J Virol, January 1998, p. 830-836, Vol. 72, No. 1
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
CCR5 Expression Correlates with Susceptibility of
Maturing Monocytes to Human Immunodeficiency Virus Type 1 Infection
Hassan M.
Naif,1,*
Shan
Li,1
Mohammed
Alali,1
Andrew
Sloane,1
Lijun
Wu,2
Mark
Kelly,3
Garry
Lynch,1
Andrew
Lloyd,3 and
Anthony
L.
Cunningham1
Molecular Pathogenesis Laboratory, Centre for
Virus Research, Westmead Institutes of Health Research, The University
of Sydney, and National Centre for HIV Virology
Research,1
School of Pathology, The
University of New South Wales, Sydney,3
Australia, and
LeukoSite Inc., Cambridge, Massachusetts
021422
Received 13 June 1997/Accepted 24 September 1997
 |
ABSTRACT |
The chemokine receptor CCR5 and to a lesser extent CCR3 and CCR2b
have been shown to serve as coreceptors for human immunodeficiency virus type 1 (HIV-1) entry into blood- or tissue-derived macrophages. Therefore, we examined the expression of the chemokine receptors CCR1,
CCR2b, CCR3, CCR5, and CXCR4 as RNAs or as membrane-expressed antigens
in monocytes maturing into macrophages and correlated these results
with the susceptibility of macrophages to HIV-1 infection, as measured
by their concentrations of extracellular p24 antigen and levels of
intracellular HIV DNA by quantitative PCR. There was little change in
levels of CCR1, CCR2b, and CCR5 RNAs. CCR3 RNA and surface antigen were
undetectable throughout maturation of adherent monocytes over 10 days.
CXCR4 RNA and membrane antigen were strongly expressed in newly
adherent monocytes, but their levels declined at day 7. The amounts of
CCR5 RNA remained stable, but the amounts of CCR5 antigen increased
from undetectable to peak levels at day 7 and then declined slightly at
day 10. Levels of susceptibility to laboratory (HIV-1BaL)
and clinical strains of HIV-1 showed parallel kinetics, peaking at day
7 and then decreasing at days 10 to 14. The concordance of levels of HIV DNA and p24 antigen suggested that the changes in susceptibility with monocyte maturation were at or immediately after entry and correlated well with CCR5 expression and inversely with CXCR4 expression.
| |
TEXT |
The chemokine receptor CCR5 was
recently identified as the major coreceptor for the entry of
non-syncytium-inducing (NSI) human immunodeficiency virus (HIV) strains
into primary CD4 lymphocytes and macrophages but not into T-cell lines
(1, 11, 15). These data were supported by the relative
refractoriness to HIV infection of CD4 lymphocytes from patients who
are homozygous for the CCR5 
32 mutation (10, 21, 27, 39).
In contrast, T-cell-line-tropic strains of HIV-1 use the chemokine
receptor CXCR4 as an entry coreceptor (17) while dual-tropic
strains can use both CCR5 and CXCR4 (14, 43). These findings
correlate with inhibition of infection of T-cell lines with SI isolates by the natural ligand for CXCR4, SDF1 (3, 33), and also by the inhibition of infection of primary lymphocytes or macrophages with
NSI HIV strains by the 
-chemokines RANTES, MIP1, and MIP1
, all
of which bind to CCR5 (8).
HIV binds to CCR5 and CXCR4 via gp120, especially its V3 loop, which
has been previously described to determine lymphocyte/macrophage tropism (6, 22, 42). Studies of chimeric chemokine receptors suggest that macrophage and dual-tropic HIV strains may differ in their
relative affinities for the amino-terminal and extracellular domains of
CCR5 (2, 12, 37). SI strains appear to bind to the
extracellular domains of CXCR4. In addition, different strains of HIV
appear to bind to different amino acids within the extracellular
domains of CCR5 (13). Binding of gp120 to CCR5 is enhanced
by prior binding to CD4 (46, 47). Furthermore, laboratory-adapted strains appear to be able to bind to CD4 and thence
probably to chemokine receptors with higher affinities than clinical
strains (25).
However, some clinical or laboratory-adapted HIV strains, including the
dual-tropic strain 89.6, also use other chemokine coreceptors, either
CCR3, CCR2b (5, 7, 14), or other orphan coreceptors, in
addition to CCR5 for entry into primary T lymphocytes and blood-derived
macrophages.
In addition, the chemokine receptors used during HIV entry of
blood-derived and some tissue macrophages differ. For example CCR3
appears to be as important as CCR5 for entry into microglial cells
(20).
The role of CCR5 and to a lesser extent CCR3 and CCR2b as HIV
coreceptors for infection of blood-derived macrophages by most clinical
and laboratory strains raises the question of whether differences in
the susceptibilities of maturing monocytes to HIV-1 infection are
determined by differential levels of expression of this coreceptor.
Therefore, we tested the hypothesis that increasing permissiveness of
differentiating monocytes to productive infection with M-tropic HIV-1
is related to changes in levels of expression of CCR5 or other
chemokine receptors such as CCR1, CCR2b, CCR3, and CXCR4.
Heparinized peripheral blood was obtained from healthy HIV-seronegative
donors. Peripheral blood mononuclear cells (PBMCs) were separated from
blood by density gradient sedimentation on Ficoll-Paque (Pharmacia,
Uppsala, Sweden). Monocytes were separated by countercurrent
elutriation as previously described (30). The fractions
containing monocytes were collected, and contaminating lymphocytes were
depleted by complement-dependent lysis with monoclonal anti-CD3
antibody (OKT3; Ortho Diagnostics, Raritan, N.J.). Residual contamination with T lymphocytes in this population was <1% as determined by flow cytometry with anti-CD3 monoclonal antibody. More
than 96% of the cells were nonspecific esterase positive. Monocytes
were either used immediately after isolation (day 0) or cultured on
24-well tissue culture plates for 1, 3, 5, 7, and 10 days at 37°C and
5% CO2. Cells were then used for infection with NSI HIV-1
isolates, RNA extraction, or flow cytometry.
Cells were infected with low-number-passage clinical isolate WM1101 and
the laboratory macrophage-tropic strain HIV-1BaL, which was
obtained from the National Institutes of Health AIDS Research and
Reference Reagent Program. Infectivities of HIV isolates were
quantified by calculation of their 50% tissue culture infective doses
in phytohemagglutinin-stimulated PBMCs. Monocytes were inoculated with
cell-free HIV isolates at 105 cpm of reverse transcriptase
(RT) activity per ml (105 tissue culture infective doses
per ml on PBMCs and at a multiplicity of infection of 0.025/cell) and
allowed to adsorb for 4 h before complete aspiration of medium,
washing, and addition of fresh medium. Cultures were replenished with
fresh medium every three days, and culture supernatants were stored for
quantification of HIV p24 antigen with an enzyme-linked immunosorbent
assay kit (Organon Teknika, Sydney, Australia). The limit of detection
of HIV p24 antigen was 12 pg/ml. Virus inocula which were used in DNA
experiments were first filtered through a 0.22-µm-pore-size filter
(Millex-GS; Millipore, Bedford, Mass.) and then treated with DNase (20 µg/ml) for 1 h at room temperature in the presence of 10 mM
MgCl2 to decontaminate the inoculum of HIV-1 DNA. Cell cultures were treated with zidovudine (20 mM) for 30 min at 37°C to
control for de novo DNA synthesis. Cell lysate preparation and PCR
conditions were as previously described (30). Primers M667
(49) and gag1 (30) were used to
amplify a 320-bp region extending from the R region within the 5' long
terminal repeat to the gag region, representing full-length
or nearly full-length HIV-1 cDNA. Primers M667 and AA55 (49)
were also used to amplify a 140-bp region flanking the R and U3 regions
of the 5' long terminal repeat, representing the sequence of the
initiation product of HIV reverse transcription. Hot PCR was used to
increase sensitivity where M667 was 5' end labeled with
[
32P]ATP, and then the modified M667 was added to the
PCR mixture at a ratio to cold primer of 1:2. Samples were subjected to
30 cycles of amplification as follows: 1 min at 95°C, 2 min at
60°C, and 3 min at 72°C with a final extension at 72°C for 7 min.
Concurrent reactions were also performed with primers PCO3 and PCO4
(38) to amplify a 110-bp DNA fragment of the human
-globin gene to ensure that equivalent amounts of DNA were used in
each sample reaction. HIV DNA standards were prepared from 8E5 cells
(18), containing one integrated copy of HIV-1 DNA per cell,
and PBMCs were used to optimize cell number. Amplified products were
run on an agarose gel, dried, exposed to X-ray film for 6 h, and
autoradiographed.
To study the RNA expression of CCR1, CCR2b, CCR3, CCR5, and CXCR4 in
differentiating monocytes (0, 1, 3, and 7 days postadherence), RT-PCR
was performed on these cultures with oligonucleotide primer pairs
specific for each chemokine receptor. Briefly, total RNA was isolated
with Trizol reagents and 2 µg was used for cDNA synthesis with
Superscript II RNase H-reverse transcriptase (Life
Technologies/Gibco-BRL, Melbourne, Australia) and oligo(dT) primer
(Boehringer, Mannheim, Germany) at 42°C for 1 h. One-tenth of
this product was used as a template for PCR amplification with
Taq polymerase (Perkin-Elmer, Sydney, Australia). PCR was
carried out for 30 cycles at 94°C for 1 min, 55°C for 2 min, and
72°C for 2 min. The primer pairs used in RT-PCR were CCR1 (296 bp)
(sense, TGGAAACTCCAAACACCACAG; antisense,
CCCAGTCATCCTTCAACTTG) (32), CCR2b (351 bp)
(sense, CCAACGAGAGCGGTGAAGAAGTC; antisense,
GCCAAAATAACCGATGTGATA) (48), CCR3 (539 bp)
(sense, TGACAACCTCACTAGATACAGTTG; antisense,
CTCTTCAAACAACTCTTCAGTCTC) (36), CCR5 (280 bp)
(sense, AATAATTGCAGTAGCTCTAACAGG; antisense, TTGAGTCCGTGTCACAAGCCC) (40), CXCR4 (381 bp)
(sense, TGACTCCATGAAGGAACCCTG; antisense,
CTTGGCCTCTGACTGTTGGTG) (26), and GAPDH (196 bp)
(sense, ATGGAGAAGGCTGGGGCTC; antisense,
AAGTTGTCATGGATGACCTTG) (19).
Flow cytometry was carried out to examine the cell surface expression
of CCR3, CCR5, CXCR4, and CD4 in differentiating monocytes (days 0, 1, 5, and 10 after adherence). After cells were removed from the plastic
surface with 5 mM EDTA in phosphate-buffered saline, they were washed
twice with cold fluorescence-activated cell sorter buffer containing
1% fetal bovine serum and 0.01% sodium azide in phosphate-buffered
saline and then resuspended in 50 µl of human serum and labeled with
specific antibody as previously described (29). Cells were
examined with a Becton Dickinson (Franklin Lakes, N.J.) FACScan flow
cytometer. Monoclonal antibodies to CCR3 (7B11) and CCR5 (2F9) were
obtained from LeukoSite Inc. (Cambridge, Mass.), and monoclonal
antibody to CXCR4 (12G5) (16) was purchased from R & D
Systems (Minneapolis, Minn.). Monoclonal antibody to CD4 (Q4120) was a
gift from Q. Sattentau (Inserm, Paris, France), and anti-Leu-M3 (CD14)
phycoerythrin conjugate and anti-Leu3a fluorescein isothiocyanate
conjugate were purchased from Becton Dickinson.
Monocytes differentiating into macrophages (i.e., monocyte-derived
macrophages [MDM]) over 7 days of adherence to plastic became
increasingly permissive to productive infection with a laboratory-adapted (BaL) and a clinical (NSI) strain of HIV, as shown
by levels of extracellular HIV p24 antigen (Fig.
1A) and particle-associated reverse
transcription (data not shown). A corresponding increase in HIV DNA was
also observed by using quantitative sensitive hot PCR and primers to
detect the full-length cDNAs (Fig. 1B, first gel) or the initiation
products (Fig. 1B, third gel) of HIV reverse transcription. These
results demonstrate clearly that restriction of both tropism and the
level of productive infection in fresh uncultured monocytes occurs
mainly at the level of entry (or uncoating). This confirms previous
reports from our own group and other groups demonstrating that tropism
of laboratory-adapted (34, 44) and clinical (4)
isolates increases with monocyte maturation. The use of highly
sensitive hot PCR supports the notion that this increased tropism
restricts HIV entry into monocytes rather than restricting the spread
of HIV from infected foci as a result of the occasional permissiveness
of monocytes. Furthermore, susceptibility to productive infection of
MDM reached a peak at approximately 7 days of adherence (Fig. 1).
Infection of 10- and 14-day (data not shown)-old MDM resulted in lower
levels of HIV p24 antigen (Fig. 1A) and DNA (data not shown). At day 7 the cells were also susceptible to infection with a greater number of
clinical isolates and the mean level of extracellular p24 antigen was
greatest (31).
View larger version (43K):
[in this window]
[in a new window]
|
FIG. 1.
Permissiveness to HIV-1 infection increased as monocytes
differentiated into MDM. Cells were infected with HIV-1 WM1101 primary
isolate (or HIV-1BaL [data not shown]) either immediately
after isolation (day 0 [D0]) or after culture on plastic for 1, 3, 7, and 10 days (D1, D3, D7, and D10, respectively). Replication kinetics
of HIV-1 WM1101 by cultured monocytes was measured by determining
amounts of the extracellular p24 antigen in culture supernatants (A)
with an enzyme-linked immunosorbent assay commercial kit (Organon
Teknika) and by quantitative hot PCR with 32P-labeled
primer for the detection of full-length cDNA (320 bp) (panel B, first
gel) or initiation products (140 bp) (panel B, third gel) of HIV
reverse transcription. Culture supernatants were collected 0, 3, 7, and
14 days after infection for the detection of HIV p24 antigen. DNA was
extracted from cells at 12 h and 1, 2, 3, 5, and 7 days after
infection and used in hot PCR to detect HIV DNA. -Globin DNA (110 bp) was amplified concurrently with HIV DNA, and results are shown
underneath each DNA sample (panel B, second and fourth gels). p.a.,
postadherence; AZT, zidovudine.
|
|
The expression of chemokine receptors (CCR1, CCR2b, CCR3, CCR5, and
CXCR4) in differentiating monocytes was determined by measuring the
specific levels of expression of mRNA or surface membrane antigen by
semiquantitative RT-PCR or flow cytometry, respectively. In three
different donors of blood monocytes, mRNAs for CCR1, CCR2b, CCR5, and
CXCR4 were detected in both freshly isolated monocytes and
differentiated macrophages (Fig. 2). CCR3 RNA was below the detectable level in all donors. CCR1 mRNA expression was relatively higher than that of other coreceptors and constant, irrespective of the stage of cell differentiation. CCR2b RNA expression in monocytes was variable between donors but showed a significant and
consistent decline as cell differentiation proceeded at 7 days of
adherence (Fig. 2). Whether this change is also reflected in the
production of cell surface antigen is clarified when specific monoclonal antibodies become available. The CCR5 transcript was detected in fresh monocytes, with a slight increase at day 1 of monocyte adherence, and its level then remained constant to day 7 (Fig.
2). In addition, the levels of expression of CXCR4 (fusin) RNA were
relatively high in fresh and newly adherent (day 1) monocytes but
declined significantly when cells differentiated into MDM at day 7 of
adherence (Fig. 2). Residual T-cell contamination in freshly isolated
monocytes was <1%, as determined by flow cytometry with anti-CD3
antibody, and 86% of monocytes were stained with monoclonal antibody
against CD14. The identities of all CCR transcripts were confirmed by
DNA sequencing of the PCR products (data not shown). RNA preparations
without reverse transcriptase were used in PCR analysis and shown
consistently to be negative for chemokine receptors and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) DNA (Fig. 2).
View larger version (78K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of the chemokine receptors CCR1, CCR2b, CCR3,
CCR5, and CXCR4 in maturing monocytes. Total RNAs from nonadherent
cells (day 0; lanes 0) and adherent cells at days 1, 3, and 7 (lanes 1, 3, and 7, respectively) were extracted, treated with RNase-free DNase
(Boehringer), and used in RT-PCR. Products were amplified with primer
pairs specific for each chemokine receptor or for GAPDH (see the text).
Amplified DNA fragments were visualized on ethidium bromide-stained
agarose gels under UV transillumination and photographed. To exclude
DNA contamination, mock PCRs were run in parallel without reverse
transcriptase (lanes C1) or without the cDNA template (lanes C2).
|
|
The levels of expression of CCR3, CCR5, and CXCR4 on cell surfaces at
different stages of differentiation were then examined by flow
cytometry with monoclonal antibodies against these coreceptors. The
expression of CCR5 on cell surfaces significantly increased as
monocytes matured to MDM over 1 to 7 days (Fig.
3, second row). In repeated experiments,
surface CCR5 was not detected immediately after monocyte isolation but
increased progressively from day 1 and was maximal at day 5, plateauing
until day 7, and then decreased to lower levels at days 10 to 14 of
adherence (Fig. 3, second row). This decrease in CCR5 surface
expression of MDM was also correlated with a decrease in CCR5 RNA (data
not shown) and a decrease in the susceptibility of MDM to productive
infection at the same time points (Fig. 1A). CXCR4 membrane expression
was relatively high at the early stage of monocyte maturation (days 0 to 3) and then decreased during the later stages of maturation (7 days
after adherence) (Fig. 3, third row). These results correlated well
with mRNA levels quantified by RT-PCR and Northern analysis (data not
shown). CCR3 surface antigen expression was not detectable in monocytes
or MDM (Fig. 3, first row), as was expected from the results with CCR3
mRNA. The level of CD4 expression (Fig. 3, fourth row) declined after
initial monocyte adherence and then was slowly upregulated, as
previously reported by us and others (9, 23), but it
correlated neither with permissiveness of monocytes to infection nor
with CCR5 expression. In addition, we have now examined CCR5 expression
on maturing monocytes in more than the three cases mentioned above,
verifying the results shown in Fig. 3 but also demonstrating that there
was variability in the levels of expression of CCR5 on MDM on days 3 to
5 which was quite considerable (three- to fivefold) and which was
independent of the CCR532 heterozygous states of individuals (data
not shown). Despite this variability in levels of CCR5 expression,
there was always a significant increase during maturation from an
undetectable level at day 0. Furthermore, monocyte maturation or
activation was induced with macrophage colony-stimulating factor over 3 days of culture. Surface expression of CCR5 was upregulated by 35% ± 6% (mean ± standard deviation), while CXCR4 was downregulated by
20% ± 3%, a pattern similar to that observed with differentiation by
adherence to plastic.
Therefore, the level of expression of CCR5, as a major coreceptor,
corresponded well to increasing permissiveness for infection by NSI
viruses at early stages of monocyte maturation (1 to 7 days after
adherence) and then with a decrease in productive infection at later
stages of maturation (10 to 14 days). The significance of the CXCR4
decline (which appears to be inversely proportional to the rise in
CCR5) is not yet clear. Freshly isolated monocytes express significant
levels of CXCR4 on their membranes and bind SDF1 but are still
refractory to infection with SI isolates. Therefore, it appears that
CCR5 but not CXCR4 is functional as an HIV coreceptor in blood
monocytes, perhaps because of differences in the association of CXCR4
(28) with CD4 or conformational differences in the
coreceptors of lymphocyte and monocyte membranes.
The above-described data supports the notion that increasing expression
of CCR5 antigen on monocytes maturing into macrophages may account for
at least a significant component of the inhanced susceptibility of MDM
to infection with M-tropic HIV-1 isolates. Furthermore, it has been
shown that monocyte susceptibility to HIV-1 infection increased despite
declining expression of the CD4 receptor during the first day of
adherence in blood monocytes (9, 23). However, other
chemokine receptors may also be involved in this mechanism, as a recent
study has suggested that at least one other unidentified coreceptor may
be active in MDM, especially where infection with M-tropic isolates
cannot be determined solely by utilization of CCR5 (5). As
reagents for the other coreceptors become available, similar studies of
expression on maturing monocytes will be necessary, as will
determination of the chemokine receptor utilization of the infecting
HIV strains used in such studies.
We thank the Australian National Centre for HIV Virology Research
and the National Health and Medical Research Council for great support.
We thank LeukoSite Inc. (Cambridge, Mass.) for kindly providing us with
antibodies to CCR3 and CCR5 and Q. Sattentau (Inserm) for antibody to
CD4. We also thank Claire Wolczak for the preparation of the
manuscript.
| 1.
|
Alkhatib, G.,
C. Combadiere,
C. C. Broder,
Y. Feng,
P. E. Kennedy,
P. M. Murphy, and E. A. Berger.
1996.
CC CKR5: a RANTES, MIP-, MIP- receptor as a fusion cofactor for macrophage-tropic HIV-1.
Science
272:1955-1958[Abstract].
|
| 2.
|
Atchinson, R. E.,
J. Gosling,
F. S. Monteclaro,
C. Franci,
L. Digilio,
I. F. Charo, and M. A. Goldsmith.
1996.
Multiple extracellular elements of CCR5 and HIV-1 entry: dissociation from response to chemokines.
Science
274:1924-1926[Abstract/Free Full Text].
|
| 3.
|
Bleul, C. C.,
M. Farzan,
H. Choe,
C. Parolin,
I. Clark-Lewis,
J. Sodroski, and T. A. Springer.
1996.
The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry.
Nature
382:829-833[Medline].
|
| 4.
|
Chang, J.,
H. M. Naif,
S. Li,
J. S. Sullivan,
C. M. Randle, and A. L. Cunningham.
1996.
Twin studies demonstrated a host cell genetic effect on productive HIV infection of human monocytes and macrophages in vitro.
J. Virol.
70:7792-7803[Abstract].
|
| 5.
|
Cheng-Mayer, C.,
R. Liu,
N. R. Landau, and L. Stamatatos.
1997.
Macrophage tropism of human immunodeficiency virus type 1 and utilization of the CC-CKR5 coreceptor.
J. Virol.
71:1657-1661[Abstract].
|
| 6.
|
Cheng-Mayer, C.,
M. Quiroga,
J. W. Tung,
D. Dina, and J. A. Levy.
1990.
Viral determinants of human immunodeficiency virus type 1 T-cell or macrophage tropism, cytopathogenicity, and CD4 antigen modulation.
J. Virol.
64:4390-4398[Abstract/Free Full Text].
|
| 7.
|
Choe, H.,
M. Farzan,
Y. Sun,
N. Sullivan,
B. Rollins,
P. D. Ponath,
L. We,
C. R. Mackay,
G. LaRosa,
W. Newman,
N. Gerard,
C. Gerard, and J. Sodroski.
1996.
The -chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates.
Cell
85:1135-1148[Medline].
|
| 8.
|
Cocchi, F.,
A. L. De Vico,
A. Grazino-Demo,
S. K. Arya,
R. C. Gallo, and P. Lusso.
1995.
Identification of RANTES, MIP-1 alpha, and MIP-1 beta as the major HIV-suppressive factors produced by CD8+ T cells.
Science
270:1811-1816[Abstract/Free Full Text].
|
| 9.
|
Collman, R. G.,
B. Godfrey,
J. Cutilli,
A. Rhodes,
N. F. Hassan,
R. Sweet,
S. D. Douglas,
H. Friedman,
N. Nathanson, and F. Gonzalez-Scarano.
1990.
Macrophage-tropic strains of human immunodeficiency virus type 1 utilize the CD4 receptor.
J. Virol.
64:4468-4476[Abstract/Free Full Text].
|
| 10.
|
Dean, M.,
M. Carrington,
C. Winkler,
G. A. Huttley,
M. W. Smith,
R. Allikmets,
J. J. Goedert,
S. P. Buchbinder,
E. Vittinghoff,
E. Gomperts,
S. Donfield,
D. Vlahov,
R. Kaslow,
A. Saah,
C. Rinaldo,
R. Detels, and S. J. O'Brien.
1996.
Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5 structural gene.
Science
273:1856-1862[Abstract/Free Full Text].
|
| 11.
|
Deng, H.,
R. Liu,
W. Ellmeier,
S. Choe,
D. Unutmaz,
M. Burkhart,
P. DiMarzio,
S. Marmon,
R. E. Sutton,
C. M. Hill,
C. B. Davis,
S. C. Peiper,
T. J. Schall,
D. R. Littman, and N. R. Landau.
1996.
Identification of a major co-receptor for primary isolates of HIV-1.
Nature
381:661-666[Medline].
|
| 12.
|
Doms, R. W.
1997.
Structure-function studies of chemokine receptors and their role in HIV and SIV infection, p. 1.
AIDS pathogenesis conference.
Keystone Symposia on Molecular and Cellular Biology, Keystone, Colo.
|
| 13.
|
Doranz, B. J.,
Z.-H. Lu,
J. Rucker,
T. Zhang,
J. F. Berson,
Z. Wang,
M. Sharron,
R. W. Doms, and S. C. Peiper.
1997.
Structural determinants of CCR5 coreceptor function for HIV-1, abstr. 116-12..
AIDS pathogenesis conference.
Keystone Symposia on Molecular and Cellular Biology, Keystone, Colo.
|
| 14.
|
Doranz, B. J.,
J. Rucker,
Y. Yi,
R. J. Smyth,
M. Samson,
S. C. Pieper,
M. Parmentier,
R. G. Collman, and R. W. Doms.
1996.
A dual-tropic primary HIV-1 isolate that uses fusin and the -chemokine receptors CKR-5, CKR-3, and CKR2b as fusion cofactors.
Cell
85:1149-1158[Medline].
|
| 15.
|
Dragic, T.,
V. Litwin,
G. P. Allaway,
S. R. Martin,
Y. Huang,
K. A. Nagashima,
C. Cayanan,
P. J. Maddon,
R. A. Koup,
J. P. Moore, and W. A. Paxton.
1996.
HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR5.
Nature
381:667-673[Medline].
|
| 16.
|
Endres, M. J.,
P. R. Clapham,
M. Marsh,
M. Ahuja,
J. D. Turner,
A. McKnight,
J. F. Thomas,
B. Stoebenau-Haggarty,
S. Choe,
P. J. Vance,
T. N. C. Wells,
C. A. Power,
S. S. Sutterwala,
R. W. Doms,
N. R. Landau, and J. A. Hoxie.
1996.
CD4-dependent infection by HIV-2 is determined by fusin/CXCR4.
Cell
87:745-756[Medline].
|
| 17.
|
Feng, Y.,
C. Broder,
P. Kennedy, and E. Berger.
1996.
HIV-1 entry cofactor: functional cDNA cloning of seven-transmembrane, G-protein-coupled receptor.
Science
272:872-877[Abstract].
|
| 18.
|
Folks, T. M.,
D. Powel,
M. Lightfoote,
S. Koenig,
A. S. Fauci,
S. Hogan,
S. Venatesan, and M. A. Martin.
1986.
Biological and biochemical characterization of a cloned Leu-3-cell surviving infection with the acquired immunodeficiency syndrome retrovirus.
J. Exp. Med.
164:280-290[Abstract/Free Full Text].
|
| 19.
|
Hanauer, A., and J. L. Mandel.
1984.
The glyceraldehyde-3-phosphate dehydrogenase gene family: structure of a human cDNA and an X chromosome linked pseudogene; amazing complexity of the gene family in mouse.
EMBO J.
3:2627-2633[Medline].
|
| 20.
|
He, J.,
Y. Chen,
M. Farzan,
H. Choe,
A. Ohagen,
S. Gartner,
J. Busciglio,
X. Yang,
W. Hofmann,
W. Newman,
C. R. Mackay,
J. Sodroski, and D. Gabuzda.
1997.
CCR3 and CCR5 are co-receptors for HIV-1 infection in microglia.
Nature
385:645-649[Medline].
|
| 21.
|
Huang, Y.,
W. A. Paxton,
S. M. Wolinsky,
A. U. Neumann,
L. Zhang,
T. He,
S. Kang,
D. Ceradini,
Z. Jin,
K. Yazdanbakhsh,
K. Kunstman,
D. Erickson,
E. Dragon,
N. R. Landau,
J. Phair,
D. D. Ho, and R. A. Koup.
1996.
The role of a mutant CCR5 allele in HIV-1 transmission and disease progression.
Nat. Med.
2:1240-1243[Medline].
|
| 22.
|
Hwang, S. S.,
T. J. Boyle,
H. K. Lyerly, and B. R. Cullen.
1991.
Identification of the envelope V3 loop as the primary determinant of cell tropism in HIV-1.
Science
253:71-73[Abstract/Free Full Text].
|
| 23.
|
Kazazi, F.,
J.-M. Mathijs,
P. Foley, and A. L. Cunningham.
1989.
Variations in CD4 expression by human monocytes and macrophages and their relationship to infection with the human immunodeficiency virus.
J. Gen. Virol.
70:2661-2672[Abstract/Free Full Text].
|
| 24.
| Kelly, M., and H. Naif. Unpublished observations.
|
| 25.
|
Kozak, S. L.,
E. J. Platt,
N. Madani,
F. E. Ferro, Jr.,
K. Peden, and D. Kabat.
1997.
CD4, CXCR-4, and CCR-5 dependencies for infections by primary patient and laboratory-adapted isolates of human immunodeficiency virus type 1.
J. Virol.
71:873-882[Abstract].
|
| 26.
|
Loetscher, M.,
T. Geiser,
T. O'Reilly,
R. Zwahlen,
M. Baggiolini, and B. Moser.
1994.
Cloning of a human seven-transmembrane domain receptor, LESTR, that is highly expressed in leukocytes.
J. Biol. Chem.
269:232-237[Abstract/Free Full Text].
|
| 27.
|
Liu, R.,
W. A. Paxton,
S. Choe,
D. Ceradini,
S. R. Martin,
R. Horuk,
M. E. MacDonald,
H. Stuhlmann,
R. A. Koup, and N. R. Landau.
1996.
Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection.
Cell
86:367-377[Medline].
|
| 28.
|
McKnight, A.,
G. Simmons,
S. Talbot,
L. Picard,
M. Ahuja,
M. Marsh,
J. A. Hoxie, and P. R. Clapham.
1997.
Inhibition of human immunodeficiency virus fusion by a monoclonal antibody to a coreceptor (CXCR4) is both cell type and virus strain dependent.
J. Virol.
71:1692-1696[Abstract].
|
| 29.
|
Naif, H. M.,
S. Li,
M. Ho-Shon,
J.-M. Mathijs,
P. Williamson, and A. L. Cunningham.
1997.
The state of maturation of monocytes into macrophages determines the effects of interleukin 4 and interleukin 13 on HIV replication.
J. Immunol.
158:501-511[Abstract].
|
| 30.
|
Naif, H. M.,
J. Chang,
M. Ho-Shon,
S. Li, and A. L. Cunningham.
1996.
Inhibition of human immunodeficiency virus replication in differentiating monocytes by interleukin 10 occurs in parallel with inhibition of cellular RNA expression.
AIDS Res. Hum. Retroviruses
12:1237-1245[Medline].
|
| 31.
| Naif, H. M. Unpublished observations.
|
| 32.
|
Neote, K.,
D. DiGregorio,
J. Y. Mak,
R. Horuk, and T. J. Schall.
1993.
Molecular cloning, functional expression, and signaling characteristics of a C-C chemokine receptor.
Cell
72:415-425[Medline].
|
| 33.
|
Oberlin, E.,
A. Amara,
F. Bachelerie,
C. Bessia,
J.-L. Virelizier,
F. Arenzana-Seisdedos,
O. Schwartz,
J.-M. Heard,
I. Clark-Lewis,
D. F. Legler,
M. Loetscher,
M. Baggiolini, and B. Moser.
1996.
The CXC chemokine SDF-1 is the ligand for LESTR/fusin and prevents infection by T-cell-line-adapted HIV-1.
Nature
382:833-835[Medline].
|
| 34.
|
O'Brien, W. A.,
Y. Koyanagi,
A. Namazi,
J.-Q. Zhao,
A. Diagne,
K. Idler,
J. Zack, and I. S. Y. Chen.
1990.
HIV-1 tropism for mononuclear phagocytes can be determined by regions of gp120 outside the CD4-binding domain.
Nature
348:69-73[Medline].
|
| 35.
|
Paxton, W. A.,
S. R. Martin,
D. Tse,
T. R. O'Brien,
J. Skurnick,
N. L. Van Devanter,
N. Padian,
J. F. Braun,
D. P. Kotler,
S. M. Wolinsky, and R. A. Koup.
1996.
Relative resistance to HIV-1 infection of CD4 lymphocytes from persons who remain uninfected despite multiple high-risk sexual exposure.
Nat. Med.
2:412-417[Medline].
|
| 36.
|
Ponath, P. D.,
S. Qin,
T. W. Post,
J. Wang,
L. Wu,
N. P. Gerard,
W. Newman,
C. Gerarad, and C. R. Mackay.
1996.
Molecular cloning and characterization of a human eotaxin receptor expressed selectively on eosinophils.
J. Exp. Med.
183:2437-2448[Abstract/Free Full Text].
|
| 37.
|
Rucker, J.,
M. Samson,
B. J. Doranz,
F. Libert,
J. F. Berson,
Y. Yi,
R. J. Smyth,
R. G. Collman,
C. C. Broder,
G. Vassart,
R. W. Doms, and M. Parmentier.
1996.
Regions in -chemokine receptors CCR5 and CCR2b that determine HIV-1 cofactor specificity.
Cell
87:437-446[Medline].
|
| 38.
|
Saiki, R. K.,
D. H. Gelfand,
S. Stoffel,
S. J. Scharf,
R. Higuchi,
G. T. Horn,
K. B. Mullins, and H. A. Erlich.
1988.
Primer-directed enzyme amplification of DNA with a thermostable DNA polymerase.
Science
239:487-491[Abstract/Free Full Text].
|
| 39.
|
Samson, M.,
F. Libert,
B. J. Doranz,
J. Rucker,
C. Liesnard,
C.-M. Farber,
S. Saragosti,
C. Lapoumeroulie,
J. Cognaux,
C. Forceille,
G. Muyldermans,
C. Verhofstede,
G. Burtonboy,
M. Georges,
T. Imai,
S. Rana,
Y. Yi,
R. J. Smyth,
R. G. Collman,
R. W. Doms,
G. Vassart, and M. Parmentier.
1996.
Resistance to HIV-1 infection in Caucasian individuals bearing mutant alleles of the CCR-5 chemokine receptor gene.
Nature
382:722-725[Medline].
|
| 40.
|
Samson, M.,
O. Labbe,
C. Mollereau,
G. Vassart, and M. Parmentier.
1996.
Molecular cloning and functional expression of a new human CC-chemokine receptor gene.
Biochemistry
35:3362-3367[Medline].
|
| 41.
|
Schmidtmayerova, H.,
H. S. Nottet,
G. Nuovo,
T. Raabe,
C. R. Flanagan,
L. Dubrovsky,
H. E. Gendelman,
A. Cerami,
M. Bukrinsky, and B. Sherry.
1996.
Human immunodeficiency virus type 1 infection alters chemokine peptide expression in human monocytes: implications for recruitment of leukocytes into brain and lymph nodes.
Proc. Natl. Acad. Sci. USA
93:700-704[Abstract/Free Full Text].
|
| 42.
|
Shioda, T.,
J. A. Levy, and C. Cheng-Mayer.
1991.
Macrophage and T-cell line tropisms of HIV-1 are determined by specific regions of the envelope gp120 gene.
Nature
349:167-169[Medline].
|
| 43.
|
Simmons, G.,
D. Wilkinson,
J. D. Reeves,
M. T. Dittmar,
S. Beddows,
J. Weber,
G. Carnegie,
U. Desselberger,
P. W. Gray,
R. A. Weiss, and P. R. Clapham.
1996.
Primary, syncytium-inducing human immunodeficiency virus type 1 isolates are dual-tropic and most can use either Lestr or CCR5 as coreceptors for virus entry.
J. Virol.
70:8355-8360[Abstract].
|
| 44.
|
Sonza, S.,
A. Maerz,
N. Deacon,
J. Meanger,
J. Mills, and S. Crowe.
1996.
Human immunodeficiency virus type 1 replication is blocked prior to reverse transcription and integration in freshly isolated peripheral blood monocytes.
J. Virol.
70:3863-3869[Abstract].
|
| 45.
|
Tedla, N.,
P. Palladinetti,
M. Kelly,
R. K. Kumar,
N. DiGirolamo,
U. Chattophadhay,
B. Cooke,
P. Truskett,
J. Dwyer,
D. Wakefield, and A. Lloyd.
1996.
Chemokines and T lymphocyte recruitment to lymph nodes in HIV infection.
Am. J. Pathol.
148:1367-1373[Abstract].
|
| 46.
|
Trkola, A.,
T. Dragic,
J. Arthos,
J. M. Binley,
W. C. Olson,
G. P. Allaway,
C. Cheng-Mayer,
J. Robinson,
P. J. Maddon, and J. P. Moore.
1996.
CD4-dependent, antibody-sensitive interactions between HIV-1 and its co-receptor CCR-5.
Nature
384:184-187[Medline].
|
| 47.
|
Wu, L.,
N. P. Gerard,
R. Wyatt,
H. Choe,
C. Parolin,
N. Ruffing,
A. Borsetti,
A. A. Cardoso,
E. Desjardin,
W. Newman,
C. Gerard, and J. Sodroski.
1996.
CD4-induced interaction of primary HIV-1 gp120 glycoproteins with the chemokine receptor CCR-5.
Nature
384:179-183[Medline].
|
| 48.
|
Yamagami, S.,
Y. Tokuda,
K. Ishii,
H. Tanaka, and N. Endo.
1994.
cDNA cloning and functional expression of a human monocytes chemoattractant protein 1 receptor.
Biochem. Biophys. Res. Commun.
202:1156-1162[Medline].
|
| 49.
|
Zack, J. A.,
S. J. Arrigo,
S. R. Weitsman,
A. S. Go,
A. Haislip, and I. S. Y. Chen.
1990.
HIV-1 entry into quiescent primary lymphocytes: molecular analysis reveals a labile, latent viral structure.
Cell
61:213-222[Medline].
|
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Top
Abstract
Text
