INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

Cell-to-cell movement of plant viruses occurs through plasmodesmal channels in a process mediated by virus-encoded proteins that are dispensable for replication and virion assembly (14). A considerable amount of evidence related to the interactions of movement proteins (MPs) with various viral, cytoplasmic, and plasmodesmal components has been reported in the last few years, but a full understanding of cell-to-cell movement of virus infection is still lacking (30).

In many plant virus groups, cell-to-cell movement is mediated by a single MP. The first of these proteins to be identified was the 30-kDa protein (p30) of tobacco mosaic virus (TMV), which was shown to affect viral host range to be essential for virus movement (15, 18), to be localized to plasmodesmata (16, 17, 34, 42, 50), and to alter size exclusion limits of plasmodesmata (51, 54). In addition, it was shown that p30 is phosphorylated in infected protoplasts (53) and in vitro (8). Also, in vitro assays demonstrated that the TMV MP has a nonspecific nucleic acid-binding activity which may be involved in unfolding the single-stranded genomic RNA in a manner compatible with transport through plasmodesmata (7). By using deletion analysis, the putative phosphorylation site, the activity-increasing size exclusion limit, and the RNA-binding activity have been tentatively mapped to specific domains of the TMV MP (6, 7, 51). More recently, immunofluorescence assays showed an association between p30 and cytoskeletal proteins (23, 32).

Potato virus X (PVX) contains a positive-sense genomic RNA comprising five open reading frames (ORFs) numbered 1 to 5 in the 5'-to-3' direction. They encode polypeptides of 166 kDa (viral replicase), 24 kDa (p24), 12 kDa (p12), 8 kDa (p8), and 25 kDa (viral coat protein [CP]) (25, 40). In contrast to TMV, cell-to-cell movement of PVX is mediated by the proteins encoded by ORF2 to -4 (the triple gene block). Participation of the triple-gene-block polypeptides in viral transport was implicated from experiments performed with white clover mosaic potexvirus (WCIMV), in which viral spread was prevented by mutations affecting each of these genes (4).

In all potexviruses described so far, proteins homologous to p24 contain the amino acid motif G/AX₂GXGKS/T, which is also present in several nucleoside triphosphatases (NTPases) and helicases (22); furthermore, the homologous protein of foxtail mosaic potexvirus (FMV) exhibits GTPase activity (44). The potential involvement of the NPTase/helicase motif in viral transport was suggested in WCIMV by site-directed mutagenesis studies in which the sequence GKS was changed to AAA and completely inhibited cell-to-cell movement (4). In addition, it was shown that FMV p26 binds nonspecifically to RNA, suggesting that this protein is also involved in unfolding of viral RNA (44).

Subcellular localization studies using gold-conjugated antibodies revealed that both PVX p24 and its FMV homolog are associated with cytoplasmic components in infected tissues (11, 44). In contrast, PVX p12 and PVX p8 contain amino acids sequences resembling membrane-spanning domains (35, 45) and remain associated with membranes in cell extracts (37). Similar arrays of three overlapping genes are present in the carla-, furo-, and hordeivirus genomes (20, 36). In each of these virus groups, at least one of the triple-gene-block polypeptides has been shown to be involved in viral movement (21, 43).

Despite the low similarity in amino acid sequences between the MPs of different viral groups (38), the local movement of totally unrelated viruses can be frequently complemented in mixed infections (3). For example, PVX can complement the tomato mosaic tobamovirus (ToMV) mutant Ls1, which is unable to move at nonpermissive temperatures (48). In addition, TMV movement can be complemented by PVX in tomato plants that carry Tm2, a gene that restricts the spread of TMV (47). From these experiments, it was concluded that the PVX transport system includes one or more functions that complement or facilitate TMV movement. However, no sequence similarities were found between the MPs of TMV and PVX proteins encoded in the triple gene block (38).

Complementation between the movement systems of TMV and PVX suggested to us that a nonspecific type of resistance to these viruses may be induced by expressing their MPs in transgenic plants, in a way similar to that described for other plant viruses (5, 9, 29, 31). In this paper, we report results showing that transgenic tobacco plants expressing the PVX p24 are resistant to infection by two different members of the tobamovirus group and, reciprocally, that transgenic tobacco plants expressing the TMV MP are resistant to PVX. However, the transgenic plants did not complement movement-defective mutants of the heterologous virus to spread either locally or systemically.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Plant lines and virus isolates. Nicotiana tabacum cv. Xanthi D8 NN was obtained from Y. Chupeau (INRA, Versailles, France) and used in all transformation assays. Transgenic N. tabacum cv. Xanthi nn line 277 (p30+) (12) and Xanthi NN line 2005 (p30+) (13) express genes encoding the TMV MP and complement a mutant of TMV that lacks a functional MP (24). The N gene confers hypersensitive resistance to TMV, producing necrotic local lesions upon infection with this virus. R₂ progeny of transgenic plant lines were used in this study. N. tabacum cv. Xanthi SX nn and N. tabacum cv. Xanthi NN were used as nontransgenic controls.

View larger version (12K): [in this window] [in a new window]   FIG. 1.   Schematic diagram of viral constructs used in this study. Straight lines indicate untranslated regions. Rectangles enclose ORFs. Mutant TMVM contained a deletion which is indicated by a gap in the rectangle. Mutant pMON8462b contained a mutation in the start codon which is indicated by a line. Numbers indicate nucleotide positions.

DNA cloning. (i) pORF2. A cDNA fragment encoding the PVX ORF2 comprising nucleotides 4484 to 5170 was obtained by PCR using clone 5X41 (40) as a template and oligonucleotides 5' GACTGGATCCAGATGGATATTCTCATC 3' and 5' GATTGCCCGGGCGGTCAGTC 3' as mutagenic primers. The underlined bases denote mismatches to introduce BamHI and SmaI sites at the 5' and 3' ends of the oligonucleotides, respectively. The amplification program was 20 cycles of 1 min at 94°C, 1 min at 50°C, and 1 min at 72°C, using a model IHB2024 Hybaid thermocycler. Reaction buffer and Taq polymerase were purchased from Promega. Following amplification, the PCR fragment was digested with BamHI and SmaI and subcloned in the pGEM-4Z vector (Promega) previously digested with BamHI and HincII, creating plasmid pORF2.

(ii) pMAL-p24. pORF2 DNA was first digested with BamHI, blunted with Klenow polymerase and dNTPs, and redigested with PstI. The resulting DNA fragment, corresponding to the PVX ORF2, was purified following agarose gel electrophoresis (GeneClean; Bio 101) and ligated to the expression vector pMAL-c (New England Biolabs) to create plasmid pMAL-p24.

(iii) pBl-p24. The HindIII-BamHI fragment from plasmid pORF2 was inserted into the binary expression vector pBl121 (26) that was previously treated with SstI, blunted with bacteriophage T4 DNA polymerase, and then digested with BamHI in order to excise the -glucuronidase gene and generate compatible cloning sites. The resulting plasmid was named pBl-p24.

Purification of MBP-p24 fusion protein. PVX p24 was expressed from pMAL-p24 as a fusion protein with maltose-binding protein (MBP) and purified by affinity chromatography. Briefly, a 16-h culture of Escherichia coli XL1Blue cells transformed with pMAL-p24 was diluted to 1:100 in 1 liter of LB medium containing 100 µg of ampicillin per ml and grown at 37°C to an optical density at 600 nm of 0.5. Isopropylthiogalactopyranoside was added to a final concentration of 0.3 mM, and cells were incubated for an additional 2 h to induce expression of the MBP-p24 fusion protein. Induced cells were harvested by centrifugation and lysed by sonication in 25 ml of 10 mM phosphate-30 mM NaCl-0.25% Tween 20-10 mM -mercaptoethanol-10 mM EDTA-10 mM EGTA. For purification, a 1:5 dilution of the crude extract was loaded into an MBP affinity chromatography column of amylose resin (New England Biolabs). The column was washed twice with 20 mM Tris-HCl (pH 7.4)-0.2 M NaCl to eliminate nonspecific ligands, and proteins were eluted with the same buffer supplemented with 10 mM -mercaptoethanol and 10 mM maltose. Eluted protein was separated in a 6% polyacrylamide gel by electrophoresis and show to be a single band of 66 kDa.

Immunization of rabbits. One milligram of purified MBP-p24 was mixed with 1 ml of Freund's adjuvant (complete for the initial intradermal injections; incomplete for subsequent intramuscular injections) and injected into two rabbits that had been previously bled to collect preimmune serum. Inoculations were repeated 4 and 6 weeks later. Antisera were collected 10 days after the last injection, and serial dilutions were tested in dot blot assays for titer determination. Antiserum used in this work was used at working dilutions of 1:1,000 and 1:2,000.

Plant transformation. Tobacco leaf disks from N. tabacum cv. Xanthi D8 NN plants were transformed as described by An et al. (1). To ensure the establishment of independent transgenic plants, only one shoot per explant was selected.

Analysis of transgenic plants. Kanamycin-resistant R₀ plants were self-pollinated, and their seeds (R₁ generation) were germinated under growth chamber conditions. p24 accumulation was analyzed by enhanced chemiluminescence (ECL) Western blot assays (ECL kit; Amersham) in 5 to 30 R₁ plants of each of the 11 R₀ lines obtained. R₂ plants were obtained by self-pollination of R₁ plants. Expression of the transgene was detected in all R₂ seedlings obtained from lines p24-C, p24-D, p24-E, p24-H, and p24-I. The amount of p24 was estimated from Western blots autoradiographs scanned with the NIH Image 1.60 software. A maximum value of 1 was set for the highest-expressing plant, and values of 1 to 0.7, 0.7 to 0.3, and less than 0.3 were ranked as corresponding to high, intermediate, and low expressors, respectively.

Infection assays. Eight to twelve plants per line were assayed in each infection test, and all experiments were repeated at least twice. Plants were grown in a growth room under artificial light (14 h/day) at 25°C. After 6 to 8 weeks, plants were mechanically inoculated with purified virus particles, sap extracts, or viral RNA, using carborundum (330 grit; Fisher Scientific) as an abrasive. Plants were rinsed with water immediately after inoculation and placed in growth chambers. TMV local lesions were counted and measured with a micrometer.

Tobacco protoplasts. Tobacco protoplasts were generated from leaf tissue as follows. Leaf tissue was surface sterilized and washed with water, and 1 g of tissue was placed in a petri plate and digested overnight with enzyme solution (0.6 M mannitol, 0.1% 2-(N-morpholino)ethanesulfonic acid [MES], 0.015 g of cellulase per ml, 0.002 g of macerase per ml). Protoplasts were then filtered through a 300-µm-pore-size sieve and transferred to 15-ml polypropylene tubes. A cushion of 0.6 M sucrose was added to each tube, and protoplasts were spun at 1,200 × g at room temperature during 4 min in a swinging-bucket rotor. The upper phase was transferred to a new 15-ml tube, and protoplasts were pelleted as described above. Protoplasts were resuspended in 0.6 M mannitol-0.1% MES and spun again. This procedure was repeated twice. Samples of 2 million protoplasts were inoculated by electroporation with in vitro transcripts as described by Watanabe et al. (52) and cultured in 35-mm-diameter dishes at 23°C. For Western blot analysis, protoplasts (4 × 10⁵ ml¹) were harvested at 48 h by centrifugation followed by lysis in Laemmli buffer (28). Samples containing the equivalent of 10⁵ protoplasts were separated in 12.5% polyacrylamide gels containing sodium dodecyl sulfate (SDS). The proteins were electroblotted onto nitrocellulose and subjected to Western blot analysis using antibodies raised against PVX CP or TMV CP, followed by development with an ECL immunodetection kit (Amersham). The amount of PVX CP was estimated from autoradiographs scanned with the NIH Image 1.60 software.

Western blotting and ELISA. Tobacco leaves were ground in liquid nitrogen and homogenized in buffer A (100 mM Tris-HCl [pH 6.8], 10 mM EDTA, 1% SDS), boiled for 5 min, and centrifuged at 10,000 × g for 15 min at 4°C. Supernatants were transferred to new tubes, and 4 volumes of cold acetone were added and thoroughly mixed. After incubation for 2 min on ice and centrifugation for 5 min at 10,000 × g, 4°C, the supernatant was discarded and pellets were held on ice. The pellets were resuspended in buffer A and clarified by centrifugation, and protein content of the supernatant was determined by the bicinchoninic acid system (Pierce) (46). Aliquots containing equivalent amounts (30 to 40 µg) of soluble protein were mixed with loading buffer, boiled for 3 min, subjected to electrophoresis in 10 to 12% polyacrylamide gels containing 0.1% SDS (28), and then electrotransferred to nylon membranes (Immobilon-P). PVX p24 was detected by using the antibody raised against the MBP-p24 fusion protein. TMV and Ob CPs were detected by using an antibody raised against TMV U1. Specifically bound antibodies were visualized by using an ECL immunodetection kit (Amersham). Enzyme-linked immunosorbent assays (ELISA) to detect PVX and PVY were carried out with anti-CP antibodies (PVX and PVY detection kits; Boehringer) as instructed by the manufacturer.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

Evaluation of anti-p24 antibody. Polyclonal antibodies to p24 were obtained by expressing the protein in E. coli cells as a fusion to the C terminus of MBP. The MBP-p24 fusion protein was purified by affinity chromatography and used as antigen to obtain polyclonal antibodies in rabbits. When leaf extracts from healthy and PVX-infected tobacco plants were tested in Western blot assays, the anti-MPB-p24 antibodies reacted specifically with a major polypeptide of 24 kDa that was present only in infected leaves (data not shown). As previously reported (11), bands of higher molecular weight were not detected in infected tissues, suggesting that p24 is not posttranslationally processed or derived from a precursor polypeptide.

Generation of p24 transgenic tobacco plants. Tobacco leaf explants were transformed with a chimeric gene comprising the cauliflower mosaic virus 35S promoter, the coding sequence for p24, and the nos 3' end; 11 R₀ plants were self-pollinated to establish lines p24-A to -K. Seedlings from the R₁ generation were analyzed for p24 accumulation by Western blot assays using anti-MBP-p24 antibodies. In five independent lines, p24-C, -D, -E, -H, and -I, segregation of p24 was approximately 3:1 (presence:absence), suggesting that a single copy of the transgene was expressed (Fig. 2). Seedlings that accumulated the highest levels of p24 exhibited a distinctive phenotype consisting of stunted plants with short internodes, smaller leaves, and slightly chlorotic appearance (Fig. 3A). Plants in the R₂ generation obtained from these high-level expressors also showed a correlation between the stunted phenotype and levels of p24, suggesting that expression of this protein above a certain threshold has a pleiotropic effect on normal plant development. R₂ lines p24-C and p24-D, with high levels of p24 and altered phenotype, and lines p24-E, p24-H and p24-I, with intermediate or low levels of p24 and normal phenotype, were selected for subsequent experiments (Table 1).

View larger version (42K): [in this window] [in a new window]   FIG. 2.   Western blot analysis of proteins extracted from p24 transgenic plants. Membranes with blotted proteins (40 µg/per lane) were reacted with anti-p24 serum. Specific binding of the antibody was detected by chemiluminescence. The position of p24 is indicated by the arrowhead. Five p24 transgenic plants of the R1 generation from p24-C (lanes 1 to 5) and p24-D (lanes 6 to 10) lines were analyzed. Plants showing a stunted and chlorotic phenotype are denoted by asterisks.

View larger version (104K): [in this window] [in a new window]   FIG. 3.   (A) Phenotype of Xanthi D8 NN (right) and p24-C (left) plants, shown 8 weeks after germination. (B) Detached systemic leaves from a p24-C plant (left) infected with pMON8462b (p24) and from a Xanthi D8 NN plant (right) infected with pMON8453 (p24+). Leaves shown are from plants at 18 dpi. (C and D) Detached inoculated leaves of p24-C (C) and Xanthi D8 NN (D) plants inoculated with TMV-U1 (50 ng/ml) and photographed at 12 dpi. (E) p24-C plant (left) and Xanthi D8 NN plant (right) inoculated with Ob (0.2 mg/ml) and photographed at 15 dpi. (F) Detached systemic leaf of a p24-C plant inoculated with PVX (5 µg/ml) and shown at 15 dpi.

Evaluation of p24 activity in the transgenic plants. To evaluate the activity of p24 in transgenic plants, complementation assays were performed with PVX infectious transcripts carrying a frameshift mutation in ORF2. RNA transcripts from clones pMON8453 (p24+) and pMON8462b (p24) (Fig. 1) were inoculated onto nontransformed line Xanthi D8 NN and onto transgenic lines p24-C and p24-E. Plants were monitored by ELISA for appearance of systemic symptoms and for CP accumulation in the inoculated and uninoculated leaves. While Xanthi D8 NN plants inoculated with transcripts of pMON8453 (p24+) were fully infected at 16 dpi, no symptoms of infection or PVX accumulation were detected in this line after inoculation with transcripts from pMON8462b (p24) (data not shown). In contrast, there was development of systemic symptoms when transcripts of pMON8462b (p24) were inoculated onto lines p24-C (Fig. 3B) and p24-E (data not shown), indicating that the transgenic protein is able to support viral transport when provided in trans. Disease symptoms observed in these complementation assays were similar to those induced by PVX on nontransgenic plants, except that the chlorotic appearance of p24+ plants was instead a dark green color in the center of the infection rings, which were sometimes masked by the chlorotic background of the transgenic plants (Fig. 3B). To assess viral replication of wild-type and mutant virus, transcripts from pMON8453 (p24+) and pMON8462b (p24) were electroporated into tobacco protoplasts. As estimated from PVX CP accumulation measured in Western blot immunoassays (see Materials and Methods), p24-defective and nondefective transcripts replicated to similar extents in these protoplasts (data not shown). As an additional control, back-inoculation experiments in which nontransgenic plants were inoculated with sap from p24-C plants previously infected with transcripts from pMON8462b (p24) failed to induce symptoms or accumulate virus, confirming that infection of p24-C plants was not due to a recovery of wild-type virus.

Resistance studies on p24 transgenic plants. The complementation between PVX and ToMV Ls1 reported by Taliansky et al. (48) prompted us to examine the effect of TMV inoculation on p24 transgenic plants. Plants from lines p24-C, p24-D, and Xanthi D8 NN were challenged with TMV, and the progress of infection was monitored by scoring the size and number of necrotic local lesions. At 10 dpi, when growth of local lesions was arrested, the average diameter of lesions was much smaller in p24 transgenic plants (0.7 to 0.9 mm) than in control plants (5.4 mm) (Fig. 3C, 3D, and 4). Inoculation with TMV RNA produced the same results (data not shown). A separate experiment including high-, intermediate-, and low-expression plants was carried out. While the average lesion size of intermediate expressors (1.10 mm) was slightly higher than those of high expressors (0.89 and 0.91 mm), values corresponding to low expressors (3.90 mm) did not significantly differ from those found in control plants (Table 2). Remarkably, the total number of local lesions did not significantly differ between p24 transgenic and control lines (Fig. 3C and D). To assess whether TMV replication or movement was affected on p24+ plants, protoplasts from lines p24-C and p24-E were inoculated with TMV infectious transcripts. As shown in Fig. 5, viral accumulation reached normal levels on p24 protoplasts, indicating that viral spread was impaired in p24+ plants.

View larger version (20K): [in this window] [in a new window]   FIG. 4.   Time course of local lesion development on inoculated leaves of p24 and nontransgenic Xanthi D8 NN plants. Ten plants per line were inoculated with TMV U1 (50 ng/ml). The values represent the mean measurements of 100 individual local lesions from different plants of the same line. Standard deviations are represented by vertical bars.

View larger version (22K): [in this window] [in a new window]   FIG. 5.   Western blot analysis of proteins extracted from tobacco protoplasts. Membranes with blotted proteins were reacted with anti-TMV CP serum. Specific binding of the antibody was detected by chemiluminescence. The position of TMV CP is indicated by an arrowhead. Times (hours postinoculation) are indicated at the top of each panel, and plant lines are indicated at the bottom. Shown are results of two independent experiments using protoplasts from p24-C (A) and p24-E (B) plant lines.

View larger version (21K): [in this window] [in a new window]   FIG. 6.   Development of Ob infection on p24 and Xanthi D8 NN plants, indicated by number of leaves showing disease symptoms as a function of days after inoculation. Twelve plants per line were inoculated with Ob (0.2 µg/ml). Values represent the average number of leaves showing symptoms, and standard deviations are represented by vertical bars. The experiment was repeated twice.

Resistance studies on p30 transgenic plants. To determine whether TMV p30 reduced infection by PVX, plants from lines 277 (p30+) (Table 1) and Xanthi SX nn were inoculated with PVX, and the development of infection was monitored in inoculated and uninoculated leaves. Although levels of virus accumulation in the inoculated leaves were similar in 277 (p30+) and control plants, there was a significant delay in the development of symptoms and virus accumulation in the uninoculated leaves of 277 (p30+) plants (Fig. 7).

View larger version (19K): [in this window] [in a new window]   FIG. 7.   Plants infected with PVX as a function of time after inoculation. Ten plants per line were inoculated with PVX (1 µg/ml), and uninoculated leaves were analyzed by ELISA at various dpi. Vertical bars represent standard deviations. The experiment was repeated twice, and values represent the mean of both experiments.

Complementation assays. The fact the p24+ and p30+ plants showed protection to TMV and PVX, respectively, suggested that the two viral transport systems would share functions reciprocally interfering with each other. Based on this proposal, we performed a series of preliminary experiments to explore whether PVX and TMV MPs can be interchanged. Thus, seedlings from lines 2005 (p30+), 277 (p30+), p24-C (Table 1), and Xanthi D8 NN were inoculated with in vitro transcripts of pMON8462b (p24), and PVX infection was monitored by ELISA at different dpi. While p24+ plants were fully infected at 15 dpi, no symptoms or PVX accumulation were detected in Xanthi D8 NN, 2005, or 277 plants up to 35 dpi (data not shown).

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

Tobacco plants expressing high levels of PVX p24 exhibit a stunted phenotype, including shorter internodes, smaller leaf sizes, and a slightly chlorotic condition. Since these plants become systemically infected after inoculation with a p24-defective mutant of PVX, it was concluded that the transgenic protein is functional and able to act in trans. In addition, p24+ plants showed more severe symptoms than did nontransgenic plants upon infection with PVX, including peculiar necrotic rings surrounding nonchlorotic tissue. These observations suggest that, in addition to its role in virus movement, p24 may be involved in symptom development.

Upon challenge with TMV, p24+ plants exhibited a considerable level of resistance which was perceived as a reduction in the area of virus-induced lesions. The fact that TMV replicated normally in p24+ protoplasts, together with the development of approximately equivalent numbers of local lesions in p24+ and nontransgenic plants, indicates that neither the establishment of TMV infection nor replication is affected by p24 and that p24 acts by interfering with TMV movement. This interpretation is also supported by the results obtained with Ob, in which those plants showing the highest levels of p24 expression did not develop systemic infection. In contrast, no differences with control plants were observed when p24+ plants were challenged with either PVY or PVX, implying that the resistance-inducing mechanism is specific to certain viral groups. Remarkably, a considerable delay in systemic infection was observed when p30+ plants were inoculated with PVX, though no differences could be detected in inoculated leaves. It was previously shown that transgenic plants containing a dysfunctional p30 developed resistance to heterologous viruses in systemic rather than in inoculated leaves (9). Similarly, resistance to PVX could reflect a differential activity of p30 inhibiting long-distance transport but not cell-to-cell spread. A summary of the infection assays performed in this work is shown in Table 3.

No TMV infection was detected when p24+ plants were inoculated with TMVM or when this mutant was coinoculated with PVX on nontransgenic plants, indicating that neither p24 nor other PVX MPs can complement p30 under these conditions. This result does not necessarily conflict with the movement complementation previously reported for PVX and ToMV Ls1 (48). This interaction could be explained if Ls1 p30 retains some but not all of its functional properties at nonpermissive temperatures, while TMVM carries an extensive deletion. On the other hand, at least one of the p24 functions is not exerted by p30, since p30-expressing plants do not support infection by a p24-defective PVX mutant. Taken together, these experiments show that the TMV and PVX transport systems are not completely interchangeable. However, our experiments cannot exclude the possibility that some functional determinants are shared by the two proteins and that the two viruses can act cooperatively in certain cases.

Two general models can be postulated to explain virus resistances in p24- and p30-expressing plants. In the first model, p24 and p30 contain multiple functional domains: those performing equivalent activities and those specific to each virus protein. This combination of shared and nonshared domains would cause the proteins to appear to be partially functional for the heterologous virus and, consequently, dominant negative effectors of the nonshared function(s). Evidence for the presence of shared functions includes the reported complementation between PVX and the ToMV Ls1 mutant (48) and the RNA-binding activity demonstrated in both proteins (7, 44). Hence, the resistance observed in p24+ and p30+ transgenic plants could be explained as a competition for a limiting cellular factor which is required for both systems. This model is supported both by the correlation between the p24 expression level and the degree of protection against TMV and Ob and by the susceptibility of p24- and p30-expressing plants to the homologous viruses (reference 9 and this work).

Alternatively, the resistance found in p24+ and p30+ plants could be explained by a mechanism inducing a constitutive defense response that restricts virus spread. A predicted consequence of this model is that such response should be nonspecific and likely to act against a broad range of viruses, including potex-, poty-, and tobamoviruses. The fact that p24+ plants are susceptible to PVX and PVY, and that p30+ plants are susceptible to TMV and other viruses, argues against this type of mechanism.

Genetically engineered protection, derived from viral and nonviral genes, has been widely explored as an alternative approach to plant virus control. CP-mediated resistance proved to be the most successful approach to accomplish this goal, but it is usually limited to closely related viruses (19). On the other hand, a broader antiviral resistance has been obtained by expression of viral MPs in transgenic plants, either in native or mutated versions. Thus, tobacco plants expressing a mutated form of the TMV p30 were found to be resistant to infection by several tobamo-, tobra-, nepo-, alfamo-, caulimo-, and cucumoviruses (9, 29). Likewise, transgenic plants expressing a mutated version of WCIMV p13 protein were shown to be resistant to this and other potexviruses and to potato carlavirus S (5). In addition, resistance to TMV was induced by expression of the brome mosaic virus 32-kDa MP in tobacco plants. Since tobacco is not a host for brome mosaic virus (31), this finding suggests that expression of MPs that are nonfunctional in a particular host could interfere with viruses adapted to replicate in it. Our results demonstrate that the nonmodified PVX and TMV MPs can confer protection in a rather specific manner which is not effective in the case of the homologous virus. To be applied under agricultural conditions, this strategy must first be adapted to suppress potential problems associated with MP expression and undesirable effects observed on plant phenotype and to develop MP mutants that are incapable of normal function (5, 29).