Previous Article | Next Article ![]()
Journal of Virology, October 1998, p. 7785-7795, Vol. 72, No. 10
Department of Microbiology and College of
Physicians and Surgeons, Columbia University, New York, New York
10032
Received 9 April 1998/Accepted 15 June 1998
The transcriptional program of herpes simplex virus is regulated by
the concerted action of three immediate-early ( Herpes simplex virus type 1 and 2 (HSV-1 and -2) infections proceed from a primary lytic infection in the
periphery to a lifelong state of latency in sensory neurons
characterized by episodes of virus reactivation and lytic infection.
The regulatory mechanisms that control HSV gene expression, the
establishment and maintenance of latency, and the reactivation of
latent virus are complex.
The genes of HSV-1 and -2 are classified into three kinetic classes,
immediate-early ( Mutational and biochemical analyses of ICP0 in transient expression
assays and/or in the context of the virus genome led to the
identification of domains essential for the activation of gene
expression and virus replication (4, 6, 7, 15-17, 61). The
role(s) of these domains in ICP0 function remains largely undefined.
ICP0 contains an acidic NH2-terminal domain, an essential C3HC4 zinc finger (6, 7, 14-17, 20,
38), a nuclear localization signal, two centrally located
proline-rich regions, and a serine tract which may represent a site of
phosphorylation (references 7 and
53 and references therein; 66).
ICP0 oligomerizes in infected cells (5, 10, 42) and
interacts with ICP4, the major virus regulatory protein (43, 46,
67). ICP27 has been shown to influence the intracellular
distribution of ICP0 in transfected cells (69). However,
because ICP4 interacts directly with ICP0 and ICP27, ICP27-dependent
effects on the intracellular localization of ICP0 may be mediated
through its interaction with ICP4. Recent studies indicate that ICP0
also interacts with the cellular proteins cyclin D3 (33) and
translation elongation factor eEF1B This report presents a series of experiments that begin to characterize
the role of the acidic NH2 terminus of ICP0 in the growth
and replication of HSV-1. We demonstrate that this domain functions as
a potent transcriptional activation domain in Saccharomyces cerevisiae. Deletion analysis in transient expression assays
further demonstrates that this region of ICP0 is required for
ICP0-mediated transcriptional activation of HSV-1 Cells and viruses.
Vero and L7 (55) cells were
grown and maintained in Dulbecco's modified Eagle's medium (DMEM;
Gibco BRL, Grand Island, N.Y.) containing 5% bovine calf serum
(HyClone Laboratories Inc., Logan, Utah). For growth of L7 cells, DMEM
was supplemented with 400 µg of G418 (Gibco BRL) per ml. 293T cells
(13) were maintained in DMEM containing 10% fetal bovine
serum (HyClone). The media were supplemented with penicillin (100 U/ml)
and streptomycin (100 µg/ml) (Gibco BRL) unless otherwise noted.
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The NH2 Terminus of the Herpes Simplex
Virus Type 1 Regulatory Protein ICP0 Contains a Promoter-Specific
Transcription Activation Domain
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
) proteins, ICP4,
ICP27, and ICP0. The experiments described in this study examine the
role of the acidic amino terminus (amino acids 1 to 103) of ICP0 in
gene activation. When tethered to a DNA binding domain, this sequence
activates transcription in the yeast Saccharomyces cerevisiae. Deletion of these amino acids affects the ability of
ICP0 to activate
-gene promoter reporters in transient expression assays, while it has little or no effect on a
- and a
-gene reporter in the same assay. Viruses that express the deleted form of
ICP0 (ICP0-NX) have a small-plaque phenotype on both Vero cells and the
complementing cell line L7. Transient expression and immunofluorescence analyses demonstrate that ICP0-NX is a dominant negative form of ICP0.
Immunoprecipitation of ICP0 from cells coinfected with viruses
expressing ICP0-NX and ICP0 revealed that ICP0 oligomerizes in infected
cells. These data, in conjunction with the finding that ICP0-N/X is
dominant negative, provide both biochemical and genetic evidence that
ICP0 functions as a multimer in infected cells.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
), early (
), and late (
), based on their
temporal expression during productive infections (references 30, 31, and 53 and references
therein). The immediate-early genes (
0,
4,
27,
22,
47,
and
X) (references 2 and 53 and references therein) are the first to be transcribed following delivery of the virus genome to the host cell nucleus. Subsequent expression of early genes, whose products are largely involved in
replication of the virus genome, and late genes, which encode many of
the structural components of the herpes simplex virion, requires the
prior synthesis of
-gene products (11, 12, 41, 48, 51).
Evidence suggests that three of the
-gene products, ICP0, ICP4, and
ICP27, cooperatively regulate the expression of all kinetic classes of
virus genes (19, 22, 40, 44, 48, 51, 54, 64). ICP4 appears
to activate
- and
-gene transcription while repressing its own
expression as well as that of the
0 gene (11, 24, 36, 37, 48,
50, 52). ICP0, a promiscuous transcriptional activator
(references 18, 22, and 53 and references therein), has been shown to affect the expression and synthesis of the essential
protein ICP27 and the expression of ICP0
and ICP4 at early times postinfection (38). ICP27 is required for the expression of
and
genes during the herpesvirus life cycle. Although this protein appears to act primarily at the
posttranscriptional level (28, 47, 56, 57, 60), its
interaction with ICP4 supports a more direct role for ICP27 in the
regulation of gene expression (46).
, a GTP exchange factor (referred
to as EF-1
in reference 32). However, the
relevance of these interactions in the context of a productive
infection is unknown.
, but not
or
, promoters. In the context of the virus genome, deletion of the
ICP0 NH2 terminus results in defects in the growth of
HSV-1, small plaques, and high fluorescent focus unit (FFU)/PFU ratios
in Vero cells and the ICP0-expressing cell line L7 (55). The
ICP0 NH2-terminal deletion mutant EL0-N/X, which lacks
amino acids (aa) 3 to 104, acts as a dominant negative inhibitor of
ICP0 function through the formation of oligomers with wild-type ICP0.
This analysis provides the first clear evidence that ICP0 contains a
promoter-specific transcriptional activation domain and suggests that
ICP0 function is dependent on the formation of dimers and/or
higher-order oligomers in infected cells.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
0 cDNA virus vCPc0 (38, 46) and the
0
deletion virus dl1403 have been described elsewhere
(61).
Plasmids. (i)
0 cDNA constructs.
Plasmid pDS17, which
contains an
0 cDNA and its associated regulatory sequences
(68), was constructed by replacing the MluI-EcoRI fragment of pDS16 (68) with
the corresponding fragment from p0XB (7). Plasmid pDSE-17B
was created by destruction of the Asp718 site located 3' of
the HSV-1 sequences in pDS17.
(ii) GAL4-BD-
0, LexA-
0, and GAL4-AD-
0 gene
fusions.
Plasmid pGBT9 (Clontech, Palo Alto, Calif.) encodes the
GAL4 DNA binding domain (GAL4-BD; aa 1 to 147) under the control of the
yeast ADH1 promoter. Plasmid pBTM116 encodes the entire LexA protein coding sequence (aa 1 to 202) under the control of the yeast
ADH1 promoter. Plasmid pXW2 (GAL4-BD-ICP0 aa 1 to 775) was constructed by insertion of the NcoI-BglII
fragment of the
0 cDNA from pDS17 into pGBT9 digested with
EcoRI and BamHI. In this construction, the
NcoI and EcoRI sites were filled in with Klenow DNA polymerase. Plasmid pJY3 (GAL4-BD-ICP0 aa 1 to 105) was
constructed by deletion of the XhoI-SalI fragment
of the
0 gene from pXW2. pJY4 (GAL4-BD-ICP0 aa 1 to 212) was
constructed by deletion of the Asp718-SalI
fragment of pXW2. pJY7 (GAL4-BD-ICP0 aa 105 to 212) was constructed by
insertion of the XhoI-PstI fragment of pJY4 into
pGBT9 digested with SalI and PstI. Plasmid
pCPC-YGal03-F (GAL4-BD-ICP0 aa 394 to 775) was
constructed by deletion of the EcoRI-NotI
fragment of pXW2. Plasmid pPC62-86 was constructed by replacing the
SalI-BamHI fragment of pPC62 (8) with
the corresponding fragment of pPC86 (8). pBD62-0105/769
(GAL4-BD-ICP0 aa 105 to 769) was constructed by insertion of the
BglII fragment of pGAD0105/769 into pPC62-86. pGAD0105-769
(GAL4-AD-ICP0 aa 105 to 769) was constructed by insertion of the
XhoI-EcoRI fragment of pGAD0 into pGAD10
(Clontech). pGAD0 (GAL4-AD-ICP0 aa 1 to 769) was constructed by
insertion of the MluI-NotI and
NotI-SalI fragments of pAD86-01 into pGAD10
digested with MluI and XhoI. Plasmid pGBT-VP16T was constructed by subcloning the EcoRI-BclI
fragment of pGAL4-VP16 (a gift from Kathryn Calame, Department of
Microbiology, Columbia University, New York, N.Y.) into pGBT9 digested
with EcoRI and BamHI. Plasmids pJY5
(LexA-ICP0 aa 1 to 105) and pJY6 (LexA-ICP0 aa 1 to 212) were
constructed by insertion of the EcoRI-PstI
fragments of pJY3 and pJY4, respectively, into pBTM116. Plasmid pGAD10
(Clontech) encodes the GAL4 transcriptional activation domain
(GAL4-AD; aa 768 to 881). pGAD0105 (GAL4-AD-ICP0 aa 1 to 105)
was constructed by insertion of the MluI-XhoI
fragment of pAD86-01 into pGAD10. pAD86-01 (GAL4-AD-ICP0 aa 1 to
775) encodes a fusion protein between the GAL4-AD and aa 1 to 775 of ICP0 in pPC86. All junctions between the GAL4-BD, LexA, or the
GAL4-AD and regions of the
0 gene were verified by DNA sequence
analysis.
0 sequences encoding
aa 105 to 553 of HSV-1 ICP0 into pPC62.
(iii)
0 mutant constructs.
pEL0N/X, which encodes a
mutant ICP0 lacking aa 3 to 104, was constructed as follows. Primers
0-N/X-5'3' (CATGGAATTCGC) and 0-N/X-3'5' (TCGAGCGAATTC)
were annealed and ligated to pDSE-17B digested with
NcoI and XhoI. The resulting deletion was
verified by DNA sequencing. Plasmid pEL0-TIF, which encodes a fusion
protein between the transcriptional activation domain of HSV-1
TIF
(
TIF-AD; aa 411 to 490) and ICP0 aa 105 to 775, was constructed as
follows. The DNA sequence encoding aa 411 to 490 of
TIF was
amplified from pRAB14 (2) by PCR (as described below), using
primers (Gibco BRL) that generate an NcoI or XhoI
site and maintain the reading frame of the
0 gene (VP16AD 5'3'
[GCCCATGGTGTCGACGGCCCCCCCGACC] and VP16AD 3'5'
[GCTCGAGACCCACCGTACTCGTCAATTCC], respectively). The
resulting PCR product was cloned into pGEM-T, thus generating pGEM-T-VP16. The predicted DNA sequence of the
TIF-AD in pGEM-T-VP16 was confirmed by DNA sequence analysis. The
NcoI-XhoI fragment of pGEM-T-VP16 was inserted
into pDSE-17B digested with NcoI and XhoI, thus
replacing the
0 sequence encoding ICP0 aa 2 to 104. Plasmid
pEL17
M was constructed by insertion of the
HindIII-MluI fragment of pDSE-17B into
pIBI31.
(iv) Firefly luciferase reporter plasmids.
Plasmids
pCPC-4P-LUC, pTK-LUC, and pEL-PgC-LUC have been described elsewhere
(38). Plasmid pCPC-27P-LUC, containing the firefly
luciferase reporter gene under the control of the HSV-1 (strain KOS
1.1)
27 gene regulatory sequences, was constructed in two steps.
First, the BamHI-BglII fragment from plasmid
pBS
27 (60) was cloned into pIC20H (39)
digested with BamHI and BglII. The resulting
plasmid, pCPC-27P, contains
27 gene sequences from
266 to
2
relative to the transcription initiation site. pCPC-27P-LUC was
generated by cloning a BamHI fragment from p19LUC
(63), containing the luciferase gene coding sequences, into
the BglII site of pCPC-27P. Plasmid pCPC-22/47P-LUC was also
made in two steps. First, pCPC-4/22P was constructed by subcloning the
BamHI-BglII fragment from plasmid pIGA101
(23), containing the
4 and
22/47 gene 5' regulatory
sequences from HSV-1 strain F, into
BamHI-BglII-digested pIC20H (39).
pCPC-22/47P-LUC, containing the luciferase gene under the control of
the
22/47 gene regulatory sequences (
724 to +33), was constructed
by cloning the BamHI luciferase gene fragment from p19LUC
into the BglII site of pCPC-4/22P. Plasmid pCPC-0P-LUC was
constructed as follows. The SacI (filled)-NcoI (filled) fragment from pXW8 (37), containing the
789 to
+147
0 gene sequences from HSV-1 strain 17, was cloned into
EcoRV-digested vector pZero2.1 (Stratagene, La Jolla,
Calif.) to yield plasmid pCPC-0PL. A StuI
fragment was deleted from pCPC-0PL to yield plasmid pCPC-0P, which contains the
537 to +147 region of the
0 gene. The
BamHI fragment from p19LUC was cloned into
BamHI-digested pCPC-0P to yield pCPC-0P-LUC. pG5-TK-LUC was
a gift from Kathryn Calame.
-Galactosidase assays. (i) Filter assays.
S.
cerevisiae Y190 (29) and CTY10-5d (Rolf Sternglanz,
State University of New York at Stony Brook) were maintained on YPD medium at 30°C. Yeast cells were transformed by using 1 µg of plasmid DNAs and salmon sperm carrier DNA. When appropriate,
transformants were grown at 30°C for 3 to 4 days on SD medium (Difco
Laboratories, Detroit, Mich.) containing 25 mM
3-amino-1,2,4-triazole and lacking the appropriate amino acids (Trp
or Leu and His) (27). Yeast colonies were lifted onto
nitrocellulose membranes (Schleicher & Schuell, Keene, N.H.), and the
cells were lysed by freezing them at
80°C for 15 min. After
reaching room temperature, the nitrocellulose disks were placed into
petri dishes containing 5 ml of Z buffer (60 mM
Na2HPO4, 40 mM NaH2PO4,
10 mM KCl, 1 mM MgSO4, 0.3%
-mercaptoethanol)
containing 1 mg of
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal) per ml and incubated at 30°C for 1 to 5 h.
(ii) Liquid assays.
Clonal Y190 transformants were grown in
SD medium without Trp or Leu and containing 0.05% glucose to an
optical density at 600 nm (OD600) of approximately 0.6. The
cells were collected by centrifugation at 1,500 × g
for 5 min at 4°C and resuspended in ice-cold Z buffer. Then 200 µl
of ice-cold acid-washed glass beads was added to each cell pellet, and
the cells were lysed by vortexing them three times for 1 min each. The
cell lysates were clarified by centrifugation at 2,500 × g for 5 min at 4°C, and the total protein concentrations
were determined by the Bradford method. For
-Galactosidase assays,
150 µl of cell extract was diluted to 800 µl with Z buffer prior to
the addition of 200 µl of 4 mg of
o-nitrophenyl-
-D-galactopyranoside (ONPG) per
ml and the mixture was incubated at 30°C until pale yellow (<30
min). Reactions were stopped by the addition of 500 µl of 1 M
Na2CO3, and the OD420 was
determined. Units of
-galactosidase per milligram of total protein
were determined based on 1 U of
-galactosidase equaling the amount
of enzyme required to hydrolyze 10
9 mol of ONPG per min.
Transfection and transient expression assays. (i) Transfections. Vero cells were transfected with the indicated plasmids by the calcium phosphate precipitation method as previously described (38).
(ii) Luciferase assays. Transfected Vero cell monolayers were harvested at 48 h posttransfection, and luciferase activities were quantified with a Berthold Lumat LB9501 luminometer (Wallac Inc., Gaithersburg, Md.) as described previously (3). Luciferase activities were determined from triplicate transfections in at least two independent experiments.
Construction of recombinant herpesviruses.
Recombinant
herpesviruses were constructed as previously described (38).
Briefly, linearized plasmid pEL0-N/X, pEL0-TIF, or pEL17
M and 100 PFU of herpesvirus nucleocapsids, purified from cells infected with the
0 null virus dl1403 (59), were transfected
into Vero cells. Recombinant viruses vEL0-N/X, vEL0-TIF, and vEL0-NXR
were isolated and plaque purified three times. vEL0-N/X encodes a
mutant form of ICP0 lacking aa 3 to 104. vEL0-TIF encodes a mutant form
of ICP0 in which aa 2 to 104 have been replaced with the HSV-1
TIF-AD (aa 411 to 490); vEL0-NXR, which was constructed by using
virus nucleocapsids isolated from cells infected with vEL0-N/X, encodes
wild-type ICP0 from an
0 cDNA. The sequence arrangements of the
0
loci in these viruses were verified by Southern blot analysis. The DNA
sequence of each mutation was verified.
Virus growth assays.
Vero cells were infected at the
indicated multiplicities of infection (MOIs). Following virus
adsorption, infected cell monolayers were washed twice with
phosphate-buffered saline (PBS) and overlaid with fresh medium. At the
indicated times, infections were halted by freezing the cells at
80°C. Virus yields were determined by titration on the
ICP0-expressing cell line L7 (55). Growth curves represent
the average of two independent infections, each titrated in duplicate.
Coimmunoprecipitations. (i) Transfections. 293T cells were transfected with either pDSE-17B (5 µg/10-cm-diameter plate), pEL0-N/X (5 µg/10-cm-diameter plate), or a mixture of both plasmids (5 µg of each plasmid/10-cm-diameter plate), using the calcium phosphate precipitation method (65). At 48 h posttransfection, the cells (four 10-cm-diameter plates per condition) were harvested and washed three times with ice-cold PBS containing 1 mM phenylmethylsulfonyl fluoride (PMSF). Each cell pellet was resuspended in 3 ml of ICP0 lysis buffer [20 mM HEPES-KOH (pH 7.9), 0.25% (vol/vol) Nonidet P-40, 400 mM NaCl, 10 mM MgCl2, 10% (vol/vol) glycerol, 1 mM PMSF, 0.1 mM L-1-chloro-3-(4-tosylamido)-4-phenyl-2-butanone (TPCK), 0.1 mM L-1-chloro-3-(4-tosylamido)-7-amino-2-heptanone (TLCK) (Boehringer Mannheim, Indianapolis, Ind.)] containing DNase I (50 µg/ml) and RNase I (50 µg/ml). Cell lysates were incubated for 20 min at 4°C, sonicated for 90 s in a Branson (Danbury, Conn.) Sonifier 450, and clarified by centrifugation at 5,000 × g for 15 min at 4°C followed by high-speed centrifugation at 16,000 × g for 15 min at 4°C.
(ii) Infections. Vero cells were infected with wild-type HSV-1, vEL0-N/X, or both viruses at an MOI of 5. At 7 h postinfection, the cells were washed three times with ice-cold PBS containing 1 mM PMSF and cell lysates were prepared as described above.
(iii) Immunoprecipitation.
Immunoprecipitations were
performed with a rabbit polyclonal antibody (CLU7) that recognizes
epitopes within ICP0 between aa 312 and 400 (37) or an
affinity-purified rabbit polyclonal antibody (
0-N18) that recognizes
the NH2-terminal 18 aa of HSV-1 ICP0. A 500-µl aliquot of
each supernatant was mixed with 5 µl of the indicated anti-ICP0
antibody and incubated at 4°C for 1 h with constant mixing prior
to the addition of 30 µl of a GammaBind Plus Sepharose (Pharmacia,
Piscataway, N.J.) suspension (50% [vol/vol] in ICP0 lysis buffer),
and incubation was continued for another 1 h at 4°C. The beads
were washed as previously described (38), resuspended in 30 µl of 1.5× sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) sample buffer, and boiled for 5 min. The immunoprecipitated
proteins were separated by SDS-PAGE and detected by Western blot
analysis, as described below, using antibody CLU7 (37).
Western blot analysis. (i) Transfected cells. 293T cells were transfected, in 10-cm-diameter plates, with 15 µg of plasmid DNAs as previously described (38, 46). Forty-eight hours posttransfection, the cells were scraped into ice-cold PBS and collected by centrifugation at 2,000 × g for 5 min at 4°C. Cell pellets were solubilized in 1.5× SDS-PAGE sample buffer as described previously (38). The proteins were separated in 7.5% denaturing polyacrylamide gels (34) and electrophoretically transferred to nitrocellulose membranes (62). ICP0 was detected by using the rabbit polyclonal antibody CLU7 as previously described (38).
(ii) HSV-1-infected cells. Vero cells were infected with 1 FFU per cell. At 8 h postinfection, the cells were scraped into ice-cold PBS and collected by centrifugation. Infected cell pellets were solubilized in 1.5× SDS-PAGE sample buffer, and the proteins were separated by SDS-PAGE as previously described (38). Immunodetection of virus proteins was performed as described elsewhere (45). The following antibodies were used to detect the indicated HSV-1 proteins: ICP0, CLU7 (37); ICP4, mouse monoclonal antibody H1114 (Goodwin Institute for Cancer Research, Plantation, Fla.); ICP27, rabbit polyclonal antibody CLU38 (37); glycoprotein B(gB), rabbit polyclonal antibody R69 (provided by G. Cohen, University of Pennsylvania); and VP5, rabbit polyclonal antibody NC-1 (also provided by G. Cohen). The secondary antibodies used in this study were horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G and goat anti-mouse immunoglobulin G (Sigma Chemical, St. Louis, Mo.). Immunoblots were developed as previously described (38).
Immunofluorescence.
Vero cells were either transfected with
5 µg of plasmid DNAs encoding wild-type or mutant forms of ICP0 or
infected with the indicated herpesviruses. At 48 h
posttransfection or 8 h postinfection, immunodetection of ICP0 was
performed as previously described (38), using either
monoclonal antibody H1083, polyclonal antibody CLU7, or
affinity-purified anti-ICP0 antibody
0-N18.
Fluorescent-focus assays. Vero cells (106 per 35-mm-diameter plate) were infected at an MOI of 0.01 or 0.001 with wild-type HSV-1 strain Glasgow 17, vCPc0, vEL0-N/X, vEL0-NXR, vEL0-TIF, or dl1403. At 8 and 24 h postinfection, cell monolayers were washed with PBS and fixed in 90% methanol for 10 min. ICP4 and ICP0 were detected with mouse monoclonal antibody 58S (58) and rabbit polyclonal antibody CLU7 (37), respectively, diluted 1:200 in PBS. The average number of FFU or PFU per cell was determined at 8 or 24 h postinfection, respectively. Thus, the FFU/PFU ratio represents the number of positively staining cells at 8 h postinfection relative to the number of infected cell foci at 24 h postinfection per field of cells. The FFU/PFU ratio for each virus was determined in three independent experiments.
| |
RESULTS |
|---|
|
|
|---|
The acidic NH2 terminus of ICP0 can activate
transcription in S. cerevisiae when fused to a heterologous
DNA binding domain or protein.
Proteins that mediate the
activation of gene expression at the level of transcription often
contain modular DNA binding and transcriptional activation domains,
i.e., discrete domains that retain function outside of their native
context. For example, the well-characterized transcriptional
activation domains of the GAL4 and HSV-1
TIF proteins activate gene
expression when fused to heterologous DNA binding domains
(references 9 and 49 and
references therein). Accordingly, in an effort to identify transcriptional activation domains within the HSV-1 immediate-early regulatory protein ICP0, regions of the
0 gene were fused to sequences encoding the GAL4-BD or the Escherichia coli
LexA protein. The ability of each of the resulting fusion proteins to
activate transcription was examined in two strains of S. cerevisiae, Y190 and CTY10-5d. Y190 contains lacZ and
HIS3 reporter genes under the control of a GAL4 upstream
activation sequence, and CTY10-5d contains lacZ under
the control of a GAL1 promoter containing four LexA binding
sites. Thus, the ability of various regions of ICP0 to function as
transcriptional activation domains when fused to the GAL4-BD or
LexA protein was determined by growth of Y190 in the absence of
histidine and the expression of
-galactosidase in Y190 or
CTY10-5d (Fig. 1).
|
TIF-AD when fused to the GAL4-BD
(Fig. 1). The GAL4-BD alone, or fusion proteins containing the
NH2-terminal 105 or 212 aa of ICP0 fused to the
GAL4-AD, failed to activate lacZ expression or allow
growth of Y190 in the absence of histidine (Fig. 1). Fusion proteins
lacking the NH2-terminal 105 aa of ICP0 also failed to
mediate reporter gene expression (Fig. 1); however, as several of these
proteins could not be detected in transformed yeast cell extracts by
Western blot analysis (data not shown), their inability to activate
reporter gene expression may result from their failure to accumulate.
These findings suggest that the acidic NH2-terminal 105 aa
of ICP0 constitute a transcriptional activation domain in S. cerevisiae when fused to the GAL4-BD.
To eliminate the possibility that the NH2 terminus of ICP0
was capable of activating reporter gene expression exclusively in the
context of a fusion protein with the GAL4-BD, plasmids encoding
fusion proteins containing aa 1 to 105 or 1 to 212 of ICP0 fused to the
bacterial LexA protein were constructed (Fig. 1). These fusion proteins
were tested for activation of a GAL1 promoter containing
four LexA binding sites in S. cerevisiae CTY10-5D (Fig.
1). The bacterial LexA protein alone did not activate lacZ expression. However, LexA fusion proteins containing ICP0 aa 1 to 105 or 1 to 212 activated lacZ expression in CTY10-5D (Fig. 1).
Thus, the NH2-terminal 105 aa of ICP0, when fused to either the GAL4-BD or the LexA protein, function as a transcriptional activator.
Quantitative
-galactosidase assays revealed that the NH2
terminus of ICP0 (aa 1 to 105) activated reporter gene expression in
S. cerevisiae to levels threefold greater than that of the minimal HSV-1
TIF-AD when fused to the GAL4-BD (Fig. 1). We
further note that the activation of reporter gene expression was
dependent on fusion of this domain of ICP0 to a DNA binding domain
(data not shown). Collectively, these results are consistent with the conclusion that the acidic NH2-terminal 105 aa of HSV-1
ICP0 constitute a transcriptional activation domain in yeast. They do
not, however, exclude the possibility that ICP0 contains other
transcriptional activation domains.
Having shown that the NH2-terminal region of ICP0 can
function as a transcriptional activation domain in yeast, we next asked whether this region could also activate gene expression in mammalian cells when fused to the GAL4-BD. Vero cells were cotransfected with
plasmids encoding the indicated fusion proteins under the control of
the simian virus 40 early promoter (Fig.
2) and reporter plasmids encoding the
firefly luciferase gene under the control of the HSV-1 thymidine kinase
(TK) promoter or the TK promoter containing five
concatemerized GAL4 binding sites (G5-TK) (Fig. 2). Plasmids
encoding wild-type ICP0 or a fusion protein containing the GAL4-BD
and the minimal HSV-1
TIF-AD were included as controls (Fig. 2).
Consistent with its ability to activate gene expression from a wide
range of viral and cellular gene promoters, wild-type ICP0 activated
gene expression from both the TK and G5-TK promoters, whereas the
GAL4-BD-
TIF-AD fusion protein activated only the G5-TK
promoter (Fig. 2). Fusion proteins containing the GAL4-BD and
regions of ICP0 universally failed to activate reporter gene expression
(Fig. 2). This result was not due to transcriptional "squelching"
(25), as varying the concentration of effector plasmids over
a wide range did not alter this result. The lack of luciferase
expression also could not be explained by low abundance of these
GAL4-ICP0 fusion proteins (Fig. 2), as all of these proteins were
readily detected in transfected Vero cells by indirect
immunofluorescence (data not shown). These analyses, however, revealed
that GAL4-BD-ICP0 fusion proteins containing the
NH2-terminal 105 or 212 aa of ICP0 were excluded from the
nuclei of transfected cells despite the presence of a nuclear
localization signal in the GAL4-BD (data not shown). This
observation may explain the failure of these fusion proteins to
activate reporter gene expression. However, it does not address why
full-length ICP0 was unable to activate reporter gene expression when
fused to the GAL4-BD as this protein accumulated in the nuclei of
transfected cells (data not shown).
|
Deletion of the NH2 terminus of ICP0 affects the level
of transactivation of immediate-early virus gene promoters.
The
data presented above raised the possibility that the
NH2-terminal 105 aa of ICP0 constitute a transcriptional
activation domain. However, they also underscored the complications
that can arise from the use of heterologous fusion proteins in the analysis of protein function. Therefore, the
0 cDNA plasmid
pEL0-N/X, which encodes a truncated form of ICP0 lacking aa 3 to 104 (ICP0-N/X) under the control of the endogenous
0 promoter/regulatory
sequences, was constructed. The effect(s) of this deletion on the
ability of ICP0 to activate transcription from each of the three major temporal classes of herpesvirus promoters was assessed in
transient expression assays. Briefly, Vero cells were cotransfected
with plasmids encoding wild-type ICP0 or ICP0-N/X and reporter
constructs directing expression of the firefly luciferase gene under
the control of the
4,
27,
22/47, or
0 promoter, the
-TK
promoter, or the
-gC promoter (Fig.
3). This analysis demonstrates that deletion of aa 3 to 104 results in a significant reduction in activation from all of the herpesvirus
-gene promoters examined (Fig. 3). This result cannot be attributed to gross structural alterations in ICP0-N/X, as it activated reporter gene expression from
the TK and gC promoters to wild-type levels (Fig. 3). Western blot
analysis demonstrated that ICP0-N/X accumulated to wild-type levels in
transfected cells (Fig. 4). These data,
in combination with our finding that the NH2 terminus of
ICP0 activates gene expression in yeast when fused to a heterologous
DNA binding domain, support a role for this domain in the activation of
transcription from HSV-1
-gene promoters.
|
|
TIF-AD (aa 411 to
490) fused to aa 105 to 775 of ICP0 (ICP0-TIF) was generated. This protein accumulated in transfected Vero cells to wild-type levels
(Fig. 4) and activated gene expression from
-gene promoters in
transient expression assays to higher levels than ICP0-N/X (Fig. 3).
ICP0-TIF activated the TK promoter to wild-type levels but exhibited
defects in the activation of the gC promoter (Fig. 3). To address the
possibility that the
TIF-AD functioned merely as a stuffer peptide,
a construct encoding a fusion protein containing aa 761 to 861 of
E. coli
-galactosidase fused to aa 104 to 775 of ICP0
(ICP0-
gal) was generated. In transient expression assays, ICP0-
gal failed to activate reporter gene expression (data not shown). These data suggest that the well-characterized transcriptional activation domain of HSV-1
TIF can functionally replace the
NH2 terminus of ICP0 and further support the conclusion
that ICP0 contains an NH2-terminal, promoter-specific
transcriptional activation domain.
Construction and analysis of a herpesvirus that directs the
expression of ICP0-N/X.
While the results described above suggest
a role for the NH2 terminus of ICP0 in the activation of
gene expression, they do not establish whether this region is important
for the growth and replication of HSV-1. To address this issue, the
mutant
0 cDNA pEL0-N/X was introduced into the HSV-1 genome by
homologous recombination to generate a recombinant herpesvirus
(vEL0-N/X) that directs the synthesis of ICP0-N/X protein during the
course of an infection. The recombinant virus vEL0-TIF, which directs the synthesis of ICP0-TIF, was constructed in a similar fashion. The sequence arrangements of the
0 loci of these viruses were verified by Southern blot analysis and DNA sequencing (data not shown).
0 cDNA virus vCPc0 (Fig.
5). The average size of a plaque
generated by vEL0-N/X was similar to that of the
0 deletion virus
dl1403 (Fig. 5). This result suggested that deletion of the
NH2-terminal acidic domain of ICP0 results in defects in
the growth of HSV-1 in tissue culture. To further address the effect(s)
of deleting this region of ICP0, the growth kinetics of vEL0-N/X
relative to those of wild-type HSV-1, vCPc0, and the
0 null virus
dl1403 were examined. Vero cells were infected at an MOI of
0.01 FFU per cell (see below), and virus yields were determined at the
indicated times postinfection by titration on the ICP0-complementing
cell line L7 (55). This analysis demonstrated that vEL0-N/X
exhibits delayed growth kinetics and reduced virus yields relative to
wild-type HSV-1 or the
0 cDNA virus vCPc0 (Fig.
6); however, these defects are not as
severe as those exhibited by the
0 deletion virus
dl1403 (Fig. 6). Because vEL0-N/X has a high FFU/PFU ratio
(Table 1) and exhibits growth defects on
both Vero and L7 cells, the number of virus particles yielded by cells
infected with this virus may be underrepresented in Fig. 6 by
approximately 8- to 10-fold. Consistent with the MOI-dependent growth
of
0 mutant viruses (61), vEL0-N/X exhibited nearly
wild-type growth kinetics and yields in high-MOI infections (data not
shown). The growth kinetics of vEL0-TIF at low MOIs were intermediate
between what was seen with vEL0-TIF and with wild-type HSV-1 (Fig. 6).
Thus, the NH2 terminus of ICP0 is important for the growth
of HSV-1 in low-MOI infections.
|
|
|
0
cDNA to create vEL0-NXR. This virus directs the synthesis of wild-type ICP0 from an
0 cDNA. The sequence arrangements of the
0 loci of
vEL0-NXR were verified by Southern blot analysis, and restoration of
the DNA encoding the wild-type acidic ICP0 NH2 terminus was confirmed by PCR and cycle sequencing (data not shown). Analysis of the
growth of this recombinant in low-MOI infections demonstrated that this
virus yielded wild-type levels of virus at 10 and 24 h
postinfection (data not shown). Thus, the growth defects of vEL0-N/X
arise only from deletion of ICP0 aa 3 to 104.
To further address the growth defects of vEL0-N/X, Western blot
analysis was performed to determine the abundance of ICP0-N/X in
infected cells (Fig. 7). ICP0-N/X
accumulated to wild-type levels in cells infected with vEL0-N/X (Fig.
7). Thus, the delayed growth kinetics and reduced virus yields of
vEL0-N/X cannot be attributed to defects in the accumulation of this
protein. Subsequent analysis of the abundance of representative
proteins from each of the three major temporal classes of HSV genes
(
,
, and
) demonstrated that the essential
regulatory
protein ICP4 accumulates to wild-type levels in cells infected with
vEL0-N/X. However, the abundance of ICP27 and
/
proteins gB and
VP5 was reduced (Fig. 7). These findings are consistent with the
intermediate growth defects of vEL0-N/X relative to wild-type
HSV-1 and the
0 deletion virus dl1403, as the levels of
ICP27, gB, and VP5 in cells infected with dl1403 were
lower than those in cells infected with vEL0-N/X (Fig. 7).
|
TIF-AD to ICP0 aa 105 to 775 (ICP0-TIF) partially compensated for deletion of the ICP0 acidic
NH2 terminus (Fig. 3 and 6). As another measure of ICP0-TIF function, the FFU/PFU ratio of this virus was determined because the
ICP0 NH2-terminal deletion virus vEL0-N/X exhibited
high FFU/PFU ratios (see below). vEL0-TIF exhibited an intermediate
FFU/PFU ratio relative to those of wild-type HSV-1 and vEL0-N/X (Table 1). Thus, the
TIF-AD can partially compensate for deletion of the
NH2 terminus in both transfected and infected cells (Fig. 3
and 6; Table 1).
Analysis of the distribution pattern of ICP0-N/X in infected cell
nuclei demonstrated that it differed from that of wild-type ICP0 (Fig.
8). Vero cells were infected with
wild-type HSV-1 or vEL0-N/X at a low MOI, and ICP0 was detected by
indirect immunofluorescence at 8 h postinfection as described in
Materials and Methods. Unlike wild-type ICP0, which accumulates as
large punctate bodies, the immunofluorescence pattern of ICP0-N/X was
more finely dispersed in the nuclei of infected cells (Fig. 8). Next,
we asked whether the altered immunofluorescence pattern of ICP0-N/X
represented an intrinsic property of this protein, or if it was a
result of altered protein-protein interaction(s) between ICP0-N/X and
an infected cell protein(s). To address this question, the distribution patterns of ICP0 and ICP0-N/X, in the absence of other virus-specified proteins, were determined in transfected Vero cells (Fig. 8). In
transfected cells, ICP0 is localized to characteristic doughnut-like structures whereas ICP0-N/X is more finely dispersed in smaller intranuclear bodies (Fig. 8C and D).
|
ICP0-N/X is a dominant negative protein.
The growth of
recombinant herpesviruses with deleterious mutations in the
0 gene
can be complemented in L7 cells (55), which express ICP0
under the control of its endogenous promoter/regulatory sequences.
However, vEL0-N/X exhibited a small-plaque phenotype when grown on
either Vero (Fig. 5) or L7 (data not shown) cells. This finding
suggested that ICP0-N/X may be a dominant negative inhibitor of
wild-type ICP0. To test this hypothesis, the FFU/PFU ratios for
wild-type HSV-1, vCPc0, vEL0-N/X, vEL0-NXR, and the
0 deletion virus
dl1403 were determined on Vero and L7 cells. As determined
here, the FFU/PFU ratio is a measure of the efficiency with which a
virus can infect a cell and initiate the synthesis of immediate-early
proteins relative to its ability to complete the lytic virus life
cycle.
0 mutant viruses have previously been shown to have high
FFU/PFU ratios in noncomplementing cell lines (61).
Consistent with these findings, our analysis demonstrated that the ICP0
deletion virus dl1403 has a very high FFU/PFU ratio in Vero
cells and a nearly wild-type FFU/PFU ratio in L7 cells (Table 1). The
FFU/PFU ratio of vEL0-N/X, however, was found to be significantly
higher than those of wild-type HSV-1, vCPc0, and the repaired control
virus vEL0-N/X in both Vero and L7 cells (Table 1). These data suggest
a dominant negative phenotype for ICP0-N/X.
4 promoter. Consistent with previous results, ICP0
activated reporter gene expression whereas ICP0-N/X was less effective
at activation of the
-gene promoter reporter (Fig.
9). Coexpression of ICP0 and ICP0-N/X led
to a significant reduction in reporter gene expression (Fig. 9). This
effect did not result from promoter competition, as no evidence of
competition was observed in cells transfected with equivalent amounts
(2 µg) of plasmids directing the expression of wild-type ICP0 (Fig.
9). Thus, ICP0-N/X is a dominant negative inhibitor of ICP0 in
transfected cells.
|
0-N18) confirmed that the
pattern of ICP0 was altered in the presence of ICP0-N/X (compare Fig.
8C and E).
Previous evidence suggests that ICP0 forms oligomers in transfected and
infected cells (5, 42). Thus, the formation of oligomers
containing mutant and wild-type forms of ICP0 could account for the
dominance of ICP0-N/X. This hypothesis is supported by the existence of
at least one oligomerization domain within ICP0 (10, 42, 67)
and our observation that ICP0-N/X appears to alter the intranuclear
distribution of wild-type ICP0 (Fig. 8). Therefore, we determined
whether wild-type ICP0 and ICP0-N/X form hetero-oligomers in infected
cells (Fig. 10). Vero cells were infected at an MOI of 5 with wild-type HSV-1, vEL0-N/X, or both viruses. At 7 h postinfection, lysates were prepared, ICP0 and ICP0-N/X were immunoprecipitated with antibodies that recognize both
proteins (CLU7) or only ICP0 (
0-N18), and the immunoprecipitates were subjected to Western blot analysis using the rabbit polyclonal antibody CLU7. As predicted, the
0-N18 antibody immunoprecipitated wild-type ICP0 exclusively, as this antibody failed to recognize ICP0-N/X (because the interacting epitope was deleted) in cell extracts that did not contain wild-type ICP0 (Fig. 10). However, antibody
0-N18 immunoprecipitated ICP0-N/X from infected-cell lysates containing both ICP0 and ICP0-N/X (Fig. 10). These data reveal
that ICP0-N/X oligomerizes with wild-type ICP0 and that deletion of the
ICP0 NH2 terminus does not impair oligomerization of the
protein. This finding further demonstrates that ICP0 forms oligomers in infected cells and supports the conclusion that ICP0 function is dependent on oligomerization during the lytic life cycle.
|
| |
DISCUSSION |
|---|
|
|
|---|
ICP0 is an immediate-early virus regulatory protein that functions
as a promiscuous activator of gene expression during the HSV-1 life
cycle (4, 6, 7, 15, 17, 19). This report reveals a role for
the acidic NH2 terminus of ICP0 in the activation of gene
expression from HSV-1
-gene promoters. The data presented here also
suggest that ICP0 possesses more than one transcriptional activation
domain. They also demonstrate that the NH2-terminal deletion mutant ICP0-N/X is a dominant negative inhibitor of ICP0's activation function and that dominance results from the formation of
hetero-oligomers. These data support the premise that ICP0 functions as
an oligomer in infected cells.
The mechanism(s) underlying ICP0 function remains undefined. Recent data, however, suggest that it acts at the level of transcription (32). ICP0 does not appear to possess any sequence-specific DNA binding activity and thus is unlikely to recognize specific elements within virus gene regulatory sequences. The possibility does exist, however, that ICP0 acts as a coactivator or adapter (1) by interacting with other sequence-specific DNA binding proteins and/or ubiquitous components of the basal transcription machinery. ICP0 interacts with and acts synergistically with ICP4, the major HSV-1 regulatory protein, to mediate the activation of virus gene expression (6, 7, 15, 17, 19, 46, 67, 69).
Transient expression analysis of ICP0 mutants indicates that the carboxy terminus contains a transcriptional activation domain (4, 6, 7, 15, 17, 19). However, the possibility that mutations within this region of ICP0 result in the loss of reporter gene expression by altering the protein's ability to oligomerize and/or interact with another protein(s) is suggested by the proximity of the major ICP0 oligomerization domain to the carboxy terminus (42). Mutations that disrupt the three-dimensional structure of ICP0, or its intracellular localization, could also result in the loss of ICP0 function. To exclude these possibilities, we performed experiments to identify regions of ICP0 capable of activating gene expression in S. cerevisiae.
These studies demonstrated that the acidic NH2 terminus of ICP0 can act as a transcriptional activation domain. Our results were generated by using proteins containing the NH2 terminus of ICP0 fused to either the GAL4-BD or the bacterial LexA protein and yeast strains containing the appropriate target promoters. Thus, the possibility that our findings represent artifacts resulting from the generation of artificial transcriptional activators or the use of a specific promoter context is unlikely. Moreover, overproduction of fusion proteins containing the ICP0 NH2-terminal region resulted in squelching (25) (data not shown), a finding consistent with data obtained using other transcriptional activators (reference 25 and references therein).
The approach taken here to identify transcriptional activation domains within ICP0 is not without complications. For example, many of the GAL4-BD-ICP0 fusion proteins that contained the carboxy terminus of ICP0 failed to accumulate to detectable levels in yeast. Another complication is that fusion with a DNA binding domain might alter the structure of ICP0 in a way that inactivates it. This possibility became apparent when we attempted to perform similar experiments with mammalian cells. None of the GAL4-BD-ICP0 fusion proteins was able to activate a target promoter containing GAL4 DNA binding sites. A third complication involved the failure of GAL4-BD-ICP0 fusion proteins containing aa 1 to 105 or 1 to 212 of ICP0 to localize to the nucleus despite the presence of a functional nuclear localization signal within the GAL4-BD. This aberrant localization could explain the inability of these proteins to activate transcription from the G5-TK promoter in mammalian cells (Fig. 2).
While the data described above suggest a role for the acidic NH2 terminus of ICP0 in the activation of transcription, they also underscore the potential drawbacks in studying fusion proteins. Therefore, we deleted the NH2 terminus of ICP0 and tested the effects of this change to the protein in transient expression assays and in the context of the virus genome. Our findings demonstrate that this domain specifically enhances the activation of immediate-early virus gene promoters by ICP0. This effect did not result from reduced accumulation of ICP0-N/X (Fig. 4), nor did it result from a gross structural alteration in ICP0-N/X, as it directed wild-type levels of reporter gene expression from the HSV-1 TK and gC promoters (Fig. 3).
Postulating that the acidic nature of the NH2 terminus was
responsible for activation, we asked whether the
TIF-AD could functionally substitute for this domain of ICP0. Our results suggest that the
TIF-AD can substitute for the ICP0 NH2
terminus, as the ICP0-TIF fusion protein activated all of the HSV-1
-gene promoters examined in this study to nearly wild-type levels
and a virus expressing this fusion protein replicated with
near-wild-type kinetics (Fig. 3 and 6). Restoration of activation did
not result just from the presence of the additional amino acids of the
TIF-AD, as a stuffer peptide containing aa 761 to 861 of E. coli
-galactosidase failed to restore activity. Collectively,
these data support the following conclusions. (i) The NH2
terminus of ICP0 is a transcriptional activation domain. (ii) ICP0
contains more than one transcriptional activation domain, as ICP0-N/X
activates at least one
and one
HSV-1 promoter, yet is defective
in the activation of transcription from four
promoters. (iii) The
acidic NH2 terminus of ICP0 is involved in the activation
of transcription in a promoter-specific fashion.
To address the role of the ICP0 NH2 terminus in the context
of the virus life cycle, a recombinant herpesvirus which directs the
synthesis of ICP0-N/X was generated. This virus exhibited growth
defects characteristic of other mutant viruses lacking functional ICP0.
Specifically, vEL0-N/X formed small plaques in Vero cell monolayers,
exhibited MOI-dependent growth, and had a high FFU/PFU ratio. However,
these defects were less severe than those of the
0 deletion virus
dl1403. The growth and replication defects of vEL0-N/X were
not caused by low abundance of ICP0-N/X, as this protein accumulated to
wild-type levels in infected cells (Fig. 7), although the intranuclear
localization of this mutant form of ICP0 was frequently aberrant. The
salient difference between ICP0 and ICP0-N/X was in the distribution
patterns of these two proteins: the ICP0-NX protein was more diffuse in
its distribution within the nuclei of transfected and infected cells.
The growth and replication defects of
0 mutant viruses, such as
dl1403, are complemented in L7 cells (55).
However, unlike dl1403 and several other
0 mutants
(38), vEL0-N/X exhibits a small-plaque phenotype and high
FFU/PFU ratios in L7 cells (Fig. 5 and Table 1). These data suggest
that ICP0-N/X is a dominant negative mutant, a conclusion supported by
the following observations: (i) in transient expression assays,
ICP0-N/X inhibited the activation of reporter gene expression by
wild-type ICP0 (Fig. 9), and (ii) ICP0-N/X altered the intranuclear
localization of wild-type ICP0 (Fig. 8). Formation of hetero-oligomers
between the two proteins might result in the observed effects. In cells
coinfected with HSV-1 strain 17 and vEL0-N/X, both proteins were
immunoprecipitated with an antibody that recognizes ICP0 but fails to
bind ICP0-N/X (Fig. 10). This result was also obtained in
cotransfection experiments (data not shown). These data provide the
first clear evidence suggesting that (i) no other virus-specified
protein(s) is required for ICP0 oligomerization and (ii) ICP0 functions
as an oligomer in infected cells.
The results presented here define the acidic NH2-terminal
region of ICP0 as a transcriptional activation domain. They also suggest that ICP0 must contain other transcriptional activation domains. Our findings do not define whether ICP0 activates
transcription directly or indirectly. However, the observation that
ICP0 interacts with and/or alters the activity of cyclin D3
(33), eEF1B
(32), a DNA-dependent protein
kinase (35), and a ubiquitin-specific protease
(21) may suggest that ICP0 activates transcription indirectly. Our results indicate that ICP0 can also affect
transcription through an acidic transcriptional activation domain. The
function of this activation domain is not redundant, as defects
resulting from its deletion were not compensated for by other
transactivation domains within this protein. Future experiments will be
required to more finely map this activation domain and to identify the other transactivation domains within ICP0 as well as the factors that
bring ICP0 to gene regulatory regions or otherwise allow it to function
as an activator.
| |
ACKNOWLEDGMENT |
|---|
This study was supported by Public Health Service grant AI-33952 to Saul J. Silverstein.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology and College of Physicians and Surgeons, Columbia University, New York, NY 10032. Phone: (212) 305-8149. Fax: (212) 305-5106. E-mail: sjs6{at}columbia.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Barlev, N.,
R. Candau,
L. Wang,
P. Darpino,
N. Silverman, and S. L. Berger.
1995.
Characterization of physical interactions of the putative transcriptional adaptor, ADA2, with acidic activation domains and TATA-binding protein.
J. Biol. Chem.
270:19337-19344 |
| 2. |
Bohenzky, R. A.,
A. G. Papavassiliou,
I. H. Gelman, and S. Silverstein.
1993.
Identification of a promoter mapping within the reiterated sequences that flank the herpes simplex virus type 1 UL region.
J. Virol.
67:632-642 |
| 3. | Brasier, A. R., J. E. Tate, and J. F. Habener. 1989. Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines. BioTechniques 7:1116-1122[Medline]. |
| 4. |
Cai, W., and P. A. Schaffer.
1989.
Herpes simplex virus type 1 ICP0 plays a critical role in the de novo synthesis of infectious virus following transfection of viral DNA.
J. Virol.
63:4579-4589 |
| 5. |
Chen, J.,
C. Panagiotidis, and S. Silverstein.
1992.
Multimerization of ICP0, a herpes simplex virus immediate-early protein.
J. Virol.
66:5598-5602 |
| 6. |
Chen, J., and S. Silverstein.
1992.
Herpes simplex viruses with mutations in the gene encoding ICP0 are defective in gene expression.
J. Virol.
66:2916-2927 |
| 7. | Chen, J., X. Zhu, and S. Silverstein. 1991. Mutational analysis of the sequence encoding ICP0 from herpes simplex virus type-1. Virology 180:207-220[Medline]. |
| 8. |
Chevray, P. M., and D. Nathans.
1992.
Protein interaction cloning in yeast: identification of mammalian proteins that react with the leucine zipper of Jun.
Proc. Natl. Acad. Sci. USA
89:5789-5793 |
| 9. |
Chien, C. T.,
P. L. Bartel,
R. Sternglanz, and S. Fields.
1991.
The two-hybrid system: a method to identify and clone genes for proteins that interact with a protein of interest.
Proc. Natl. Acad. Sci. USA
88:9578-9582 |
| 10. |
Ciufo, D. M.,
M. A. Mullen, and G. S. Hayward.
1994.
Identification of a dimerization domain in the C-terminal segment of the IE110 transactivator protein from herpes simplex virus.
J. Virol.
68:3267-3282 |
| 11. |
DeLuca, N. A.,
A. M. McCarthy, and P. A. Schaffer.
1985.
Isolation and characterization of deletion mutants of herpes simplex virus type 1 in the gene encoding immediate-early regulatory protein ICP4.
J. Virol.
56:558-570 |
| 12. |
Dixon, R. F., and P. A. Schaffer.
1980.
Fine structure mapping and functional analysis of temperature-sensitive mutants in the gene encoding the herpes simplex virus type 1 immediate-early protein VP175.
J. Virol.
36:189-203 |
| 13. |
DuBridge, R. B.,
P. Tang,
H. C. Hsia,
L. Phaik-Mooi,
J. H. Miller, and M. P. Calos.
1987.
Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system.
Mol. Cell. Biol.
7:379-387 |
| 14. | Everett, R., P. O'Hare, D. O'Rourke, P. Barlow, and A. Orr. 1995. Point mutations in the herpes simplex virus type 1 Vmw110 RING finger helix affect activation of gene expression, viral growth, and interaction with PML-containing nuclear structures. J. Virol. 69:7339-7344[Abstract]. |
| 15. | Everett, R. D. 1988. Analysis of the functional domains of herpes simplex virus type 1 immediate-early polypeptide Vmw110. J. Mol. Biol. 202:87-96[Medline]. |
| 16. |
Everett, R. D.
1989.
Construction and characterization of herpes simplex virus type 1 mutants with defined lesions in immediate early gene 1.
J. Gen. Virol.
70:1185-1202 |
| 17. | Everett, R. D. 1987. A detailed mutational analysis of VMW110, a trans-acting transcriptional activator encoded by herpes simplex virus type 1. EMBO J. 6:2069-2076[Medline]. |
| 18. |
Everett, R. D.
1986.
The products of herpes simplex virus type 1 (HSV-1) immediate early genes 1, 2, and 3 can activate HSV-1 gene expression in trans.
J. Gen. Virol.
67:2507-2513 |
| 19. | Everett, R. D. 1984. Trans-activation of transcription by herpes virus products: requirement for two HSV-1 immediate-early polypeptides for maximum activity. EMBO J. 3:3135-3141[Medline]. |
| 20. | Everett, R. D., P. Barlow, A. Milner, B. Luisi, A. Orr, G. Hope, and D. Lyon. 1993. A novel arrangement of zinc-binding residues and secondary structure in the C3HC4 motif of an alpha herpes virus protein family. J. Mol. Biol. 234:1038-1047[Medline]. |
| 21. | Everett, R. D., M. Meredith, A. Orr, A. Cross, M. Kathoria, and J. Parkinson. 1997. A novel ubiquitin-specific protease is dynamically associated with the PML domain and binds to a herpes virus regulatory protein. EMBO J. 16:566-577[Medline]. |
| 22. | Gelman, I. H., and S. Silverstein. 1986. Coordinate regulation of herpes simplex virus gene expression is mediated by the functional interaction of two immediate early gene products. J. Mol. Biol. 191:395-409[Medline]. |
| 23. |
Gelman, I. H., and S. Silverstein.
1987.
Herpes simplex virus immediate-early promoters are responsive to virus and cell trans-acting factors.
J. Virol.
61:2286-2296 |
| 24. |
Gelman, I. H., and S. Silverstein.
1985.
Identification of immediate early genes from herpes simplex virus that transactivate the virus thymidine kinase gene.
Proc. Natl. Acad. Sci. USA
82:5265-5269 |
| 25. | Gill, G., and M. Ptashne. 1988. Negative effect of the transcriptional activator GAL4. Nature 344:721-724. |
| 26. |
Goldin, A.,
R. Sandri-Goldin,
M. Levine, and J. Glorioso.
1981.
Cloning of herpes simplex virus type 1 sequences representing the whole genome.
J. Virol.
38:50-58 |
| 27. | Guthrie, C., and G. Fink. 1991. Guide to yeast genetics and molecular biology, vol. 194. Academic Press, Inc., Pasadena, Calif. |
| 28. |
Hardy, W. R., and R. M. Sandri-Goldin.
1994.
Herpes simplex virus inhibits host cell splicing, and regulatory protein ICP27 is required for this effect.
J. Virol.
68:7790-7799 |
| 29. | Harper, J., G. Adami, N. Wei, K. Keyomarsi, and S. Elledge. 1993. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75:805-816[Medline]. |
| 30. |
Honess, R. W., and B. Roizman.
1974.
Regulation of herpesvirus macromolecular synthesis. I. Cascade regulation of the synthesis of three groups of viral proteins.
J. Virol.
14:8-19 |
| 31. |
Honess, R. W., and B. Roizman.
1975.
Regulation of herpesvirus macromolecular synthesis: sequential transition of polypeptide synthesis requires functional viral polypeptides.
Proc. Natl. Acad. Sci. USA
72:1276-1280 |
| 32. | Jordan, R., and P. Schaffer. 1997. Activation of gene expression by herpes simplex virus type 1 ICP0 occurs at the level of mRNA synthesis. J. Virol. 71:6850-6862[Abstract]. |
| 33. | Kawaguchi, Y., C. Van Sant, and B. Roizman. 1997. Herpes simplex virus 1 alpha regulatory protein ICP0 interacts with and stabilizes the cell cycle regulator cyclin D3. J. Virol. 71:7328-7336[Abstract]. |
| 34. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline]. |
| 35. | Lees-Miller, S., M. Long, M. Kilvert, V. Lam, S. Rice, and C. Spencer. 1996. Attenuation of DNA-dependent protein kinase activity and its catalytic subunit by the herpes simplex virus type 1 transactivator ICP0. J. Virol. 70:7471-7477[Abstract]. |
| 36. |
Leopardi, R.,
N. Michael, and B. Roizman.
1995.
Repression of the herpes simplex virus type 1 4 gene by its gene product (ICP4) within the context of the viral genome is conditioned by the distance and stereoaxial alignment of the ICP4 DNA binding site relative to the TATA box.
J. Virol.
69:3042-3048[Abstract].
|
| 37. |
Lium, E. K.,
C. A. Panagiotidis,
X. Wen, and S. J. Silverstein.
1996.
Repression of the 0 gene by ICP4 during a productive herpes simplex virus infection.
J. Virol.
70:3488-3496[Abstract].
|
| 38. |
Lium, E. K., and S. J. Silverstein.
1997.
Mutational analysis of the herpes simplex virus type 1 ICP0 C3HC4 zinc ring finger reveals a requirement for ICP0 in the expression of the essential 27 gene.
J. Virol.
71:8602-8614[Abstract].
|
| 39. | Marsh, J. L., M. Erfle, and E. J. Wykes. 1984. The pIC plasmid and phage vectors with versatile cloning sites for recombinant selection by insertional inactivation. Gene 32:481-485[Medline]. |
| 40. |
McCarthy, A. M.,
L. McMahan, and P. A. Schaffer.
1989.
Herpes simplex virus type 1 ICP27 deletion mutants exhibit altered patterns of transcription and are DNA deficient.
J. Virol.
63:18-27 |
| 41. |
McMahan, L., and P. A. Schaffer.
1990.
Repressing and enhancing functions of the herpes simplex virus regulatory protein ICP27 map to C-terminal regions and are required to modulate viral gene expression very early in infection.
J. Virol.
64:3471-3485 |
| 42. | Meredith, M., A. Orr, M. Elliott, and R. Everett. 1995. Separation of sequence requirements for HSV-1 Vmw110 multimerisation and interaction with a 135-kDa cellular protein. Virology 209:174-187[Medline]. |
| 43. |
Mullen, M.,
D. Ciufo, and G. Hayward.
1994.
Mapping of intracellular localization domains and evidence for colocalization interactions between the IE110 and IE175 nuclear transactivator proteins of herpes simplex virus.
J. Virol.
68:3250-3266 |
| 44. |
O'Hare, P., and G. S. Hayward.
1985.
Three trans-acting regulatory proteins of herpes simplex virus modulate immediate-early gene expression in a pathway involving positive and negative feedback regulation.
J. Virol.
56:723-733 |
| 45. | Panagiotidis, C. A., S. C. Huang, and E. S. Canellakis. 1995. Relationship of the expression of the S20 and L34 ribosomal proteins to polyamine biosynthesis in Escherichia coli. Int. J. Biochem. Cell. Biol. 27:157-168[Medline]. |
| 46. | Panagiotidis, C. A., E. K. Lium, and S. J. Silverstein. 1997. Physical and functional interactions between herpes simplex virus immediate-early proteins ICP4 and ICP27. J. Virol. 71:1547-1557[Abstract]. |
| 47. |
Phelan, A.,
M. Carmo-Fonseca,
J. McLauchlan,
A. I. Lamond, and J. B. Clements.
1993.
A herpes simplex virus type 1 immediate-early gene product, IE63, regulates small nuclear ribonucleoprotein distribution.
Proc. Natl. Acad. Sci. USA
90:9056-9060 |
| 48. |
Preston, C. M.
1979.
Control of herpes simplex virus type 1 mRNA synthesis in cells infected with wild-type virus or the temperature-sensitive mutant tsK.
J. Virol.
29:275-284 |
| 49. | Ptashne, M. 1988. How eukaryotic transcriptional activators work. Nature 335:683-689[Medline]. |
| 50. |
Resnick, J.,
B. A. Boyd, and M. L. Haffey.
1989.
DNA binding by the herpes simplex virus type 1 ICP4 protein is necessary for efficient down regulation of the ICP0 promoter.
J. Virol.
63:2497-2503 |
| 51. |
Rice, S. A., and D. M. Knipe.
1988.
Gene-specific transactivation by herpes simplex virus type 1 alpha protein ICP27.
J. Virol.
62:3814-3823 |
| 52. |
Roberts, M. S.,
A. Boundy,
P. O'Hare,
M. C. Pizzorno,
D. M. Ciufo, and G. S. Hayward.
1988.
Direct correlation between a negative autoregulatory response element at the cap site of the herpes simplex virus type 1 IE175 ( 4) promoter and a specific binding site for the IE175 (ICP4) protein.
J. Virol.
62:4307-4320 |
| 53. | Roizman, B., and A. Sears. 1993. The human herpes viruses. Raven Press, New York, N.Y. |
| 54. |
Sacks, W. R.,
C. C. Greene,
D. P. Aschman, and P. A. Schaffer.
1985.
Herpes simplex virus type 1 ICP27 is an essential regulatory protein.
J. Virol.
55:796-805 |
| 55. | Samaniego, L., N. Wu, and N. A. DeLuca. 1997. The herpes simplex virus immediate-early protein ICP0 affects transcription from the viral genome and infected-cell survival in the absence of ICP4 and ICP27. J. Virol. 71:4614-4625[Abstract]. |
| 56. | Samaniego, L. A., A. L. Webb, and N. A. DeLuca. 1995. Functional interactions between herpes simplex virus immediate-early proteins during infection: gene expression as a consequence of ICP27 and different domains of ICP4. J. Virol. 69:5705-5715[Abstract]. |
| 57. |
Sandri-Goldin, R. M., and G. E. Mendoza.
1992.
A herpesvirus regulatory protein appears to act post-transcriptionally by affecting mRNA processing.
Genes Dev.
6:848-863 |
| 58. |
Showalter, S. D.,
M. Zwieg, and B. Hampar.
1981.
Monoclonal antibodies to herpes simplex virus type 1 proteins, including the immediate-early protein ICP4.
Infect. Immun.
34:684-692 |
| 59. | Smiley, J. 1980. Construction in vitro and rescue of a thymidine kinase deficient deletion mutant of herpes simplex virus. Nature 285:333-335[Medline]. |
| 60. | Soliman, T., R. Sandri-Goldin, and S. Silverstein. 1997. Shuttling of the herpes simplex virus type 1 regulatory protein ICP27 between the nucleus and cytoplasm mediates the expression of late proteins. J. Virol. 71:9188-9197[Abstract]. |
| 61. |
Stow, N. D., and E. C. Stow.
1986.
Isolation and characterization of a herpes simplex virus type 1 mutant containing a deletion within the gene encoding the immediate early polypeptide Vmw110.
J. Gen. Virol.
67:2571-2585 |
| 62. |
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354 |
| 63. |
van Zonneveld, A. J.,
S. A. Curriden, and D. J. Luskutoff.
1988.
Type 1 plasminogen activator inhibitor gene: functional analysis and glucocorticoid regulation of its promoter.
Proc. Natl. Acad. Sci. USA
85:5525-5529 |
| 64. | Watson, R. J., and J. B. Clements. 1980. A herpes simplex type 1 function continuously required for early and late virus RNA synthesis. Nature 285:329-330[Medline]. |
| 65. |
Wigler, M.,
A. Pellicer,
S. Silverstein,
R. Axel,
G. Urlaub, and L. Chasin.
1979.
DNA-mediated transfer of the adenine phosphoribosyltransferase locus into mammalian cells.
Proc. Natl. Acad. Sci. USA
76:1373-1376 |
| 66. |
Wilcox, K. W.,
A. Kohn,
E. Sklyanskaya, and B. Roizman.
1980.
Herpes simplex virus phosphoproteins. I. Phosphate cycles on and off some viral polypeptides and can alter their affinity for DNA.
J. Virol.
33:167-182 |
| 67. |
Yao, F., and P. A. Schaffer.
1994.
Physical interaction between the herpes simplex virus type 1 immediate-early regulatory proteins ICP0 and ICP4.
J. Virol.
68:8158-8168 |
| 68. |
Zhu, X.,
J. Chen, and S. Silverstein.
1991.
Isolation and characterization of a functional cDNA encoding ICP0 from herpes simplex virus type 1.
J. Virol.
65:957-960 |
| 69. |
Zhu, Z.,
W. Cai, and P. A. Schaffer.
1994.
Cooperativity among herpes simplex virus type 1 immediate-early regulatory proteins: ICP4 and ICP27 affect the intracellular localization of ICP0.
J. Virol.
68:3027-3040 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»