh promoter and two
copies of the p10 promoter with unique restriction sites
downstream of each promoter. The four RNA polymerase subunit genes were
cloned into this plasmid for overexpression of AcNPV RNA polymerase in
infected cells according to standard cloning protocols (27).
A BamHI site
(GTGCGCAGTAATGGATCCACGATGACGGAC; BamHI site underlined) was inserted upstream of the
lef-8 open reading frame (ORF) in the genomic clone
pEcoRI-M by site-directed mutagenesis (11). The resulting
2-kb BamHI-EcoRI fragment containing lef-8 was cloned into pBAC4x-1 (Novagen) under
polyhedrin control. The AcNPV genomic clone pHindIII-C was digested
with NarI and XhoI and incubated with Klenow
enzyme and deoxynucleoside triphosphates to fill in 5' overhangs. A
1.6-kb fragment containing the complete lef-4 ORF was
purified by agarose gel electrophoresis and cloned into the
SmaI site of pBAC4x-lef8. Insertion of the fragment in the
correct orientation was determined by restriction digestions. Site-directed mutagenesis was used to construct a BamHI site
(underlined) upstream of the lef-9 ORF
(ACGCGTTCGTGTACGGATCCAAACATGTTT). The resulting
plasmid was digested with BamHI and BglII, and
the ends were repaired with Klenow enzyme. A 1.4-kb fragment containing lef-9 was cloned into the StuI site of
pBAC4x-lef8/lef4 under the control of the polh promoter. The
orientation of the insert was screened by restriction digest analysis.
The genomic clone pPstI-F was digested with EcoRI and
PstI. A 2.3-kb fragment containing p47 was cloned into the
EcoRI and PstI sites of pVL1393. The p47 ORF was
excised from this plasmid by digestion BglII, followed by
repair with Klenow enzyme and digestion with BamHI. The
p47 fragment was then ligated with pBAC-lef8/lef4/lef9
previously prepared by digestion with Bsu36I, repair with
Klenow enzyme, and digested with BglII. The resulting
plasmid, pBAC-RNApol, was cotransfected with linearized BakPAK6
(Clontech) DNA into Sf9 cells. Recombinant viruses were amplified and
used to prepare nuclear extracts by the same protocol as described
above except that cells were harvested at 60 h postinfection and
the polymin P concentration was increased to 0.2%.
 |
RESULTS |
Purification of baculovirus RNA polymerase complex.
AcNPV RNA polymerase was purified by chromatography of
nuclear extracts on phenyl-Sepharose, heparin-agarose, and Mono Q
resin, followed by gel filtration through Superose 6 (Table
1). RNA polymerase activity was tested
after each purification step by using a baculovirus promoter-specific
assay as previously described (30). The transcription
complex eluted in a single peak from each column, indicating that all
factors required for enzymatic activity and promoter recognition were
tightly associated in a single complex. In the crude extract and in the
phenyl-Sepharose peak, transcription activity was not linear with
respect to amount of protein added, probably because of contaminating
nucleases or other proteins that interfere with the assay. Therefore,
it was necessary to calculate the purification and yield relative to
the heparin peak, and as a result, the values shown in Table 1
underestimate the overall purification. The specific activity of the
purified RNA polymerase was approximately 123,000 U/mg of protein.
The distribution of transcription activity on Superose 6 coincided with
a peak of protein as measured by absorbance at 280
nm (Fig.
1A). RNA polymerase
fractionated with an apparent molecular
weight of 560,000. When
fractions across the peak were assayed
by SDS-PAGE, four polypeptides
with apparent molecular weights
of 98,000, 55,000, 53,000, and 46,000 were found to increase and
decrease concomitant with the peak of
enzymatic activity as well
as with the peak of protein (Fig.
1B).
Additional bands were detected
in the molecular weight range of 55,000 to 65,000. These probably
represent contaminating keratins since they
were observed in most
lanes, including lanes with no protein loaded.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Gel filtration chromatography of RNA polymerase. RNA
polymerase was filtered through Superose 6. Fractions (0.5 ml) were
collected from 10 to 15 ml and assayed for transcription activity. The
indicated fractions were assayed for in vitro transcription activity as
described in Materials and Methods. A transcription assay of the pooled
Mono Q peak is shown in lane 2. Lane 1 contains
X174-HinfI molecular markers, and the sizes (in
kilobases) of relevant fragments are shown on the left. The transcripts
corresponding to Polh/CFS and 39kL/CFS are indicated on the right. The
positions of elution of blue dextran 2000 (BD), thyroglobulin
(THY; 669 kDa), ferritin (FER; 4043 kDa), catalase (CAT; 232 kDa), and aldolase (ALD; 158 kDa) were determined
by elution of protein standards under the same conditions. (B) Proteins
in the corresponding fractions were separated by electrophoresis on an
SDS-8% polyacrylamide gel and visualized by staining with silver. The
apparent molecular weights (in kilodaltons) of the bands that
correspond with transcription activity are shown on the right. The
migration of protein molecular weight markers (in kilodaltons) are
indicated on the left. (C) Quantitation of subunits. Purified RNA
polymerase (lanes 8 and 9 contain 300 and 150 ng, respectively) was
separated by SDS-PAGE and stained with Coomassie brilliant blue. Lanes
2 to 6 contain bovine serum albumin (100, 200, 400, 600, and 800 ng);
lane 1 contains molecular markers.
|
|
The stoichiometry of the four proteins was determined to be equimolar
on the basis of Coomassie brilliant blue staining relative
to protein
markers of known concentration (Fig.
1C), which suggests
that an active
transcription complex contains two molecules of
each subunit. There was
no evidence for additional protein bands
in the Coomassie blue-stained
gel, which suggests that contaminating
proteins, if present, were
submolar. Analysis of polymerase subunits
on a 13% polyacrylamide gel,
followed by staining with either
silver or Coomassie blue, failed to
reveal the presence of smaller
subunits (data not shown).
Template specificity of the baculovirus RNA polymerase.
In
vitro transcription reactions were performed with 30 ng of purified
protein and the indicated DNA templates (Fig.
2). No transcripts were detected in the
absence of template (lane 2) or in the presence of pCFS
(30), the parental cytidine-free cassette (lane 3).
When the AcNPV late promoter construct (39kL/CFS) and the
very late promoter construct (Polh/CFS) were separately added to
transcription reactions, both templates were accurately transcribed
(lanes 4 and 5). Both supercoiled and linear templates were transcribed
by the RNA polymerase complex with essentially equal efficiencies
(lanes 6 and 7).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 2.
Template specificity of the very late transcription
complex. To analyze transcription of late and very late templates, in
vitro transcription assays were performed with 30 ng of purified RNA
polymerase (RNApol) and the indicated templates. Plasmids Polh/CFS and
39kL/CFS contain the polh promoter linked to a short
cytidine-free template as previously described (30). Plasmid
39kE/CFS contains the short cytidine-free template linked to the early
39k promoter. The transcripts corresponding to Polh, 39kL,
and 39kE are indicated on the right. The 39kE/CFS template was
transcribed by using purified RNA polymerase (lanes 8 and 10) or with
extracts prepared during the early phase of viral infection (lanes 9 and 11) and assayed under conditions optimal for transcription of late
templates (lanes 8 and 9) or early templates (lanes 10 and 11). X174
DNA digested with HinfI was added to lane 1, and the sizes
(in kilobases) of relevant fragments are indicated on the left.
|
|
The purified complex was also not active on 39kE/CFS, a construct that
contains the cytidine-free cassette linked to the early
promoter for
the
39k gene (
16). This early promoter is a
typical
RNA polymerase II promoter and contains a TATA box and a CAGT
initiator element. 39kE/CFS is transcribed by nuclear extracts
prepared
from AcNPV-infected insect cells harvested at 8 h postinfection
(lanes 9 and 11). Transcription of this template was more efficient
with conditions optimal for RNA polymerase II templates (6 mM
Mg
2+ and a 15-min preincubation) than with conditions
optimal for
viral late templates (2 mM Mg
2+ and no
preincubation). Transcripts that are longer than expected
are commonly
seen with crude nuclear extracts, presumably due
to the presence of
contaminating CTP. 39kE/CFS was not transcribed
by the viral RNA
polymerase under standard conditions for late
(lane 8) or for early
promoters (lane 10). These data demonstrate
that the four-subunit RNA
polymerase contains elements necessary
for both promoter recognition
and enzymatic activity.
Identification of protein subunits.
The two smallest RNA
polymerase subunits were identified by N-terminal amino acid
sequence. Purified RNA polymerase subunits were
separated by electrophoresis on SDS-8% polyacrylamide gels, transferred to polyvinylidene difluoride membranes, and submitted for automated Edman degradation. The sequence of the smallest subunit
was Met-Phe-Val-Thr-Arg-Leu. The only perfect match for this sequence
in the combined SwissProt/GenBank protein databases is the AcNPV
protein known as p47. The gene encoding p47 was originally identified
as the site of the temperature-sensitive mutant ts317 (8). This mutant was defective in the release of
infectious virus and expression of polyhedrin at the nonpermissive
temperature, although viral DNA synthesis appeared to be normal. This
phenotype suggested that the mutation disrupted a function required for transcription of late and very late genes. p47 was also identified by
Todd et al. (29) as one of the 18 genes required for
transient expression of reporter genes under the control of baculovirus late and very late promoters. The p47 gene is predicted to
encode a protein of 47.5 kDa, which is in good agreement
with an apparent molecular mass of 46 kDa calculated from SDS-gels
(Fig. 1). Thus, identification of p47 as one of the RNA polymerase
subunits is consistent with the known biology of the protein.
The N-terminal sequence of the next-smallest subunit was determined to
be Met-Phe-Ser-Phe-Leu-Asp. The only perfect match
to this sequence in
the protein databases was the AcNPV LEF-9
protein. The
lef-9
gene was originally mapped by Lu and Miller
(
19) as part of
a screen for viral genes required for transient
expression of
baculovirus late and very late genes. The amino
acid sequence that we
determined corresponds to residues 27 to
32 of the LEF-9 ORF as
originally published (
19). However, in
that report,
transcriptional mapping of the
lef-9 gene was not
performed
and the ORF was assumed to start at the furthest upstream
methionine
codon. This discrepancy suggests either that the protein
we sequenced
was subject to posttranslational processing or the
incorrect start site
was identified by Lu and Miller (
19).
To address the question of which methionine codon was used for
initiation of translation of the
lef-9 ORF, we performed
primer
extension assays. RNA purified from AcNPV-infected cells was
hybridized
with an oligonucleotide complementary to a sequence within
the
N terminus of ORF-9. We found that the 5' ends of
lef-9
transcripts
mapped to heterogeneous sites between the upstream
methionine
codon and the residue identified in our sequence analysis
(Fig.
3). Transcription initiating from
two start sites proximal to
the
lef-9 ORF was detected
primarily at the 6-h time point, although
low levels of transcripts
could be detected at earlier and later
times. The proximal transcripts
initiated at a CACT motif, which
occurs 26 nucleotides downstream of a
TATA sequence. This arrangement
of promoter motifs is similar to that
found in many of the baculovirus
early promoters, in which initiation
begins at a CAGT motif (
4).
A single distal transcription
start site was mapped to a point
12 nucleotides further upstream.
Sequences surrounding this start
site do not correspond to consensus
early promoters. Transcription
from this point was detected in at
6 h postinfection, and transcripts
persisted through 36 h
postinfection.

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 3.
Primer extension mapping of lef-9 mRNA. Total
cellular RNA was isolated from AcNPV-infected Sf9 cells at the
indicated times postinfection. The 5' end of the transcripts was mapped
by primer extension analysis using an oligonucleotide complementary to
nt 49300 to 49319 of the AcNPV genome sequence (1).
Sequencing ladders were generated by using the same primer. The
sequence ladder is antisense relative to the sequence of the
lef-9 promoter shown below. The primer extension products
are denoted by arrows on the right and correspond to arrows above the
sequence, which indicate the transcription start sites. The amino acid
residues identified by N-terminal sequencing are shown in uppercase;
the 26-residues predicted to be at the N terminus of LEF-9 are shown in
lowercase.
|
|
Our primer extension data strongly argue that the LEF-9 ORF initiates
with the sequence Met-Phe-Ser-Phe-Leu-Asp and not at
the upstream site
previously identified (
19). Recalculation
of the molecular
weight for LEF-9 according to our protein sequence
data predicts a
polypeptide of 56 kDa, which is closer to the
apparent molecular weight
of this subunit than the previously
published value of 59 kDa.
N-terminal sequence analysis of the 55-kDa polypeptide failed to yield
useful sequence information. Therefore, protein fingerprinting
was used
to identify this subunit. An SDS-polyacrylamide gel slice
containing
the 55-kDa subunit was digested with trypsin, and then
the eluted
peptides were analyzed by mass spectroscopy to determine
their
molecular masses. The masses of all tryptic peptides were
entered into
the MOWSE database searching program (
21), which
matches
peptide fingerprints of an unknown protein with the predicted
fingerprints of all ORFs in the OWL database. The most significant
match returned by the database search was for the AcNPV LEF-4
protein. Eleven of the 19 tryptic peptides entered matched those
predicted for LEF-4, which confirms the identity of this protein
(Table
2). LEF-4 was first mapped by Passarelli
and Miller (
22)
as a factor required for expression of viral
late genes, and it
was subsequently identified as the site of a
temperature-sensitive
mutation producing a phenotype similar to the p47
mutation described
above (
7). The predicted molecular size
of LEF-4 is 54 kDa,
consistent with an apparent molecular size of 55 kDa calculated
from Fig.
1B.
Attempts to sequence the largest subunit were not successful. However,
we were able to predict and confirm the identity of
the protein by
immunochemical analysis. AcNPV encodes relatively
few proteins in the
molecular weight range observed for the largest
subunit. One of these,
LEF-8, contains a conserved sequence motif
that is common to
prokaryotic and eukaryotic RNA polymerases (
23).
In
addition, LEF-8 is required for viral late and very late gene
expression in a transient assay, consistent with its proposed
role as a
component of the virus-specific RNA polymerase. Therefore,
we
raised antiserum against LEF-8 expressed in bacteria and
immunoblotted
fractions across the Superose 6 peak. As shown in Fig.
4, the
large subunit of purified
RNA polymerase was recognized by the
LEF-8 antiserum. The intensity of
the immunoreactive bands closely
correlated with the peak of
transcription activity. We conclude,
therefore, that the large subunit
is encoded by
lef-8.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
Recognition of the large subunit with LEF-8 antiserum.
(A) The Mono Q peak fraction (lane 2) was filtered through Superose 6 as described in the legend to Fig. 1. Proteins corresponding to the
peak of protein at 560,000 were assayed for transcription activity
(lanes 3 to 8). Positions of the polh and 39kL
transcripts are indicated on the right. X174 molecular markers are
shown in lane 1. (B) Superose 6 fractions containing transcription
activity were electrophoresed on SDS-8% polyacrylamide gels,
transferred to nitrocellulose membranes, and probed with LEF-8
antiserum. Lane 1, prestained molecular weight markers, with sizes (in
kilodaltons) indicated on the left. The position of the immunoreactive
protein is shown on the right.
|
|
Cloning and overexpression of RNA polymerase.
To confirm that
the RNA polymerase subunits had been correctly identified, we cloned
the genes encoding p47, LEF-9, LEF-4, and LEF-8 into the baculovirus
transfer vector pBAC4x-1. This plasmid contains two copies of the
polh promoter and two copies of the p10 promoter
and allows for overexpression of four proteins in a baculovirus
expression system. Sf9 cells were infected with the recombinant virus
pBAC-RNApol, and nuclear extracts were prepared from cells harvested at
60 h postinfection. In a wild-type virus infection, in vivo
synthesis of viral RNAs had ceased by 60 h postinfection, and RNA
polymerase activity was undetectable in extracts prepared from
wild-type virus-infected cells harvested at this time (data not shown).
However, in cells infected with pBAC-RNApol, transcription activity was
high in extracts prepared at 60 h postinfection. Overall yields of
RNA polymerase per liter of infected cells were 10-fold higher than
yields with wild-type virus harvested at 36 h postinfection (Table
3). From 5 liters of cells infected with
pBAC-RNApol we were able to purify 70 µg of RNA polymerase, while the
yield from wild-type virus-infected cells was only 36 µg from 25 liters of infected cells.
 |
DISCUSSION |
Since the discovery of a novel RNA polymerase activity in
baculovirus-infected cells (12, 15), the question of whether the
-amanitin-resistant polymerase is a virus-encoded enzyme or a
virus-modified host RNA polymerase has intrigued baculovirologists. This report identifying the protein subunits of the AcNPV
polymerase confirms that the polymerase responsible for transcription
of late and very late genes is encoded by the virus.
The baculovirus RNA polymerase was shown to consist of only four
subunits, p47, LEF-4, LEF-8, and LEF-9. The specific activity of the
polymerase purified from wild-type virus-infected cells indicated that
the enzyme could incorporate approximately 123 nmol of GMP per mg of
enzyme. Assuming a monomer molecular weight of 258,000, this implies
that 1 nmol of enzyme can incorporate 32 nmol of GMP. The cytidine-free
template directs incorporation of 90 GMP residues, indicating that 35%
of the RNA polymerase complexes are active in transcription. If the
viral RNA polymerase contains two molecules of each subunit as
suggested by the gel filtration data, this would suggest that 70% of
the molecules are active. This high molar activity of the purified
enzyme suggests that the transcription activity is due solely to the
four proteins detected. While we cannot rule out the possibility that
our purified polymerase preparations contain submolar amounts of other
viral or host proteins, these calculations suggest that it is unlikely that proteins present at submolar levels could significantly contribute to activity. However, definitive proof that these four proteins are
sufficient for RNA polymerase activity will require reconstitution of
activity from purified subunits.
Overexpression of the four subunits in baculovirus-infected cells was
shown to increase the yields of purified polymerase by a factor of 10. This confirms our identification of the four subunits and suggests that
one or more of these proteins are limiting for the assembly of RNA
polymerase. Furthermore, the specific activity of RNA polymerase
purified from the overexpression system was equivalent to that from
wild-type-infected cells. This finding supports our conclusion that
minor contaminating proteins do not contribute significantly to
activity, as it is unlikely that these minor proteins would contaminate
the overexpressed preparation at levels 10-fold higher than with enzyme
purified from wild-type virus-infected cells.
All four of the polymerase subunits have previously been shown to be
required for transient expression of viral late and very late genes
(29), and genetic evidence suggested that p47 and lef-4 encode late transcription factors (7).
LEF-8 and LEF-9 were predicted to encode RNA polymerase subunits, based
on the presence of conserved motifs (19, 23). This LEF-8
motif is conserved among
and
' subunits of RNA polymerases from
a number of sources and is predicted to form part of the catalytic site of the enzyme. Our data showing that LEF-8 is the largest subunit in
the purified RNA polymerase complex support this hypothesis, although
we have not yet determined whether LEF-8 is the catalytic subunit.
The baculovirus RNA polymerase was active only on templates containing
a viral late promoter. Cytidine-free templates lacking a promoter or
linked to an early promoter were not transcribed, suggesting that the
conserved TAAG motif was essential for transcription initiation. Late
and very late promoters were transcribed with equal efficiencies,
suggesting that additional factors are needed for correct temporal
expression of the two classes of late genes. In vivo, baculovirus late
and very late genes are expressed during two distinct temporal phases.
The late genes are transcribed first, and only the sequences
immediately surrounding the TAAG motif are believed to be important in
promoter selection. The very late genes are expressed after assembly of
virions, and in addition to the essential TAAG motif, an A+T-rich
region between the start of transcription and the start of translation
is important for high-level expression of the very late genes
(25). Thus, the polymerase complex that we purified is
probably lacking the factor(s) responsible for the burst of very late
transcription, and possibly it is also missing the factor(s) that
represses polyhedrin transcription during the late phase. Previously we
showed that phosphocellulose chromatography of extracts prepared from
infected cells could separate factors that altered the template
specificity of the viral RNA polymerase (30). While
phosphocellulose chromatography may be useful in the future for
purification of additional transcription factors, we found it necessary
to omit this step from our current protocol. The RNA polymerase complex
aggregates at low salt, and significant amounts of polymerase were lost
during dialysis prior to loading onto phosphocellulose.
Previous work has identified 18 viral proteins that are essential for
expression of late and very late genes (29). Eight of these
are required for early viral gene expression and DNA replication which
precede late gene expression. Therefore, a model for late gene
expression should include roles for the remaining 10 proteins. Here we
show that 4 of these 10 are components of the viral RNA polymerase.
Functions of the additional proteins probably include factors that
discriminate between late and very late genes, as mentioned above. In
addition, proteins are needed for termination of transcription, a
function which would not be identified in our assay because
transcription stalls when a cytidine is needed. Furthermore,
posttranslational processing functions (formation and methylation of 5'
caps, cleavage, and polyadenylation, for example) are probably virus
encoded as well. It is also possible some of these viral proteins are
involved in assembly of the four polymerase subunits. Since our
overexpression was done in a baculovirus system, all other viral
proteins should be present in the infected cells and could act steps
that precede initiation of transcription.
Most eukaryotic DNA viruses rely on the host RNA polymerase II for
transcription of viral genes. Poxviruses and African swine fever virus
are the only other examples of eukaryotic viruses that encode
DNA-dependent RNA polymerases, and their need for a virus-encoded
enzyme is usually attributed to the fact that they replicate in the
cytoplasm and thus do not have access to the nuclear enzymes. The
poxvirus enzymes resemble the three cellular RNA polymerases with
respect to the number and size of subunits (5). All of the
cellular enzymes contain two large subunits which share regions of
amino acid sequence homology and 4 to 12 small subunits, some of which
are common to the different cellular enzymes and homologous to the
poxvirus enzymes. The AcNPV RNA polymerase with only four subunits is
the simplest DNA-directed RNA polymerase from a eukaryotic source
described thus far. The baculovirus RNA polymerase contains only one
large subunit, and with the exception of two short motifs it shows
little homology with other RNA polymerases. This lack of similarity
with respect to sequence and structure raises interesting questions
regarding the evolutionary origin of the baculovirus RNA polymerase.
Our data suggest that baculoviruses are more similar to T7 and related
bacteriophages than to the host or other eukaryotic viruses. The
replication strategies employed by the two viruses are strikingly
similar, although one infects insect cells and the other infects
bacteria. In both cases, the early viral promoters resemble their host
promoters and are transcribed by the corresponding host RNA
polymerases. However, the structures of the viral late gene promoters
are dramatically different from those of their early promoters and they
do not contain motifs recognized by the host polymerases. In fact, the
structures of the baculovirus and T7 late promoters are more similar to
each other than either is to the structures of the promoters of their
hosts. Both promoters consist of a short conserved sequence that serves
as both a promoter and an initiator element (25, 26).
Therefore, it is not surprising to find that baculoviruses, like T7
bacteriophage (9), use a virus-encoded RNA polymerase to
transcribe viral late genes. The T7 RNA polymerase is a single
polypeptide which contains both promoter recognition and enzymatic
activities (2). Although simple in structure, the viral
polymerases transcribe their cognate genes efficiently and with high
specificity.
 |
ACKNOWLEDGMENTS |
This research was supported by grant MCB 95-06233 from the
National Science Foundation. Mass spectrometry and automated sequence analysis were performed at California Institute of Technology with
equipment purchased under NIH grant RR11292.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry and Biophysics, Room 103A, Texas A&M University, College Station, TX 77843-2128. Phone: 409-845-7556. Fax: 409-845-9274. E-mail: lguarino{at}bioch.tamu.edu.
 |
REFERENCES |
| 1.
|
Ayres, M. D.,
S. C. Howard,
J. Kuzio,
M. Lopez-Ferber, and R. D. Possee.
1994.
The complete DNA sequence of Autographa californica nuclear polyhedrosis virus.
Virology
202:586-605[Medline].
|
| 2.
|
Bailey, J. N.,
J. F. Klement, and W. T. McAllister.
1983.
Relationship between promoter structure and template specificities exhibited by the bacteriophage T3 and T7 RNA polymerases.
Proc. Natl. Acad. Sci. USA
80:2814-2818[Abstract/Free Full Text].
|
| 3.
|
Beniya, H.,
C. J. Funk,
G. F. Rohrmann, and R. F. Weaver.
1996.
Purification of a virus-induced RNA polymerase from Autographa californica nuclear polyhedrosis virus-infected Spodoptera frugiperda cells that accurately initiates late and very late transcription in vitro.
Virology
216:12-19[Medline].
|
| 4.
|
Blissard, G. W., and G. F. Rohrmann.
1990.
Baculovirus diversity and molecular biology.
Annu. Rev. Entomol.
35:127-155[Medline].
|
| 5.
|
Broyles, S. S., and B. Moss.
1987.
Homology between RNA polymerases of poxviruses, prokaryotes, and eukaryotes: nucleotide sequence and transcriptional analysis of vaccinia virus genes encoding 147-kDa and 22-kDa subunits.
Proc. Natl. Acad. Sci. USA
83:3141-3145.
|
| 6.
|
Bradford, M. M.
1976.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[Medline].
|
| 7.
|
Carstens, E. B.,
H. Chan,
H. Yu,
G. V. Williams, and R. Casselman.
1994.
Genetic analysis of temperature-sensitive mutations in baculovirus late expression factors.
Virology
204:323-337[Medline].
|
| 8.
|
Carstens, E. B.,
A. L. Lu, and H. L. B. Chan.
1993.
Sequence, transcriptional mapping, and overexpression of p47, a baculovirus gene regulating late gene expression.
J. Virol.
67:2513-2520[Abstract/Free Full Text].
|
| 9.
|
Chamberlin, M., and J. Ring.
1973.
Characterization of T7-specific ribonucleic acid polymerase. 1. General properties of the enzymatic reaction and the template specificity of the enzyme.
J. Biol. Chem.
248:2235-2244[Abstract/Free Full Text].
|
| 10.
|
Chirgwin, J. M.,
A. E. Przybyla,
R. J. McDonald, and W. J. Rutter.
1979.
Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease.
Biochemistry
18:5294-5297[Medline].
|
| 11.
|
Deng, W. P., and J. A. Nickoloff.
1992.
Site-directed mutagenesis of virtually any plasmid by eliminating a unique site.
Anal. Biochem.
200:81-84[Medline].
|
| 12.
|
Fuchs, L. Y.,
M. S. Woods, and R. F. Weaver.
1983.
Viral transcription during AcNPV infection: a novel RNA polymerase induced in infected Spodoptera fugiperda cells.
J. Virol.
48:641-646[Abstract/Free Full Text].
|
| 13.
|
Glocker, B.,
R. R. Hoopes, and G. F. Rohrmann.
1993.
In vitro transcription from baculovirus late gene promoter: accurate mRNA initiation by nuclear extracts prepared from infected Spodoptera frugiperda cells.
J. Virol.
67:3771-3776[Abstract/Free Full Text].
|
| 14.
|
Gong, M., and L. A. Guarino.
1994.
Expression of the 39k promoter of Autographa californica nuclear polyhedrosis virus is increased by the apoptotic suppressor P35.
Virology
204:38-44[Medline].
|
| 15.
|
Grula, M. A.,
P. L. Buller, and R. F. Weaver.
1981.
-Amanitin-resistant viral RNA synthesis in nuclei isolated from nuclear polyhedrosis virus-infected Heliothis zea larvae and Spodoptera frugiperda cells.
J. Virol.
38:916-921[Abstract/Free Full Text].
|
| 16.
|
Guarino, L. A., and M. Smith.
1992.
Regulation of delayed-early gene transcription of dual TATA boxes.
J. Virol.
66:3722-3739.
|
| 17.
|
Harlow, E., and D. Lane.
1988.
Antibodies: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 18.
|
Hoopes, R. R., Jr., and G. F. Rohrmann.
1991.
In vitro transcription of baculovirus immediate early genes: accurate initiation by nuclear extracts from both insect and human cells.
Proc. Natl. Acad. Sci. USA
88:4513-4517[Abstract/Free Full Text].
|
| 19.
|
Lu, A., and L. K. Miller.
1994.
Identification of three late expression factor genes within the 33.8- to 43.4-map-unit region of Autographa californica nuclear polyhedrosis virus.
J. Virol.
68:6710-6718[Abstract/Free Full Text].
|
| 20.
|
Mans, R. M., and D. Knebel-Morsdorf.
1998.
In vitro transcription of pe38/polyhedrin hybrid promoters reveals sequences essential for recognition by the baculovirus-induced RNA polymerase and for the strength of very late viral promoters.
J. Virol.
72:2991-2998[Abstract/Free Full Text].
|
| 21.
|
Pappin, D. J.,
P. Hojrup, and J. J. Bleasby.
1993.
Rapid identification of proteins by peptide-mass fingerprinting.
Curr. Biol.
3:327-332[Medline].
|
| 22.
|
Passarelli, A. L., and L. K. Miller.
1993.
Identification of genes encoding late expression factors located between 56.0 and 65.4 map units of the Autographa californica nuclear polyhedrosis virus genome.
Virology
197:704-714[Medline].
|
| 23.
|
Passarelli, A. L.,
J. W. Todd, and L. K. Miller.
1994.
A baculovirus gene involved in late gene expression predicts a large polypeptide with a conserved motif of RNA polymerases.
J. Virol.
68:4673-4678[Abstract/Free Full Text].
|
| 24.
|
Pullen, S. S., and P. D. Friesen.
1995.
Early transcription of the ie1 transregulator gene of Autographa californica nuclear polyhedrosis virus is regulated by DNA sequences within its 5' noncoding leader region.
J. Virol.
69:156-165[Abstract].
|
| 25.
|
Rankin, C. B.,
B. G. Ooi, and L. K. Miller.
1988.
Eight base pairs encompassing the transcriptional start point are the major determinant for baculovirus polyhedrin expression.
Gene
70:39-49[Medline].
|
| 26.
|
Rohrmann, G. F.
1986.
Polyhedrin structure.
J. Gen. Virol.
67:1499-1508[Abstract/Free Full Text].
|
| 27.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 28.
| Summers, M. D., and G. E. Smith. 1987. A
manual of methods for baculovirus vectors and insect cell culture
procedures. Tex. Agric. Exp. Stn. Bull. 1555.
|
| 29.
|
Todd, J. W.,
A. L. Passarelli, and L. K. Miller.
1995.
Eighteen baculovirus genes, including lef-11, p35, 39k, and p47, support late gene expression.
J. Virol.
69:968-974[Abstract].
|
| 30.
|
Xu, B.,
S. Yoo, and L. A. Guarino.
1995.
Differential transcription of baculovirus late and very late promoters: fractionation of nuclear extracts by phosphocellulose chromatography.
J. Virol.
69:2912-2917[Abstract].
|
| 31.
|
Yang, C. L.,
D. A. Stetler, and R. F. Weaver.
1991.
Structural comparison of the Autographa californica nuclear polyhedrosis virus-induced RNA polymerases from the host, Spodoptera frugiperda.
Virus Res.
20:251-264[Medline].
|
| 32.
|
Yoo, S., and L. A. Guarino.
1994.
The Autographa californica nuclear polyhedrosis virus ie2 gene encodes a transcriptional regulator.
Virology
202:746-753[Medline].
|
Journal of Virology, October 1998, p. 7985-7991, Vol. 72, No. 10
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chen, Y.-R., Wu, C.-Y., Lee, S.-T., Wu, Y.-J., Lo, C.-F., Tsai, M.-F., Wang, C.-H.
(2008). Genomic and host range studies of Maruca vitrata nucleopolyhedrovirus. J. Gen. Virol.
89: 2315-2330
[Abstract]
[Full Text]
-
Li, Y., Guarino, L. A.
(2008). Roles of LEF-4 and PTP/BVP RNA Triphosphatases in Processing of Baculovirus Late mRNAs. J. Virol.
82: 5573-5583
[Abstract]
[Full Text]
-
Duffy, S. P., Becker, E. M., Whittome, B. H., Lucarotti, C. J., Levin, D. B.
(2007). In vivo replication kinetics and transcription patterns of the nucleopolyhedrovirus (NeabNPV) of the balsam fir sawfly, Neodiprion abietis. J. Gen. Virol.
88: 1945-1951
[Abstract]
[Full Text]
-
Quadt, I., van Lent, J. W. M., Knebel-Morsdorf, D.
(2007). Studies of the Silencing of Baculovirus DNA Binding Protein. J. Virol.
81: 6122-6127
[Abstract]
[Full Text]
-
Duffy, S. P., Young, A. M., Morin, B., Lucarotti, C. J., Koop, B. F., Levin, D. B.
(2006). Sequence Analysis and Organization of the Neodiprion abietis Nucleopolyhedrovirus Genome. J. Virol.
80: 6952-6963
[Abstract]
[Full Text]
-
Knebel-Morsdorf, D., Quadt, I., Li, Y., Montier, L., Guarino, L. A.
(2006). Expression of Baculovirus Late and Very Late Genes Depends on LEF-4, a Component of the Viral RNA Polymerase Whose Guanyltransferase Function Is Essential.. J. Virol.
80: 4168-4173
[Abstract]
[Full Text]
-
Changela, A., Martins, A., Shuman, S., Mondragon, A.
(2005). Crystal Structure of Baculovirus RNA Triphosphatase Complexed with Phosphate. J. Biol. Chem.
280: 17848-17856
[Abstract]
[Full Text]
-
de Jong, J. G., Lauzon, H. A. M., Dominy, C., Poloumienko, A., Carstens, E. B., Arif, B. M., Krell, P. J.
(2005). Analysis of the Choristoneura fumiferana nucleopolyhedrovirus genome. J. Gen. Virol.
86: 929-943
[Abstract]
[Full Text]
-
Li, L., Li, Q., Willis, L. G., Erlandson, M., Theilmann, D. A., Donly, C.
(2005). Complete comparative genomic analysis of two field isolates of Mamestra configurata nucleopolyhedrovirus-A. J. Gen. Virol.
86: 91-105
[Abstract]
[Full Text]
-
Garcia-Maruniak, A., Maruniak, J. E., Zanotto, P. M. A., Doumbouya, A. E., Liu, J.-C., Merritt, T. M., Lanoie, J. S.
(2004). Sequence Analysis of the Genome of the Neodiprion sertifer Nucleopolyhedrovirus. J. Virol.
78: 7036-7051
[Abstract]
[Full Text]
-
Nobiron, I., O'Reilly, D. R., Olszewski, J. A.
(2003). Autographa californica nucleopolyhedrovirus infection of Spodoptera frugiperda cells: a global analysis of host gene regulation during infection, using a differential display approach. J. Gen. Virol.
84: 3029-3039
[Abstract]
[Full Text]
-
Titterington, J. S., Nun, T. K., Passarelli, A. L.
(2003). Functional dissection of the baculovirus late expression factor-8 gene: sequence requirements for late gene promoter activation. J. Gen. Virol.
84: 1817-1826
[Abstract]
[Full Text]
-
Wu, X., Guarino, L. A.
(2003). Autographa californica Nucleopolyhedrovirus orf69 Encodes an RNA Cap (Nucleoside-2'-O)-Methyltransferase. J. Virol.
77: 3430-3440
[Abstract]
[Full Text]
-
Martins, A., Shuman, S.
(2003). Mapping the triphosphatase active site of baculovirus mRNA capping enzyme LEF4 and evidence for a two-metal mechanism. Nucleic Acids Res
31: 1455-1463
[Abstract]
[Full Text]
-
Lu, L., Du, Q., Chejanovsky, N.
(2002). Reduced Expression of the Immediate-Early Protein IE0 Enables Efficient Replication of Autographa californica Multiple Nucleopolyhedrovirus in Poorly Permissive Spodoptera littoralis Cells. J. Virol.
77: 535-545
[Abstract]
[Full Text]
-
Guarino, L. A., Dong, W., Jin, J.
(2002). In Vitro Activity of the Baculovirus Late Expression Factor LEF-5. J. Virol.
76: 12663-12675
[Abstract]
[Full Text]
-
Guarino, L. A., Mistretta, T.-A., Dong, W.
(2002). Baculovirus lef-12 Is Not Required for Viral Replication. J. Virol.
76: 12032-12043
[Abstract]
[Full Text]
-
Quadt, I., Mainz, D., Mans, R., Kremer, A., Knebel-Morsdorf, D.
(2002). Baculovirus Infection Raises the Level of TATA-Binding Protein That Colocalizes with Viral DNA Replication Sites. J. Virol.
76: 11123-11127
[Abstract]
[Full Text]
-
Acharya, A., Gopinathan, K. P.
(2002). Characterization of late gene expression factors lef-9 and lef-8 from Bombyx mori nucleopolyhedrovirus. J. Gen. Virol.
83: 2015-2023
[Abstract]
[Full Text]
-
Pearson, M. N., Rohrmann, G. F.
(2002). Transfer, Incorporation, and Substitution of Envelope Fusion Proteins among Members of the Baculoviridae, Orthomyxoviridae, and Metaviridae (Insect Retrovirus) Families. J. Virol.
76: 5301-5304
[Full Text]
-
Lin, G., Blissard, G. W.
(2002). Analysis of an Autographa californica Multicapsid Nucleopolyhedrovirus lef-6-Null Virus: LEF-6 Is Not Essential for Viral Replication but Appears To Accelerate Late Gene Transcription. J. Virol.
76: 5503-5514
[Abstract]
[Full Text]
-
Mikhailov, V. S., Rohrmann, G. F.
(2002). Baculovirus Replication Factor LEF-1 Is a DNA Primase. J. Virol.
76: 2287-2297
[Abstract]
[Full Text]
-
Lin, G., Blissard, G. W.
(2002). Analysis of an Autographa californica Nucleopolyhedrovirus lef-11 Knockout: LEF-11 Is Essential for Viral DNA Replication. J. Virol.
76: 2770-2779
[Abstract]
[Full Text]
-
Rosas-Acosta, G., Braunagel, S. C., Summers, M. D.
(2001). Effects of Deletion and Overexpression of the Autographa californica Nuclear Polyhedrosis Virus FP25K Gene on Synthesis of Two Occlusion-Derived Virus Envelope Proteins and Their Transport into Virus-Induced Intranuclear Membranes. J. Virol.
75: 10829-10842
[Abstract]
[Full Text]
-
Afonso, C. L., Tulman, E. R., Lu, Z., Balinsky, C. A., Moser, B. A., Becnel, J. J., Rock, D. L., Kutish, G. F.
(2001). Genome Sequence of a Baculovirus Pathogenic for Culex nigripalpus. J. Virol.
75: 11157-11165
[Abstract]
[Full Text]
-
Acharya, A., Gopinathan, K. P.
(2001). Identification of an enhancer-like element in the polyhedrin gene upstream region of Bombyx mori nucleopolyhedrovirus. J. Gen. Virol.
82: 2811-2819
[Abstract]
[Full Text]
-
Lin, G., Slack, J. M., Blissard, G. W.
(2001). Expression and localization of LEF-11 in Autographa californica nucleopolyhedrovirus-infected Sf9 cells. J. Gen. Virol.
82: 2289-2294
[Abstract]
[Full Text]
-
Moser, B. A., Becnel, J. J., White, S. E., Afonso, C., Kutish, G., Shanker, S., Almira, E.
(2001). Morphological and molecular evidence that Culex nigripalpus baculovirus is an unusual member of the family Baculoviridae. J. Gen. Virol.
82: 283-297
[Abstract]
[Full Text]
-
Chen, X., IJkel, W. F. J., Tarchini, R., Sun, X., Sandbrink, H., Wang, H., Peters, S., Zuidema, D., Lankhorst, R. K., Vlak, J. M., Hu, Z.
(2001). The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome. J. Gen. Virol.
82: 241-257
[Abstract]
[Full Text]
-
Jin, J., Guarino, L. A.
(2000). 3'-End Formation of Baculovirus Late RNAs. J. Virol.
74: 8930-8937
[Abstract]
[Full Text]
-
Yang, S., Miller, L. K.
(1999). Activation of Baculovirus Very Late Promoters by Interaction with Very Late Factor 1. J. Virol.
73: 3404-3409
[Abstract]
[Full Text]
-
Guarino, L. A., Jin, J., Dong, W.
(1998). Guanylyltransferase Activity of the LEF-4 Subunit of Baculovirus RNA Polymerase. J. Virol.
72: 10003-10010
[Abstract]
[Full Text]
-
Jin, J., Dong, W., Guarino, L. A.
(1998). The LEF-4 Subunit of Baculovirus RNA Polymerase Has RNA 5'-Triphosphatase and ATPase Activities. J. Virol.
72: 10011-10019
[Abstract]
[Full Text]
-
Gross, C. H., Shuman, S.
(1998). RNA 5'-Triphosphatase, Nucleoside Triphosphatase, and Guanylyltransferase Activities of Baculovirus LEF-4 Protein. J. Virol.
72: 10020-10028
[Abstract]
[Full Text]
-
Ramachandran, A., Jain, A., Arora, P., Bashyam, M. D., Chatterjee, U., Ghosh, S., Parnaik, V. K., Hasnain, S. E.
(2001). Novel Sp Family-like Transcription Factors Are Present in Adult Insect Cells and Are Involved in Transcription from the Polyhedrin Gene Initiator Promoter. J. Biol. Chem.
276: 23440-23449
[Abstract]
[Full Text]