Previous Article | Next Article ![]()
Journal of Virology, October 1998, p. 7796-7806, Vol. 72, No. 10
Department of Microbiology-Immunology,
Northwestern University Medical School, Chicago, Illinois
60611,1 and
GSF, Institut für
Immunologie, D-81377 München, Germany2
Received 7 May 1998/Accepted 23 June 1998
Latent membrane protein 2A (LMP2A) of Epstein-Barr virus (EBV) is
expressed on the plasma membrane of B lymphocytes latently infected
with EBV and blocks B-cell receptor (BCR) signal transduction in
EBV-immortalized B cells in vitro. The LMP2A amino-terminal domain that
is essential for the LMP2A-mediated block on BCR signal transduction
contains eight tyrosine residues. Association of Syk protein tyrosine
kinase (PTK) with LMP2A occurs at the two tyrosines of the LMP2A
immunoreceptor tyrosine-based activation motif, and it is hypothesized
that Lyn PTK associates with the YEEA amino acid motif at LMP2A
tyrosine 112 (Y112). To examine the specific association of Lyn PTK to
LMP2A, a panel of LMP2A cDNA expression vectors containing
LMP2A mutations were transfected into an EBV-negative B-cell line and
analyzed for Lyn and LMP2A coimmunoprecipitation. Lyn associates with
wild-type LMP2A and other LMP2A mutant constructs, but Lyn association
is lost in the LMP2A construct containing a tyrosine
(Y)-to-phenylalanine (F) mutation at LMP2A residue Y112 (LMP2AY112F).
Next, the LMP2AY112F mutation was recombined into the EBV genome
to generate stable lymphoblastoid cell lines (LCLs) transformed
with the LMP2AY112F mutant virus. Analysis of BCR-mediated signal
transduction in the LMP2AY112F LCLs revealed loss of the LMP2A-mediated
block in BCR signal transduction. In addition, LMP2A was not tyrosine phosphorylated in LMP2AY112F LCLs. Together these data
indicate the importance of the LMP2A Y112 residue in the ability of
LMP2A to block BCR-mediated signal transduction and place
the role of this residue and its interaction with Lyn PTK as essential
to LMP2A phosphorylation, PTK loading, and down-modulation of PTKs involved in BCR-mediated signal transduction.
In primary B lymphocytes,
cross-linking the B-cell receptor (BCR) leads to an intricate signal
cascade including the recruitment and activation of the Src family
protein tyrosine kinases (PTKs); subsequent activation and
recruitment of other kinases, phosphatases, or adaptor proteins; the
hydrolysis of phospholipids; mobilization of intracellular calcium;
activation of protein kinase C; activation of nuclear transcription
factors; and transcription of BCR signal-specific genes (1, 5, 10,
13, 44). These signal cascades also occur in Epstein-Barr virus
(EBV)-negative transformed B-cell lines in vitro, but B-cell lines
transformed with EBV are blocked in the ability to transduce
signals through the BCR. One EBV gene product, the latent
membrane protein 2A (LMP2A), has been demonstrated to be
responsible for this phenotype (26-28).
LMP2A is one of nine viral proteins expressed in B cells latently
infected with EBV in vitro. LMP2A contains a 119-amino-acid amino-terminal cytoplasmic domain, 12 hydrophobic transmembrane domains, and a 27-amino-acid cytoplasmic carboxyl domain and is expressed in aggregates in the plasma membranes of latently infected B
cells (Fig. 1) (21). The
amino-terminal domain of LMP2A includes eight tyrosine residues
(20), two of which form an immunoreceptor tyrosine-based
activation motif (ITAM) (4, 37). This amino-terminal domain
has been shown to be tyrosine phosphorylated and is necessary for LMP2A
association with the Src family PTKs and the Syk PTK (3, 20,
26). Each phosphorylated tyrosine residue provides a potential
binding site for cellular proteins containing Src homology 2 (SH2)
domains. SH2 domains are noncatalytic domains conserved among
cytoplasmic signaling proteins which bind tyrosine-phosphorylated proteins (34, 38).
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Tyrosine 112 of Latent Membrane Protein 2A Is
Essential for Protein Tyrosine Kinase Loading and Regulation of
Epstein-Barr Virus Latency
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

View larger version (23K):
[in a new window]
FIG. 1.
LMP2A structure and amino acid sequence indicating
important motifs of the LMP2A amino-terminal domain. (A) Schematic of
the predicted structure of LMP2A in the B-cell plasma membrane. LMP2A
contains a 119-amino-acid amino-terminal cytoplasmic domain, 12 hydrophobic transmembrane domains, and a 27-amino-acid cytoplasmic
carboxyl domain and is expressed in aggregates in the plasma membranes
of latently infected B cells. Numbers denote the locations of the eight
tyrosine residues in the LMP2A amino-terminal domain. (B) Amino acid
sequence of the LMP2A amino-terminal domain, with the eight tyrosine
residues (arrows), four proline-rich motifs
(~~~~~), and DQSL motif
( 



) indicated. Each of the eight LMP2A
amino-terminal Y residues was mutated to an F residue in pLMP2A cDNA
expression vector constructs, including a double Y-to-F mutation at
LMP2A residues Y74 and Y85. Four LMP2A deletion mutations, lacking
LMP2A residues 21 to 36, 21 to 64, 21 to 85, and 80 to 112, were also
incorporated into pLMP2A cDNA expression vector constructs. In
addition, multiple LCLs incorporating a Y-to-F mutation at LMP2A Y112
were generated.
LMP2A was first shown to block normal BCR signal transduction in the
EBV-negative B-cell line BJAB. In BJAB cells expressing LMP2A and no
other EBV gene products, intracellular calcium was not mobilized
following BCR cross-linking (28). Studies using EBV-transformed lymphoblastoid cell lines (LCLs), referred to as
EBV+LMP2A+ LCLs, demonstrate a similar block in calcium
mobilization after BCR cross-linking as well as a block in protein
tyrosine phosphorylation and nuclear gene transcription following
BCR cross-linking (26-28). In addition, BCR cross-linking
failed to activate cellular signal transducers such as Lyn, Syk,
phosphatidylinositol 3-kinase (PI3-kinase), phospholipase
C
2, (PLC
2), Vav, mitogen-activated protein kinase (MAPK), and Shc
in the EBV+LMP2A+ LCLs (26). In contrast, parallel
BCR cross-linking studies of LCLs with null mutations in LMP2A,
referred to as EBV+LMP2A
LCLs, resulted in normal BCR signal
transduction, as measured by the induction of tyrosine phosphorylation,
mobilization of intracellular calcium, and induction of lytic viral
replication (26, 27). These results indicated that the
amino-terminal domain of LMP2A was sufficient for the block in
BCR-mediated signal transduction observed in EBV+LMP2A+ LCLs.
The importance of the LMP2A amino-terminal domain in blocking BCR signal transduction was confirmed by the analysis of EBV-infected LCLs with deletion mutations within the LMP2A amino-terminal domain. We constructed three deletions which removed amino acids 21 to 36, 21 to 64, or 21 to 85 from the LMP2A amino-terminal domain. Amino acids 21 to 36 were dispensable, whereas amino acids 37 to 85 were essential for full LMP2A function (11). The importance of the LMP2A ITAM in the LMP2A-mediated block in BCR signal transduction was confirmed by the analysis of LCLs with tyrosine-to-phenylalanine point mutations in the LMP2A ITAM. Mutation of either tyrosine restored normal BCR signal transduction and prevented the binding of the Syk PTK to LMP2A (12).
In this study, a tyrosine (Y)-to-phenylalanine (F) mutation was engineered into the LMP2A gene at amino acid 112 (Y112F) and incorporated into both LMP2A cDNA expression vectors as well as the viral genome to generate LCLs infected with LMP2AY112F recombinant virus (11, 12). The LMP2AY112F LCLs were analyzed for the ability to transduce signals through the BCR and the effect of the LMP2AY112F mutation on the Lyn and Syk PTKs.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell lines and cell culture.
All cell lines were maintained
in RPMI 1640 medium containing 10% inactivated fetal bovine serum,
1,000 U of penicillin per ml, and 1,000 µg of streptomycin (Sigma,
St. Louis, Mo.) per ml (complete RPMI). BJAB is an EBV-negative
B-lymphoma cell line (24). B95-8 is an EBV-infected marmoset
cell line that is partially permissive for viral replication (29,
30). HPB.ALL is an acute lymphoblastic leukemia T-cell line. The
HH514-16 subclone of the original EBV-infected P3HR1 (P3JHR1)
Burkitt's lymphoma cell line (a gift of George Miller) has EBV genomes
with only a single type of DNA, from which the segment encoding EBNA2
and the last two exons of EBNALP are deleted (14). WT1 and
WT4 are EBV+LMP2A+ LCLs, and ES1 and ES4 are EBV+LMP2A
LCLs
(27). Primary human mononuclear cells were obtained from
blood samples of healthy donors by centrifugation over a cushion of
Ficoll-Paque (Pharmacia, Piscataway, N.J.). For EBV-positive donors, T
lymphocytes were removed as previously described (23).
Antibodies. Whole goat anti-human immunoglobulin (Ig) for cross-linking surface Ig (sIg) experiments was purchased from Southern Biotechnical Associates (Santa Cruz, Calif.), and goat anti-human F(ab')2 was purchased from Jackson ImmunoResearch Laboratories (West Grove, Pa.). The rat monoclonal anti-human LMP2A antibody (14B7) has been previously described (11). The mouse monoclonal antihemagglutinin (HA1) epitope antibody (12CA5) was obtained from BAbCO (Richmond, Calif.). The anti-Lyn mouse monoclonal antibody was purchased from Transduction Laboratories (Lexington, Ky.), and the anti-Lyn rabbit polyclonal antibody was purchased from Upstate Biotechnology Inc. (Lake Placid, N.Y.). The mouse monoclonal antibody to Syk (4D10) and the antiphosphotyrosine (APT) antibody (PY20) were purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.). The mouse monoclonal antibody to the BZLF1 protein (BZ1) has been described previously (48). All horseradish peroxidase (HRP)-linked secondary antibodies were purchased from Amersham (Arlington Heights, Ill.) except for the NeutrAvidin-HRP, purchased from Pierce (Rockford, Ill.). The donkey anti-rat secondary antibody Cy3 used for immunofluorescence was purchased from Jackson.
Construction of plasmids. The LMP2A cDNA expression vectors were generated by a PCR-based strategy and incorporated into pLMP2A (20). All LMP2A mutations were sequenced to confirm the presence of the desired mutation and the absence of any mutations introduced by PCR. pSVNaeZ, used to induce lytic EBV replication, and EcoRI-A, used to rescue the EBNA2 and EBNALP mutations contained in the P3HR1 cell line, have been described previously (23, 40). The genomic LMP2AY112F mutation was generated by using a PCR-based strategy, and a unique PmlI restriction site adjacent to the Y112 codon was also generated. The recombinant LMP2A fragment containing both the tyrosine mutation and the PmlI site was incorporated into pRH6, which contains a KpnI (B95-8, bp 161097)-to-EcoRI (B95-8, bp 1) fragment from B95-8 EBV DNA. All recombinant LMP2A constructs were sequenced to confirm the presence of the desired tyrosine-to-phenylalanine mutation, the incorporation of the PmlI site, and the absence of any mutations introduced by PCR.
Transfection. DNA used for transfections was banded twice on CsCl density gradients. Recombinant cell lines were generated by transfecting 107 P3HR1 cells in 0.4 ml of complete RPMI with 15 µg of pSVNaeZ, 7 µg of EcoRI-A, and 25 µg of recombinant LMP2A DNA. BJAB cells (107) were transfected similarly with 50 µg of each pLMP2A cDNA and labeled with [35S]methionine as described previously (20). Cells were pulsed once with a Gene Pulser (Bio-Rad, Hercules, Calif.) at 200 V and 960-µF capacitance in a 0.4-cm electrode gap cuvette (Bio-Rad) and immediately diluted in 10 ml of complete RPMI. The induction of lytic EBV replication in LCLs was performed similarly except that these cells were pulsed at 230 V with 25 µg of pSVNaeZ and diluted in complete RPMI containing 20 ng of 12-O-tetradecanolylphorbol-13-acetate per ml.
Generation of LMP2AY112F LCLs. PCR-mediated mutagenesis was used to create an EBV DNA fragment encoding LMP2A with a tyrosine-to-phenylalanine point mutation at amino acid 112 of LMP2A. The recombinant LMP2A construct was verified by sequencing and then incorporated into virus through a strategy using the transformation-incompetent, replication-competent EBV deletion mutant, P3HR1. Recombinant virus was generated by the cotransfection of the P3HR1 cell line with pSVNaeZ DNA, to induce lytic viral replication; EcoRI-A DNA, to rescue the EBNA2 and EBNALP deletions in the P3HR1 genome; and the recombinant LMP2A DNA fragment (22). The recombinant P3HR1 virus was used to infect primary blood mononuclear cells (PBMCs) or purified B lymphocytes in culture as previously described (11). Clones emerged 3 to 5 weeks after initial plating and were screened by PCR for incorporation of the LMP2AY112F point mutation at 6 to 8 weeks.
PCR and Southern blot verification of LMP2AY112F mutant LCLs. Genomic DNA from LCLs was prepared (40) and amplified in a 25-µl volume for 40 cycles as previously described (22). Primers 5'LMP1 (CTAGGCGCACCTGGAGGTGG) and 3'LMP1 (AGTCAGTCAGGCAAGCCTAT) were used to screen LCLs containing the 81-bp smaller LMP1 gene present in the EBV genomic DNA fragment in which the LMP2A mutation was incorporated. The LMP1 gene is adjacent to the LMP2A gene within the EBV genome. After this initial screen, primers 5'LMP2A (CTGCTGCAGCTATGGGGTCC) and 3'112-LMP2A (TCCTCTGCCCGCTTCTTCGA) were used to specifically amplify DNA from LCLs incorporating the LMP2AY112F point mutation. Ethidium bromide-stained PCR products were viewed after electrophoresis through 1.5% EEO agarose (Fisher, Pittsburgh, Pa.) to determine the sizes of the amplified products.
PCR-identified LMP2AY112F mutant LCLs and wild-type controls were further verified by Southern blot hybridization. A 1,872-bp fragment, generated from a BglI digest of pRL49 (22), was isolated and used as a 32P-labeled hybridization probe. Genomic DNA was prepared by cell lysis, proteinase K treatment, phenol extraction, and ethanol precipitation (43). Prepared DNAs from representative LCLs were digested with BglI alone or with both BglI and PmlI. The digested DNAs were separated by electrophoresis on a 1% agarose gel, transferred to a nylon membrane (GeneScreen; NEN, Boston, Mass.), and probed as previously described (43). Both digests verified the correct restriction sites present in the LMP2A wild-type and mutant LCLs, and the BglI-PmlI double digest verified the unique PmlI site present only in the LMP2AY112F mutants. The verified LMP2AY112F mutant LCLs and wild-type controls were further characterized for sIg expression by flow cytometry using a fluorescein isothiocyanate-linked goat anti-human Ig diluted 1:50 (Southern Biotech, Birmingham, Ala.) as previously described (28).Cellular activation and preparation of lysates. Tissue culture cells (cell numbers are indicated in figure legends) were resuspended and equilibrated in serum-free RPMI for 15 min at 37°C. Cells were stimulated with 25 µg of goat anti-human Ig (Southern Biotech) per ml for the indicated times, and cells were immediately lysed in 1% Nonidet P-40 (NP-40) lysis buffer (1% NP-40, 50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 2 mM EDTA, 10 µg each of pepstatin and leupeptin per mL, 0.5 mM phenylmethylsulfonyl fluoride, 1 mM sodium orthovanadate). The insoluble materials were removed by centrifugation at 4°C, and cleared supernatants were processed for immunoprecipitations or immunoblotting.
Immunoprecipitations and immunoblotting. Cleared lysates were incubated with the appropriate antisera for 1 h at 4°C; immune complexes were captured with either protein A- or protein G-Sepharose (Pharmacia) for 1 h as indicated in the figure legends and then washed four times with 1% NP-40 lysis buffer. Immunoprecipitated proteins were then resuspended in 2× sodium dodecyl sulfate (SDS) sample buffer, heated at 70°C for 5 min, and separated by electrophoresis through SDS-polyacrylamide gels (percentages are indicated in the figure legends) (SDS-PAGE).
For immunoblotting, immune complex materials were electrophoresed and transferred to either nitrocellulose or Immobilon, as indicated in the figure legends. Membranes were blocked in 3 to 5% milk for 1 h at room temperature and then incubated in primary antibody, diluted in Tris-buffered saline-Tween (TBST), for 1 h at room temperature. Membranes were washed three times in TBST, incubated with a HRP- or biotin-linked secondary antibody for 30 min at room temperature, and washed four times in TBST, and proteins were detected by enhanced chemiluminescence (ECL; Pierce, Rockford, Ill.).In vitro kinase assays.
Lyn and Syk immunoprecipitation
reactions were done as described above, and the immune complexes were
washed four times with 1% Triton X-100 lysis buffer. Immune complexes
were further washed twice with kinase buffer (50 mM Tris [pH 7.4], 10 mM MgCl2, 10 mM MnCl2). After washing, the
immune complexes were resuspended in a 25-µl volume of kinase buffer
labeled with 10 µCi of [
-32P]ATP per sample and
incubated at room temperature for 20 min. Reactions were stopped with
the addition of 2× SDS sample buffer; the samples were heated at
70°C for 5 min and loaded onto SDS-6% polyacrylamide gels. The
32P-labeled products were visualized by autoradiography of
the dried gels.
Calcium mobilization.
Tissue culture cells (3 × 106) were resuspended in loading buffer (145 mM NaCl, 5 mM
KCl, 1 mM MgCl2, 1 mM CaCl2, 10 mM glucose, 10 mM HEPES, 1% bovine serum albumin, 2.5 mM probenicid) and loaded with
2 mM calcium-binding dye (fluo-3-acetoxymethyl ester [fluo-3]; Molecular Probes, Eugene, Oreg.) for 30 min at room temperature. After
loading, the cells were washed twice and resuspended in loading buffer.
The prepared cells were then measured for fluorescence after BCR
cross-linking with goat anti-human Ig F(ab')2 antibody (Jackson) in a Perkin-Elmer (Norwalk, Conn.) LS-5B luminescence spectrometer. Excitation and emission values for fluo-3 are 505 and 530 nm, respectively. Autofluorescence (or Fmin
[minimal fluorescence]) for each LCL was also determined by
performing the above procedure without adding fluo-3 dye. Baseline
fluorescence (F) was recorded for 1 min, and maximal
fluorescence (Fmax) was measured by addition of
digitonin (40 µM). Calcium concentration (nanomolar) was calculated according to the formula [Ca2+] = 400 (F
Fmin)/(Fmax
F) (18, 25).
Immunofluorescence.
Immunofluorescence of LCLs was performed
as previously described (21). In brief, LCLs were fixed to
glass slides with acetone at
20°C for 5 min, blocked with 20%
normal goat serum for 10 min at room temperature, incubated with the
anti-LMP2A rat monoclonal antibody 14B7 diluted 1:1,000, incubated with
a goat anti-rat secondary antibody Cy3 diluted 1:1,000 (Jackson) for 30 min, washed in phosphate-buffered saline and viewed with a Zeiss
Axioscope fluorescence microscope.
| |
RESULTS |
|---|
|
|
|---|
Site-specific cDNA mutation of the LMP2A amino-terminal domain. PCR-mediated mutagenesis was used to create LMP2A cDNA expression vector constructs with point mutations and deletion mutations in the LMP2A amino-terminal domain. Each of the eight Y residues located within this 119-amino-acid domain was changed to an F residue, including a double Y-to-F mutation at LMP2A residues Y74 and Y85. The LMP2A deletion mutations eliminated LMP2A residues 21 to 36, 21 to 64, 21 to 85, and 80 to 112. In addition, an 11-amino-acid peptide from the influenza virus HA1 protein that is reactive with monoclonal antibody 12CA5 was added to the carboxyl terminus of each LMP2A cDNA construct to facilitate analysis of the cDNA mutants. All of the recombinant LMP2A constructs were verified by sequencing (data not shown) and then incorporated into the expression vector pLMP2A (20). Figure 1 shows the amino acid sequence of the LMP2A amino-terminal domain, with the eight tyrosine residues highlighted.
Loss of LMP2A phosphorylation and Src family PTK association in the Y112 LMP2A mutant. To determine which sequences of the LMP2A amino-terminal domain were responsible for LMP2A associations with cellular proteins and necessary for LMP2A phosphorylation, the epitope-tagged wild-type and mutant LMP2A cDNA expression vectors were transfected into the EBV-negative B-lymphoma cell line BJAB, labeled with [35S]methionine, lysed in NP-40, and immunoprecipitated with the anti-HA1 antibody 12CA5. One-half of the immunoprecipitated proteins were separated by SDS-PAGE, and the immunoprecipitated 35S-labeled LMP2A proteins were visualized by autoradiography (Fig. 2B). As expected, no 35S-labeled LMP2A was immunoprecipitated in vector control (pSG5)-transfected cells (Fig. 2B, lane 11), while approximately equal amounts of LMP2A were detected in each of the LMP2A transfections (Fig. 2B, lanes 2 to 10 and 12 to 16). The LMP2A protein in the deletion mutants migrated more rapidly than wild-type LMP2A, reflecting the size of each deletion.
|
21-64 showed reduced
LMP2A phosphorylation, p2A
21-85 showed even less
phosphorylation, and LMP2A phosphorylation in p2A
80-112 was nearly
undetectable (Fig. 2A, lanes 14 to 16). The pY112F mutant also had
nearly undetectable levels of LMP2A phosphorylation, as seen in the
p2A
80-112 mutant (Fig. 2A, lanes 2 and 16). In addition, fewer
phosphorylated proteins were immunoprecipitated in the
pY112F-transfected cells, and the level of phosphorylation was less
than in the other in vitro kinase reactions (Fig. 2A), although all
reactions were carried out with similar 35S-labeled LMP2A
protein levels (Fig. 2B). The Src family PTKs, which migrate just above
LMP2A, and a protein with a molecular mass of approximately 96 kDa
appeared to be reduced or absent from the pY112F LMP2A immune complex.
The in vitro kinase reactions of the cells transfected with pY74F,
pY85F, and pY7485F did not contain the 72-kDa Syk PTK. These results
are in agreement with previous work that identified the LMP2A ITAM,
LMP2A residues Y74 and Y85, as the site of Syk binding to LMP2A
(12). The in vitro kinase reaction of the pY60F-transfected
cells appeared to be missing a protein of approximately 112 kDa (Fig.
2A, lane 8).
The in vitro kinase reactions of the four LMP2A deletion mutants
supported the associations of the same specific proteins with regions
of LMP2A as was seen with the LMP2A tyrosine point mutants. The
p2A
21-36 deletion mutant, which lacks LMP2A residues Y23 and
Y31, appeared to contain the same immunoprecipitating proteins as the
pY23F and pY31F point mutant immune complexes, and all three mutants
appeared to contain the same proteins as seen in immunoprecipitates
with wild-type LMP2A (Fig. 2A, lane 13). Therefore, the loss of
residues 21 to 36, or specifically Y23 or Y31, did not seem to affect
LMP2A associations with cellular proteins. The in vitro kinase reaction
of the p2A
21-64 deletion mutant, which lacks Y23, Y31, Y60, and Y64,
was missing the same 112-kDa protein as observed in the pY60F
immunoprecipitate (Fig. 2A, lane 14). The p2A
21-85 deletion mutant,
which lacks Y23, Y31, Y60, Y64, Y74, and Y85, lost the associations of
both the 72-kDa (Syk) and 112-kDa proteins (Fig. 2A, lane 15).
The lost LMP2A association with the 112-kDa protein was
consistent with the loss of LMP2A residue Y60, and the missing 72-kDa
(Syk) protein was consistent with the loss of LMP2A residues Y74
and Y85, as was demonstrated in the in vitro kinase reactions of the
pY60F, pY74F, and pY85F LMP2A point mutant-transfected cells. The in vitro kinase reaction of the p2A
80-112 deletion mutant, which lacks
Y112, Y101, and Y85, contained fewer 32P-labeled
proteins than observed in wild-type LMP2A immunoprecipitates (Fig. 2A, lanes 12 and 16), although both samples contained similar levels of LMP2A protein in the immunoprecipitates (Fig. 2B, lanes 12 and 16). The Src family PTKs, which migrated as a three bands of
approximately 53, 56, and 60 kDa, were clearly absent from both
p2A
80-112 and pY112F in vitro kinase reaction (Fig. 2A, lanes 2 and
16). The presence of the Src family PTKs was clearly evident in the
LMP2A deletion mutant constructs p2A
21-64 and p2A
21-85, where the
smaller LMP2A protein no longer comigrated with the Src PTKs (Fig. 2A,
lanes 14 and 15). In summary, these data indicate that LMP2A residue
Y60 is important for LMP2A association with a 112-kDa phosphorylated
protein, Y74 and Y85 are important for 72-kDa Syk association with
LMP2A as previously shown (12), and Y112 is critical for the
53- to 60-kDa Src family PTK association with LMP2A.
Mutation of Y112 in the LMP2A amino-terminal domain prevents the
association of the Lyn PTK with LMP2A.
To investigate the
tyrosine-specific association of the Lyn PTK with LMP2A, HA1
epitope-tagged LMP2A cDNA expression vectors were transfected into BJAB
cells, labeled with [35S]methionine, lysed in
NP-40, and immunoprecipitated with the anti-HA1 antibody 12CA5.
Autoradiography of the transferred proteins confirmed that
similar amounts of LMP2A immunoprecipitated from each LMP2A-expressing
transfection (Fig. 3B, lanes 23 to
32 and 34 to 38), and no LMP2A expression was detected in the control pSG5-transfected BJABs (Fig. 3B, lanes 22 and 33). The membranes were then immunoblotted with an anti-Lyn polyclonal antiserum to detect
Lyn coimmunoprecipitation with LMP2A (Fig. 3A). Lyn is the most
abundant Src family PTK expressed in BJAB cells (2). Both
p56 and p53 forms of Lyn readily coimmunoprecipitated with wild-type
LMP2A in BJABs transfected with a wild-type pLMP2A cDNA construct (Fig.
3A, lanes 4 and 17). The two forms of Lyn are derived from alternative
splicing by utilizing an internal splice donor site in the Lyn mRNA
(47). Lyn was not detected in pSG5 control
immunoprecipitates (Fig. 3A, lanes 3 and 16). Lyn also coimmunoprecipitated with pLMP2A constructs containing LMP2A
tyrosine point mutations (pY101F, pY7485F, pY85F, pY74F, pY64F,
pY60F, pY31F, and pY23F [Fig. 3A, lanes 6 to 13]), as well as with
pLMP2A deletion mutants (p2A
21-36, p2A
21-64, and
p2A
21-85 [Fig. 3A, lanes 18 to 20]). However, Lyn
coimmunoprecipitation with LMP2A was barely detectable in
pY112F-transfected BJABs (Fig. 3A, lane 5) or the
p2A
80-112-transfected BJABs (Fig. 3A, lane 21). Both forms of Lyn
were readily detected in control cellular lysates from BJAB cells (Fig.
3A, lanes 1 and 14), while no Lyn expression was detected in cellular
lysates from the T-cell line HPB.ALL (Fig. 3A, lanes 2 and 15). A more
detailed analysis, performed by titrating BJAB cell lysates and
comparing levels of immunoprecipitating p56 and p53 with levels of Lyn
bound to LMP2A in immune complexes, demonstrated that the two forms of
Lyn bound equally well to LMP2A in amounts similar to their relative
abundance in BJAB cells (data not shown). These data indicate that
LMP2A tyrosine 112 is the location of Lyn PTK association with
LMP2A. Without the tyrosine residue at 112, Lyn does not
associate with LMP2A.
|
Generation of LCLs infected with LMP2AY112F EBV. The LMP2AY112F mutation was incorporated into the EBV genome through a strategy previously described (22). The generated LMP2AY112F recombinant virus was used to infect PBMCs to generate LCLs as previously described (11). The generated LCLs were screened by PCR to identify the presence of the LMP2AY112F mutation within the infecting EBV genome, and each LMP2AY112F LCL was further verified for correct incorporation of the recombinant LMP2A DNA fragment by Southern blot hybridization (data not shown). Multiple cell lines were transformed by the LMP2AY112F recombinant virus, and these EBV+LMP2AY112F LCLs are characterized in this study.
LMP2A protein expression in EBV+LMP2AY112F LCLs.
Expression of LMP2A in the generated EBV+LMP2AY112F LCLs was
confirmed by immunoblot analyses using the LMP2A-specific
antibody 14B7. Representative data are shown in Fig.
4. LMP2A expression in two EBV+LMP2A+
LCLs was clearly evident (Fig. 4, lanes 1 and 2), while no
LMP2A was detected in the negative control EBV+LMP2A
LCL, ES1
(Fig. 4, lane 3), or the EBV
cell line BJAB (Fig. 4, lane 4). LMP2A
expression in four representative EBV+LMP2AY112F LCLs (Fig. 4,
lanes 5 to 8) was similar to the LMP2A expression in EBV+LMP2A+
LCLs. Immunofluorescence microscopy using anti-LMP2A antibodies
verified that the LMP2A subcellular protein localization within the
EBV+LMP2AY112F LCLs was similar to LMP2A subcellular localization in EBV+LMP2A+ LCLs (data not shown). These data
demonstrate the similar expression levels and subcellular
localization of LMP2A protein in EBV+LMP2A+ and
EBV+LMP2AY112F LCLs.
|
LMP2A is not phosphorylated in EBV+LMP2AY112F LCLs.
To verify the phosphorylation state of LMP2A in response to
BCR cross-linking, unstimulated and stimulated cellular lysates of EBV+LMP2A+, EBV+LMP2A
, and EBV+LMP2AY112F LCLs
were immunoprecipitated with an anti-LMP2A antibody, divided
equally, and separated by duplicate SDS-PAGE. Two parallel
immunoblot analyses were performed to detect immunoprecipitated LMP2A
(Fig. 5A) and tyrosine-phosphorylated LMP2A (Fig. 5B). Equivalent levels of LMP2A were immunoprecipitated from all LMP2A-expressing LCLs: the two EBV+LMP2A+ LCLs (Fig. 5A,
lanes 1 to 6) and two EBV+LMP2AY112F LCLs (Fig. 5A, lanes 10 to
15), while no LMP2A was detected in the control EBV+LMP2A
LCL (Fig. 5A, lanes 7 to 9). In the APT blot, LMP2A was
constitutively phosphorylated in the two EBV+LMP2A+ LCLs (Fig. 5B,
lanes 1 to 6), while LMP2A in the two EBV+LMP2AY112F LCLs was not
phosphorylated before or after BCR cross-linking (Fig. 5B, lanes 10 to
15). As expected, no phosphorylated LMP2A was detected in the control EBV+LMP2A
LCL (Fig. 5B, lanes 7 to 9). These data
demonstrate the complete loss of LMP2A tyrosine phosphorylation in
EBV+LMP2AY112 LCLs.
|
EBV+LMP2AY112F LCLs demonstrate high levels of constitutive Lyn
phosphorylation and kinase activity and the induction of Syk
phosphorylation and kinase activity similar to those of EBV+LMP2A
LCLs following BCR cross-linking.
To investigate the effect of the
LMP2AY112F point mutation on the phosphorylation state and kinase
activities of the Lyn and Syk PTKs, parallel anti-Lyn and anti-Syk
immunoprecipitations were performed on cellular lysates from
representative EBV+LMP2A+, EBV+LMP2A
, and EBV+LMP2AY112F
LCLs. The Lyn and Syk immunoprecipitations were divided equally and
were either analyzed for autokinase activities by in vitro immune
complex kinase assays or probed for Lyn, Syk, or APT reactivities on
immunoblots. The Lyn immunoprecipitation and Lyn immunoblot revealed
similar Lyn protein expression levels in all LCLs, although the
EBV+LMP2A+ LCL demonstrated slightly less protein than either
the EBV+LMP2A
or EBV+LMP2AY112F LCLs (Fig.
6A, lanes 1 to 9). This observation
was reproducible in other Lyn immunoprecipitation experiments of
EBV+LMP2A+ LCLs (data not shown) and was consistent with
observations previously described (26). The parallel APT
immunoblot of the same Lyn immunoprecipitates revealed phosphorylation
differences between the wild-type and mutant LCLs (Fig. 6B). The
EBV+LMP2A+ LCL demonstrated undetectable Lyn phosphorylation levels
both before or after BCR cross-linking (Fig. 6B, lanes 1 to 3), while
constitutive Lyn phosphorylation was clearly evident in the
EBV+LMP2A
and EBV+LMP2AY112F mutant LCLs both before and
after BCR cross-linking (Fig. 6B, lanes 4 to 9). Finally, in vitro
autophosphorylation kinase assays were performed on the same Lyn
immunoprecipitates (Fig. 6C). The representative EBV+LMP2A+ LCL
demonstrated low Lyn kinase activity (Fig. 6C, lanes 1 to 3), while the
EBV+LMP2A
and EBV+LMP2AY112F LCLs demonstrated greater
Lyn kinase activities (Fig. 6C, lanes 4 to 9). These data demonstrate
that unlike the down-modulation of Lyn phosphorylation and kinase
activity characteristic of EBV+LMP2A+ LCLs, the EBV+LMP2AY112 LCL demonstrated both the increased Lyn phosphorylation and kinase activity characteristic of an EBV+LMP2A
LCL.
|
and EBV+LMP2AY112 LCLs demonstrated the absence of Syk
phosphorylation before BCR cross-linking and the rapid induction of Syk
phosphorylation within 1 min after BCR cross-linking (Fig. 6E, lanes 4 to 9). The APT studies were further supported by an in vitro
autophosphorylation kinase assay performed on the same Syk
immunoprecipitates (Fig. 6F). Syk demonstrated a low constitutive
kinase activity in the EBV+LMP2A+ LCL that was not induced by BCR
cross-linking (Fig. 6F, lanes 1 to 3), while the EBV+LMP2A
LCL
and EBV+LMP2AY112 LCL demonstrated increased baseline Syk
activities that were further induced to greater activities after
BCR cross-linking (Fig. 6C, lanes 4 to 9). These data
demonstrate that unlike the down-modulation of Syk
phosphorylation and kinase activity characteristic of
EBV+LMP2A+ LCLs, the EBV+LMP2AY112 LCL demonstrated the
induction of both Syk phosphorylation and kinase activity as
characteristic of an EBV+LMP2A
LCL. The results of this study are
consistent with previous observations of Lyn and Syk protein
expression, phosphorylation, and kinase activity levels in
EBV+LMP2A+ and EBV+LMP2A
LCLs (26).
Mutation of LMP2AY112F restores BCR-activated tyrosine
phosphorylation.
To investigate the effect of the
LMP2AY112F mutation on the induction of APT activity, one of
the earliest known biochemical events after BCR cross-linking,
EBV+LMP2A+, EBV+LMP2A
, and EBV+LMP2AY112F LCLs, matched
for BCR expression by flow cytometry (data not shown), were analyzed
for induction of tyrosine phosphorylation following BCR cross-linking.
An EBV+LMP2A+ LCL demonstrated the constitutive phosphorylation of
a number of proteins in unstimulated LCLs (Fig. 7, lane 1), and this pattern remained
relatively unchanged after BCR cross-linking (Fig. 7, lanes 2 to 3). As
shown in Fig. 5, LMP2A was phosphorylated in EBV+LMP2A+ LCLs, and
its level of phosphorylation did not change over time (Fig. 7, lanes 1 to 3, arrow). This phosphorylated protein was confirmed to be LMP2A by
stripping the blot and reprobing it with the LMP2A-specific antibody
14B7 (data not shown). In contrast, there was little constitutive
phosphorylation in untreated cellular lysates from EBV+LMP2AY112F LCLs (Fig. 7, lanes 7, 10, and 13) or the
control EBV+LMP2A
LCL (Fig. 7, lane 4), but upon BCR
cross-linking there was a dramatic increase in the number of proteins
which were tyrosine phosphorylated in all mutant cell lines (Fig. 7,
lanes 4 to 6, 7 to 9, 10 to 12, and 13 to 15). This increase in
tyrosine phosphorylated proteins in the EBV+LMP2AY112F LCLs
following BCR cross-linking was similar to the induction of protein
tyrosine phosphorylation observed in either EBV+LMP2A
LCLs or an
EBV
B-lymphoma cell line as previously described
(26). As shown in Fig. 5, LMP2A was not phosphorylated
in any of the EBV+LMP2AY112F point mutant LCLs either before or
after BCR cross-linking, while LMP2A phosphorylation in the
EBV+LMP2A+ LCL was clearly present before and after BCR cross-linking (Fig. 7, lanes 1 to 3, arrow). These data indicate that
the induction of tyrosine phosphorylation following BCR cross-linking is not blocked in EBV+LMP2AY112F LCLs. Interestingly, two proteins with the approximate molecular masses of 60 and 57 kDa were
constitutively phosphorylated in the unstimulated lysates of the
LMP2AY112F LCLs and not present in the unstimulated lysate of the
EBV+LMP2A
LCL (Fig. 7; compare lanes 4, 7, 10, and 13). Proteins
of similar molecular masses are also constitutively phosphorylated in
the unstimulated lysate of the EBV+LMP2A+ LCL (Fig. 7, lane 1).
|
Calcium mobilization in EBV+LMP2A+ and
EBV+LMP2AY112F LCLs following BCR cross-linking.
To
assess the effect of the LMP2AY112F mutation on calcium mobilization,
multiple EBV+LMP2A+ and EBV+LMP2AY112 LCLs, derived in parallel
and matched for BCR expression by flow cytometry (data not shown), were
loaded with the calcium-binding dye fluo-3 and monitored for
fluorescence after BCR cross-linking. Previously described
EBV+LMP2A+ (Table 1, WT4) and
EBV+LMP2A
(Table 1, ES1) LCLs were included as controls
(27). EBV+LMP2A+ LCLs demonstrated a minimal calcium
flux after BCR cross-linking (5 to 13%) (Table 1). These calcium flux
values are small compared to the mean calcium flux value of the control
EBV+LMP2A
LCL (411%) (Table 1). Representative
EBV+LMP2AY112F point mutant LCLs were also tested and had an
observed mean calcium flux of 80 to 368%, a mean greater than
that for EBV+LMP2A+ LCLs (5 to 13%) (Table 1). These data
demonstrate that the LMP2AY112 LCLs readily mobilize calcium
following BCR cross-linking, unlike EBV+LMP2A+ LCLs,
which demonstrate a block in BCR cross-linking induced calcium
mobilization.
|
Induction of BZLF1 expression in EBV+LMP2AY112F mutant LCLs
following BCR cross-linking.
The activation of lytic viral
replication was investigated in EBV+LMP2A+, EBV+LMP2A
,
and EBV+LMP2AY112 LCLs following BCR cross-linking by
analyzing the expression of BZLF1, the immediate-early transactivator
of EBV lytic replication. The BCR was either untreated or treated with
goat anti-human Ig antibody for 48 h in representative EBV+LMP2A+, EBV+LMP2A
, or EBV+LMP2AY112F LCLs, and the
cellular lysates were monitored for BCR-induced expression of BZLF1
by immunoblotting with monoclonal antibody BZ1 (27, 48).
BZLF1 expression was evident after BCR cross-linking in the two control EBV+LMP2A
LCLs (Fig. 8, lanes 4 and
6) and the five representative EBV+LMP2AY112F LCLs (Fig. 8, lanes
8, 10, 12, 14, and 16) but was not detected in any of the
EBV+LMP2AY112F LCLs before BCR cross-linking (Fig. 8, lanes 7, 9, 11, 13, and 15) or in the two EBV+LMP2A
LCLs (Fig. 8, lanes 3 and
5). BZLF1 expression was not detected in the representative
EBV+LMP2A+ LCL either before or after BCR cross-linking (Fig. 8,
lanes 1 and 2). The two different-sized BZLF1 proteins reflect a
variable number of repeat sequences present within the BZLF1 gene
of different viral isolates. The BZLF1 proteins of both molecular
weights specifically react with the BZ1 monoclonal antibody. These data
demonstrate that tyrosine 112 of LMP2A plays an important role in the
LMP2A-mediated inhibition of viral nuclear gene transcription following
BCR cross-linking and that loss of LMP2A tyrosine residue 112 results
in the induction of BZLF1 expression, one of the first events leading
to EBV lytic replication.
|
| |
DISCUSSION |
|---|
|
|
|---|
The results reported in this study indicate that tyrosine 112 of LMP2A is essential for LMP2A-mediated down-modulation of BCR signal transduction. The LMP2AY112F mutation results in the restoration of normal BCR signal transduction, as demonstrated by the induction of tyrosine phosphorylation (Fig. 7), the mobilization of intracellular calcium (Table 1), the induction of nuclear gene transcription (Fig. 8), and the activation of cellular PTKs (Fig. 6) after BCR cross-linking. In addition, the LMP2AY112F mutation results in the loss of Lyn association with LMP2A (Fig. 3A) and the loss of LMP2A tyrosine phosphorylation (Fig. 5B).
Applying the data collected in this study with data from previously
published studies of LMP2 and studies of signal transduction through
the BCR, we have formulated a model of LMP2A function in latently
infected B lymphocytes (Fig. 9). In this
model, LMP2A is expressed in the plasma membranes of EBV latently
infected B cells and forms aggregates resembling ligated BCRs
(Fig. 9). Previously, studies have shown that the transmembrane domains of LMP2A are responsible for LMP2A aggregation. Truncation of LMP2A after two or five transmembrane domains result in the loss of
LMP2A aggregation and a concomitant loss of LMP2A function (20,
27). Once LMP2A is aggregated in a newly infected B cell, the Lyn
PTK may be recruited to the unphosphorylated LMP2A aggregates through
strategies similar to those used for the recruitment of the
nonactivated Src family PTKs to the unphosphorylated BCR. The
amino-terminal unique region of Lyn plays an important role in the
association of Lyn with the unphosphorylated Ig
chain (Ig
). The
unique region of Lyn binds the DCSM sequence located before the second
conserved tyrosine of the Ig
ITAM (8, 35). Interestingly,
LMP2A has a homologous DQSL sequence located adjacent to the LMP2A ITAM
which may play a similar role as the DCSM Ig
sequence by providing a
docking site for the Lyn PTK on unphosphorylated LMP2A (Fig. 9A).
Alternatively, the Lyn SH3 domain may interact with one of the
four proline-rich regions in the LMP2A amino-terminal domain (Fig. 9A).
The small amount of the Lyn PTK detectable in the pY112F- and
p2A
80-112-transfected immunoprecipitates is compatible with either
of these hypotheses (Fig. 3A).
|
Once Lyn is recruited to LMP2A by one or both of the mechanisms discussed above, Lyn phosphorylates LMP2A at Y112. Alternatively, an unknown kinase, which may be one of the proteins whose constitutive phosphorylation is induced in LMP2AY112F LCLs as well as EBV+LMP2A+ LCLs (Fig. 7), may phosphorylate LMP2A at Y112 (Fig. 9B). Once Y112 is phosphorylated, Lyn binds at Y112 and subsequently phosphorylates the remaining LMP2A tyrosines, in particular the two tyrosines of the LMP2A ITAM (Fig. 9C). The LMP2A phosphotyrosine motif at LMP2AY112 is YEEA, similar to the YEEI motif which is the SH2 domain binding motif preferred by the Src family PTKs (39). Interestingly, the BCR does not contain a similar motif. The specificity of Lyn for the LMP2A YEEA motif may confer preferential binding of Lyn to LMP2A and provide LMP2A with the ability to block normal BCR signal transduction. Data presented in this study provide evidence of the essential role of the Lyn PTK for LMP2A function. Without Lyn association with LMP2A at Y112 (Fig. 3A), LMP2A does not become phosphorylated (Fig. 5), and BCR-mediated signal transduction events occur, as evidenced by the induction of tyrosine phosphorylation (Fig. 7), mobilization of intracellular calcium (Table 1), induction of BZLF1 transcription (Fig. 8), and induction of PTK activities (Fig. 6) in the LMP2AY112F LCLs.
Following the phosphorylation of LMP2A, other SH2 domain-containing
proteins may be recruited to LMP2A aggregates, just as SH2-containing
proteins are recruited to the BCR upon BCR cross-linking. Specifically,
the Syk PTK binds to the phosphorylated LMP2A ITAM (12)
(Fig. 9D), similar to the binding of Syk to the ITAMs present in Ig
and Ig
heterodimers. Binding of Syk to the Ig
and Ig
heterodimer requires complete phosphorylation of the ITAMs
(17), similar to the requirement of Syk binding only
to a completely phosphorylated LMP2A ITAM. Mutation of either
tyrosine in the LMP2A ITAM resulted in the loss of Syk binding to
LMP2A (12). Although Syk is unable to bind to the LMP2A ITAM
mutants, LMP2A is still phosphorylated at other LMP2A amino-terminal
tyrosines (12). Once LMP2A is phosphorylated, other
unidentified SH2 domain-containing proteins involved in normal
BCR signal transduction may also be recruited to LMP2A
phosphotyrosines. In immunoprecipitation studies, LMP2A
associates with at least six unidentified cell proteins (2).
Candidate proteins are Shc, PI3-K, PLC
2, Abl, Crk, Nck, and Csk. In
addition, other proteins such as MAPK or WW domain-containing proteins
may also be recruited to LMP2A aggregates (Figs. 9A and D). MAPK has
been shown to bind an LMP2A amino-terminal glutathione S-transferase fusion protein (33). Many
of these same proteins (PI3-K, PLC
2, Vav, Shc, and MAPK) failed to
be activated by BCR cross-linking in LMP2A-expressing LCLs
(26), thus demonstrating further evidence for LMP2A
interaction with other cellular signal transducers and LMP2A
down-modulation of their activities. Once bound to LMP2A, the
functional activity of these proteins may be altered. Once recruited to
LMP2A aggregates, the sequestered LMP2A-associated proteins would no
longer be free to participate in normal BCR signal transduction.
Alternatively, LMP2A may induce the desensitization of cellular signal
transducers, thus preventing normal B-cell signal transduction.
Desensitization may be mediated by Csk, a negative regulator of the Src
family PTKs, or possibly by protein phosphatases recruited to
LMP2A complexes. For example, SHP-1, when recruited to the BCR complex
by the Fc receptor, results in down-modulation of BCR signal
transduction (9). This type of functional inactivation of
cellular proteins by viral proteins has been observed in other systems,
such as the binding and inactivation of the tumor suppressor protein Rb
by the human papillomavirus E7 oncoprotein (31).
Our studies of LMP2A function also highlight the central importance of the Lyn and Syk PTKs in BCR signal transduction. The Src family PTKs and Syk associate with the BCR and are activated following receptor activation (3, 6, 8, 16, 19, 36, 45, 46). A wealth of biochemical and genetic data has indicated the importance of these PTKs in B-cell signal transduction. Most relevant to studies of LMP2A function are the Lyn and Syk gene knockouts in murine and chicken B cells (7, 15, 32, 41, 42). EBV+LMP2A+ LCLs demonstrate a BCR-mediated signaling phenotype very similar to that of the Syk gene knockout in chicken B cells that demonstrate total disruption of BCR signal transduction (41). In the Lyn gene knockout in chicken B cells, there is only a modest alteration in B-cell signal transduction (41), presumably because of the replacement of Lyn function with other Src family PTKs. These observations further demonstrate the central importance of both the Lyn and Syk PTKs in the progression of normal B-cell signal transduction and how the loss or inactivation of these PTKs drastically alters the signaling pathways in B cells. The ability of LMP2A to bind and down-modulate the activities of both of these PTKs provides LMP2A with the means to efficiently block BCR-mediated signal transduction.
The role of other LMP2A-associated proteins remains to be determined.
Proposed in our current model of LMP2A function is the binding of other
cellular signaling proteins, containing modular SH2, SH3, or WW
domains, to LMP2A phosphotyrosines or proline-rich regions. LMP2A may
target proteins which are directly or indirectly activated by
BCR-induced PTK phosphorylation events. Candidate proteins are
the Shc, PI3-K, PLC
2, Abl, Crk, Nck, and Csk proteins. Future functional analysis of the remaining LMP2A tyrosine
residues and LMP2A proline-rich regions will determine the potential
roles of these elements in the LMP2A-mediated block in BCR signal
transduction.
Applying the knowledge gained in these studies to the role of LMP2A in vivo suggests an important role for LMP2A in maintaining a latent EBV infection within the peripheral blood B lymphocytes of an infected individual. In these cells, the blockade of BCR-mediated signal transduction may allow EBV-infected B cells to encounter BCR-specific signals without undergoing lytic replication, thus maintaining a reservoir of latent viral genomes within the infected host. However, lytic replication may occur in certain circumstances such as the interaction of an EBV-infected lymphocyte with epithelium-produced cytokines or with epithelial surfaces, using signal transduction pathways that are not efficiently blocked by LMP2A. This unique integration of a viral protein into the B-cell signal transduction pathway to block normal B-cell function offers an unusual opportunity to investigate the strategy that EBV has evolved to persist in the human population. Our investigations into this unusual interaction between LMP2A and cellular proteins may provide insights into the regulation of EBV infection, suggesting novel therapies for the control or prevention of EBV latency and latency-associated syndromes, and may further our understanding of B-cell signal transduction.
| |
ACKNOWLEDGMENTS |
|---|
R.L. is supported by Public Health Service grants CA62234 and CA73507 from the National Cancer Institute. R.L. is a Scholar of the Leukemia Society of America.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology-Immunology, Northwestern University Medical School, 303 E. Chicago Ave., Chicago, IL 60611. Phone: (312) 503-0467. Fax: (312) 503-1339. E-mail: r-longnecker{at}nwu.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Bolen, J. B. 1993. Nonreceptor tyrosine protein kinases. Oncogene 8:2025-2031[Medline]. |
| 2. |
Burkhardt, A. L.,
J. B. Bolen,
E. Kieff, and R. Longnecker.
1992.
An Epstein-Barr virus transformation-associated membrane protein interacts with Src family tyrosine kinases.
J. Virol.
66:5161-5167 |
| 3. |
Burkhardt, A. L.,
M. Brunswick,
J. B. Bolen, and J. J. Mond.
1991.
Anti-immunoglobulin stimulation of B lymphocytes activates src-related protein-tyrosine kinases.
Proc. Natl. Acad. Sci. USA
88:7410-7414 |
| 4. | Cambier, J. C. 1995. New nomenclature for the Reth motif (or ARH1/TAM/ARAM/YXXL). Immunol. Today 16:110[Medline]. |
| 5. | Cambier, J. C., C. M. Pleiman, and M. R. Clark. 1994. Signal transduction by the B cell antigen receptor and its coreceptors. Annu. Rev. Immunol. 12:457-486[Medline]. |
| 6. |
Campbell, M. A., and B. M. Sefton.
1992.
Association between B-lymphocyte membrane immunoglobulin and multiple members of the Src family of protein tyrosine kinases.
Mol. Cell. Biol.
12:2315-2321 |
| 7. | Cheng, A. M., B. Rowley, W. Pao, A. Hayday, J. B. Bolen, and T. Pawson. 1995. Syk tyrosine kinase required for mouse viability and B-cell development. Nature 378:303-306[Medline]. |
| 8. | Clark, M. R., S. A. Johnson, and J. C. Cambier. 1994. Analysis of Ig-alpha-tyrosine kinase interaction reveals two levels of binding specificity and tyrosine phosphorylated Ig-alpha stimulation of Fyn activity. EMBO J. 13:1911-1919[Medline]. |
| 9. |
D'Ambrosio, D.,
K. L. Hippen,
S. A. Minskoff,
I. Mellman,
G. Pani,
K. A. Siminovitch, and J. C. Cambier.
1995.
Recruitment and activation of PTP1C in negative regulation of antigen receptor signaling by FcgRIIB1.
Science
268:293-297 |
| 10. | DeFranco, A. L. 1995. Transmembrane signaling by antigen receptors of B and T lymphocytes. Curr. Opin. Cell Biol. 7:163-175[Medline]. |
| 11. | Fruehling, S., S. Lee, R. Herrold, B. Frech, G. Laux, E. Kremmer, F. A. Grässer, and R. Longnecker. 1996. Identification of latent membrane protein 2A (LMP2A) domains essential for the LMP2A dominant-negative effect on B-lymphocyte surface immunoglobulin signal transduction. J. Virol. 70:6216-6226[Abstract]. |
| 12. | Fruehling, S., and R. Longnecker. 1997. The immunoreceptor tyrosine-based activation motif of Epstein-Barr virus LMP2A is essential for blocking BCR-mediated signal transduction. Virology 235:241-251[Medline]. |
| 13. | Gold, M. R., and L. Matsuuchi. 1995. Signal transduction by the antigen receptors of B and T lymphocytes. Int. Rev. Cytol. 157:181-276[Medline]. |
| 14. | Heston, L., M. Rabson, N. Brown, and G. Miller. 1982. New Epstein-Barr virus variants from cellular subclones of P3J-HR-1 Burkitt lymphoma. Nature 295:160-163[Medline]. |
| 15. | Hibbs, M. L., D. M. Tarlinton, J. Armes, D. Grail, G. Hodson, R. Maglitto, S. A. Stacker, and A. R. Dunn. 1995. Multiple defects in the immune system of lyn-deficient mice, culminating in autoimmune disease. Cell 83:301-311[Medline]. |
| 16. |
Hutchcroft, J. E.,
M. L. Harrison, and R. L. Geahlen.
1992.
Association of the 72-kDa protein-tyrosine kinase PTK72 with the B cell antigen receptor.
J. Biol. Chem.
267:8613-8619 |
| 17. | Kimura, T., H. Sakamoto, E. Appella, and R. P. Siraganian. 1996. Conformational changes induced in the protein tyrosine kinase p72syk by tyrosine phosphorylation or by binding of phosphorylated immunoreceptor tyrosine-based activation motif peptides. Mol. Cell. Biol. 16:1471-1478[Abstract]. |
| 18. | Lee, S. K., and P. H. Stern. 1994. Studies on the mechanism of desensitization of the parathyroid hormone-stimulated calcium signal in UMR-106 cells: reversal of desensitization by alkaline phosphatase but not by protein kinase C downregulation. J. Bone Miner. Res. 9:781-789[Medline]. |
| 19. | Lin, J., and L. B. Justement. 1992. The MB-1/B29 heterodimer couples the B cell antigen receptor to multiple src family protein tyrosine kinases. J. Immunol. 149:1548-1555[Abstract]. |
| 20. |
Longnecker, R.,
B. Druker,
T. M. Roberts, and E. Kieff.
1991.
An Epstein-Barr virus protein associated with cell growth transformation interacts with a tyrosine kinase.
J. Virol.
65:3681-3692 |
| 21. |
Longnecker, R., and E. Kieff.
1990.
A second Epstein-Barr virus membrane protein (LMP2) is expressed in latent infection and colocalizes with LMP1.
J. Virol.
64:2319-2326 |
| 22. |
Longnecker, R.,
C. L. Miller,
X.-Q. Miao,
A. Marchini, and E. Kieff.
1992.
The only domain which distinguishes Epstein-Barr virus latent membrane 2A (LMP2A) from LMP2B is dispensible for lymphocyte infection and growth transformation in vitro, and LMP2A is therefore nonessential.
J. Virol.
66:6461-6469 |
| 23. |
Marchini, A.,
B. Tomkinson,
J. I. Cohen, and E. Kieff.
1991.
BHRF1, the Epstein-Barr virus gene with homology to Bcl2, is dispensable for B-lymphocyte transformation and virus replication.
J. Virol.
65:5991-6000 |
| 24. | Menezes, J., W. Leibold, G. Klein, and G. Clements. 1975. Establishment and characterization of an Epstein-Barr virus (EBV)-negative lymphoblastoid B cell line (BJA-B) from an exceptional, EBV-genome-negative African Burkitt's lymphoma. Biomedicine 22:276-284[Medline]. |
| 25. | Merrit, J. E., S. A. McCarthy, M. P. A. Davies, and K. E. Moores. 1990. Use of fluo-3 to measure cytosolic Ca2+ in platelets and neutrophils. Biochem. J. 269:513-519[Medline]. |
| 26. | Miller, C. L., A. L. Burkhardt, J. H. Lee, B. Stealey, R. Longnecker, J. B. Bolen, and E. Kieff. 1995. Integral membrane protein 2 of Epstein-Barr virus regulates reactivation from latency through dominant negative effects on protein-tyrosine kinases. Immunity 2:155-166[Medline]. |
| 27. |
Miller, C. L.,
J. H. Lee,
E. Kieff, and R. Longnecker.
1994.
An integral membrane protein (LMP2) blocks reactivation of Epstein-Barr virus from latency following surface immunoglobulin crosslinking.
Proc. Natl. Acad. Sci. USA
91:772-776 |
| 28. |
Miller, C. L.,
R. Longnecker, and E. Kieff.
1993.
Epstein-Barr virus latent membrane protein 2A blocks calcium mobilization in B lymphocytes.
J. Virol.
67:3087-3094 |
| 29. |
Miller, G., and M. Lipman.
1973.
Release of infectious Epstein-Barr virus by transformed marmoset leukocytes.
Proc. Natl. Acad. Sci. USA
70:190-194 |
| 30. |
Miller, G.,
T. Shope,
H. Lisco,
D. Stitt, and M. Lipman.
1972.
Epstein-Barr virus: transformation, cytopathic changes, and viral antigens in squirrel monkey and marmoset leukocytes.
Proc. Natl. Acad. Sci. USA
69:383-387 |
| 31. | Munger, K., B. A. Werness, N. Dyson, W. C. Phelps, E. Harlow, and P. M. Howley. 1989. Complex formation of human papillomavirus E7 proteins with the retinoblastoma tumor suppressor gene product. EMBO J. 8:4099-4105[Medline]. |
| 32. | Nishizumi, H., I. Taniuchi, Y. Yamanashi, D. Kitamura, D. Ilic, S. Mori, T. Watanabe, and T. Yamamoto. 1995. Impaired proliferation of peripheral B cells and indication of autoimmune disease in lyn-deficient mice. Immunity 3:549-560[Medline]. |
| 33. | Panousis, C. G., and D. T. Rowe. 1997. Epstein-Barr virus latent membrane protein 2 associates with and is a substrate for mitogen-activated protein kinase. J. Virol. 71:4752-4760[Abstract]. |
| 34. | Pawson, T., and G. D. Gish. 1992. SH2 and SH3 domains: from structure to function. Cell 71:359-362[Medline]. |
| 35. |
Pleiman, C. M.,
C. Abrams,
L. T. Gauen,
W. Bedzyk,
J. Jongstra,
A. S. Shaw, and J. C. Cambier.
1994.
Distinct p53/56lyn and p59fyn domains associate with nonphosphorylated and phosphorylated Ig-alpha.
Proc. Natl. Acad. Sci. USA
91:4268-4272 |
| 36. | Pleiman, C. M., D. D'Ambrosio, and J. C. Cambier. 1994. The B-cell antigen receptor complex: structure and signal transduction. Immunol. Today 15:393-399[Medline]. |
| 37. | Reth, M. 1989. Antigen receptor tail clue. Nature 338:383-384[Medline]. |
| 38. | Schaffhausen, B. 1995. SH2 domain structure and function. Biochim. Biophys. Acta 1242:61-75[Medline]. |
| 39. | Songyang, Z., S. E. Shoelson, M. Chaudhuri, G. Gish, T. Pawson, W. G. Haser, F. King, T. Roberts, S. Ratnofsky, R. J. Lechleider, B. G. Neel, R. B. Birge, J. E. Fajardo, M. M. Chou, H. Hanafusa, B. Schaffhausen, and L. C. Cantley. 1993. SH2 domains recognize specific phosphopeptide sequences. Cell 72:767-778[Medline]. |
| 40. |
Swaminathan, S.,
B. Tomkinson, and E. Kieff.
1991.
Recombinant Epstein-Barr virus with small RNA (EBER) genes deleted transforms lymphocytes and replicates in vitro.
Proc. Natl. Acad. Sci. USA
88:1546-1550 |
| 41. | Takata, M., H. Sabe, A. Hata, T. Inazu, Y. Homma, T. Nukada, H. Yamamura, and T. Kurosaki. 1994. Tyrosine kinases Lyn and Syk regulate B cell receptor-coupled Ca2+ mobilization through distinct pathways. EMBO J. 13:1341-1349[Medline]. |
| 42. | Turner, M., P. J. Mee, P. S. Costello, O. Williams, A. A. Price, L. P. Duddy, M. T. Furlong, R. L. Geahlen, and V. L. J. Tybulewicz. 1995. Perinatal lethality and blocked B-cell development in mice lacking the tyrosine kinase Syk. Nature 378:298-302[Medline]. |
| 43. |
Wang, F.,
A. Marchini, and E. Kieff.
1991.
Epstein-Barr virus (EBV) recombinants: use of positive selection markers to rescue mutants in EBV-negative B-lymphoma cells.
J. Virol.
65:1701-1709 |
| 44. | Weiss, A., and D. R. Littman. 1994. Signal transduction by lymphocyte antigen receptors. Cell 76:263-274[Medline]. |
| 45. | Yamada, T., T. Tanaguchi, C. Yang, S. Yasue, H. Saito, and H. Yamamura. 1993. Association with B-cell-antigen receptor with protein-tyrosine kinase p72syk and activation by engagement of membrane IgM. Eur. J. Biochem. 213:455[Medline]. |
| 46. |
Yamanashi, Y.,
Y. Fukui,
W. Wongsasant,
Y. Kinoshita,
Y. Ichimori,
K. Toyoshima, and T. Yamamoto.
1992.
Activation of src-like protein-tyrosine kinase lyn and its association with PI(3)kinase upon B-cell antigen receptor-mediated signalling.
Proc. Natl. Acad. Sci. USA
89:1118-1122 |
| 47. |
Yi, T. L.,
J. B. Bolen, and J. N. Ihle.
1991.
Hematopoietic cells express two forms of Lyn kinase differing by 21 amino acids in the amino terminus.
Mol. Cell. Biol.
11:2391-2398 |
| 48. |
Young, L. S.,
R. Lau,
M. Rowe,
G. Niedobitek,
G. Packham,
F. Shanahan,
D. T. Rowe,
D. Greenspan,
J. S. Greenspan,
A. B. Rickinson, and P. J. Farrell.
1991.
Differentiation-associated expression of the Epstein-Barr virus BZLF1 transactivator protein in oral hairy leukoplakia.
J. Virol.
65:2868-2874 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»