Previous Article | Next Article 
J Virol, January 1998, p. 684-692, Vol. 72, No. 1
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Role of Baculovirus IE2 and Its RING Finger in
Cell Cycle Arrest
Elena A.
Prikhod'ko and
Lois K.
Miller*
Departments of Entomology and Genetics, The
University of Georgia, Athens, Georgia 30602
Received 2 June 1997/Accepted 1 October 1997
 |
ABSTRACT |
The ie2 gene of Autographa californica
nuclear polyhedrosis virus (AcMNPV) is known to
transactivate transient expression from viral promoters in a host
cell-specific manner. We report that transfection of
Spodoptera frugiperda (SF-21) cells with ie2
was sufficient to arrest the cell cycle, resulting in the accumulation
of enlarged cells with abnormally high DNA contents. By 72 h
posttransfection, more than 50% of ie2-transfected
cells had DNA contents greater than 4N. There was no evidence of
mitotic spindle formation in these cells, and expression of
ie2 appeared to block cell cycle progression in S phase.
Several ie2 mutants were analyzed to further define the
region of IE2 responsible for arresting the cell cycle. Analysis of
these mutants showed that deletion of the RING finger motif eliminated
the ability of IE2 to arrest the cell cycle but did not affect its
ability to transactivate the ie1 promoter. Moreover,
mutation of a single conserved cysteine (C251) of the RING finger motif
abolished the ability of IE2 to block cell cycle progression but had no
apparent effect on its trans-regulatory activity. In
contrast, a mutant of IE2 containing a deletion of residues 94 to 173 was able to block cell division but lacked trans-regulatory
activity. Thus, the ability of IE2 to arrest the cell cycle depended on
the integrity of the RING finger motif and was distinct from and
independent of its ability to trans-activate the
ie1 promoter. IE2 also arrested the division of cells
derived from other insect species, Trichoplusia ni (TN-368
and BTI-TN-5B1-4) and Helicoverpa zea (Hz-AM1).
 |
INTRODUCTION |
The product of the ie2
gene of Autographa californica nuclear polyhedrosis virus
(AcMNPV) is a ~49-kDa protein, IE2, which activates the
transient expression of plasmid-borne reporter genes under the control
of viral promoters in SF-21 cells. IE2 was originally identified by its
ability to trans-activate expression from the early
AcMNPV 39K promoter in the presence of another viral
trans-regulator, IE1 (5, 16). The effect of IE2
on expression from the 39K promoter was traced to the ability of the
IE2 gene, ie2, to trans-activate expression from
the ie1 promoter (6) in transient expression assays. In SF-21 cells, ie2 is also required, along with 17 other viral genes including ie1, for optimal transient
expression from reporter plasmids carrying a late viral promoter
(26, 32). In these assays, efficient late expression
requires the replication and stability of the reporter plasmid carrying
a viral homologous repeat sequence which binds IE1 and is thought to
serve as an origin of DNA replication (18, 21, 33). The
requirement of IE2 in optimizing plasmid DNA replication and late gene
expression is host specific, since it is required in SF-21 cells but
not in TN-368 cells (25, 35). The host dependence of IE2 may
explain the observation that ie2 is nonessential for
replication of the closely related baculovirus Bombyx mori
nuclear polyhedrosis virus (BmNPV) in Bombyx mori cells
(13).
IE2 is a nuclear protein which contains a RING finger motif at
its center (23, 40). RING fingers, or
C3HC4 motifs, form a cross-braced zinc
coordinating structure (11, 12, 24) and are found in a
number of proteins of diverse function. The AcMNPV
genome alone contains a total of five genes encoding proteins with RING
finger motifs: IE2, CG30 (41), PE-38 (22), IAP1 (3, 8), and IAP2 (1). Although the RING finger
motifs of the IE2s of both AcMNPV and BmNPV differ
slightly in the spacing of one cysteine pair from the canonical RING
finger motif, a canonical RING finger motif is found in the
ie2 homolog of Orgyia pseudotsugata nuclear
polyhedrosis virus (OpMNPV) (40). Like the RING
finger-containing mammalian oncogene PML, AcMNPV IE2 and
PE38 localize to discrete structures within the nucleus
(23).
While studying the effects of early AcMNPV genes on
apoptosis in SF-21 cells (34), we noticed that transfection
of plasmids expressing ie2 resulted in the enlargement of
the cells. We now report that ie2 expression blocked cell
cycle progression but did not block cellular DNA replication, resulting
in an increase in the number of cells with an abnormal DNA content,
greater than 4N. In addition, we found that mutants of IE2 containing
either a deletion of the RING finger motif or a mutation of an
individual conserved amino acid residue of the RING finger motif lacked
the ability to block cell division but retained the ability to
trans-activate the ie1 promoter.
 |
MATERIALS AND METHODS |
Cells.
Spodoptera frugiperda IPBL-SF-21 (SF-21)
(44), Trichoplusia ni BTI-TN-5B1-4
(46) and TN-368 (20), and Helicoverpa
zea Hz-AM1 (28) cells were cultured at 27°C in TC-100
medium (Gibco BRL, Gaithersburg, Md.) supplemented with 10% fetal
bovine serum and 0.26% tryptose broth, as described previously
(31).
Reporter plasmids and plasmid constructs.
The reporter
plasmid phcIE1 (29) contains the chloramphenicol
acetyltransferase (CAT) gene under the transcriptional control of the
ie1 promoter (17) and a portion of the hr-5
(37) sequences of AcMNPV.
Plasmid pBs-PstN, containing the AcMNPV
PstI-N fragment (from 97.0 to 98.9 map units [m.u.], was
described previously (32). Plasmid pBs-PstNfs has a
frameshift mutation at the BglII site at 98.4 m.u.
within the ie2 gene that results in the premature termination of IE2 synthesis. To construct pBs-PstNfs, pBs-PstN was
digested with BglII, blunt-ended with T4 DNA polymerase, and then religated. The frameshift was confirmed by DNA sequencing.
To construct plasmid pBs-IE2

(94-173), pBs-PstN was digested with
HpaI and
SnaBI and then religated. Thus,
pBs-IE2

(94-173)
contains an in-frame deletion of the 237-bp
HpaI-
SnaBI fragment
in the
ie2 gene.
The
ie2 coding sequence also contains an
HpaI-like
site (ATTAAC),
HpaI*, that can be
digested with high concentrations
of
HpaI restriction
enzyme. The 543-bp
HpaI-
HpaI* fragment was
deleted from pBs-PstN by digestion with a high concentration of
HpaI and replaced with the 363-bp
HpaI-
DraI fragment of
ie2. The
HpaI-
DraI fragment was obtained by digestion of a
PCR-amplified
product of the Ac
MNPV
ie2 gene
with
HpaI and
DraI, followed by
gel purification.
The resulting plasmid, pBs-IE2

(215-274), contained
an in-frame
deletion of the 180-bp
DraI-
HpaI* fragment.
Sequence
analysis was used to confirm that pBs-IE2

(94-173) and
pBs-IE2

(215-274)
have the expected in-frame deletions of the
HpaI-
SnaBI and
DraI-
HpaI*
fragments, respectively.
Plasmid pHSP70PLVI
+CAT has been described previously
(
7) and contains the CAT gene under the transcriptional
control of
the
Drosophila melanogaster hsp70 promoter
(
42). This plasmid
was used to construct plasmid
pHSP70FLAG-PLVI
+ (provided by G. G. Prikhod'ko),
which contains an in-frame sequence
encoding a FLAG epitope tag
(GACTACAAGGACGACGATGACAAA) downstream
of the
hsp70 promoter. To construct pHSP70FLAG-IE2, expressing
FLAG-
ie2, the PCR-amplified
ie2 open reading
frame (ORF) was inserted
into pHSP70FLAG-PLVI
+. Primers
used to amplify the
ie2 gene were a 5' primer in the
sense
orientation (5'-GCCGGATCCAATATGAGTCGCCAAATC-3') and a 3'
primer in the antisense orientation
(5'-TCCCCCGGGTTAACGTCTAGACATAACAG-3').
The same strategy was
used to construct pHSP70FLAG-IE2

(94-173)
and
pHSP70FLAG-IE2

(215-274). Site-specific mutagenesis was performed
on
pHSP70FLAG-IE2 with a Transformer site-directed mutagenesis
kit using
the selection primer CATCAGAGTCGCTAGCGATGTAAACGATGG
and the
mutagenic primer CTGTGTACAAAGCTTTTTGCAGCGC to generate
a
mutant IE2 containing alanine instead of cysteine at residue
251 (pHSP70FLAG-IE2C251A).
Transfection, transient expression assays, and CAT assays.
SF-21 cells (2.0 × 106 cells per 60-mm-diameter dish)
were transfected with 2.0 µg of the reporter plasmid phcIE1 and 1.0 µg of each of the other plasmids by using Lipofectin (Gibco BRL). Transfected cells were incubated at 27°C and harvested at 24 h posttransfection. CAT assays (15, 37) were performed by
using 1/50 of each cell lysate. In those experiments involving heat shock, the cells were heat shocked at 18 h posttransfection for 30 min at 42°C and then harvested 6 h after heat shock. The
percentage of viable cells was determined at various times as described
previously (7, 34).
Flow cytometry.
For flow cytometry, the medium was removed
at the indicated times posttransfection and the cells were fixed and
stained with DAPI (4',6-diamidino-2-phenylindole; Sigma, St. Louis,
Mo.). The cells were harvested and washed once with ice-cold
phosphate-buffered saline (PBS), pH 6.2. After fixation in 80% ethanol
for 30 min on ice, the cells were washed again with ice-cold PBS and
stained with a solution containing 1 µg of DAPI per ml, 0.1 mM EDTA,
and 1 µg of RNase A per ml in PBS. DAPI-stained cells were analyzed with a Coulter EPIC 753 flow cytometer (Coulter Electronics, Hialeah, Fla.), as described previously (7).
Microphotography and immunofluorescence.
SF-21 cells were
seeded on glass coverslips in 35-mm-diameter culture dishes and
transfected with the indicated plasmids, as described above. At 48 h posttransfection, growth medium was aspirated and the cells were
rinsed with PBS (pH 6.2) and fixed in methanol at
10°C for 20 min,
followed by two washes in PBS. To detect the microtubule network, cells
were incubated with a 1:500 dilution of DM1 anti-alpha tubulin (Sigma)
in PBS containing 1 µg of DAPI per ml for 30 min at room temperature.
The cells were washed in PBS and incubated with a 1:50 dilution of
lissamine rhodamine-conjugated goat anti-mouse immunoglobulin G (IgG)
and IgM (Jackson Immunoresearch Laboratories) in PBS. Cells were washed twice in PBS and mounted on glass slides in Gelmount.
Immunoblot analysis.
Transfected cells were heat shocked at
18 h posttransfection and harvested 3 h after heat shock.
Cells were lysed in SDS buffer (4% sodium dodecyl sulfate [SDS], 125 mm Tris-HCl [pH 6.7], 30% [vol/vol] glycerol, 0.002% [wt/vol]
bromphenol blue, 2% [vol/vol]
-mercaptoethanol). Proteins from
lysates of the transfected cells were separated on SDS-12%
polyacrylamide gels and transferred to Immobilon P membranes
(Millipore). FLAG-tagged proteins were detected with a 1:10,000
dilution of anti-FLAG M2 monoclonal antibody (Eastman Kodak Co., New
Haven, Conn.) followed by a 1:10,000 dilution of rabbit anti-mouse
IgG-horseradish peroxidase conjugate (Amersham). Immunoblots were
visualized by the chemiluminescence method (Amersham).
 |
RESULTS |
Expression of AcMNPV ie2 blocks cell
division.
By light microscopy, we observed that SF-21 cells
transfected with a plasmid containing the PstI-N fragment of
the AcMNPV genome, pBs-PstN, became enlarged by 48 h posttransfection (Fig. 1A). The
pBs-PstN-transfected cells continued to increase in size until 72 h and existed in this enlarged state for more than 96 h after
transfection without obvious signs of stress (data not shown). This
unusual morphology was not detected in SF-21 cells transfected with the
vector plasmid pBluescript KS+ (pBs) (Fig. 1B).

View larger version (93K):
[in this window]
[in a new window]

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
Expression of the AcMNPV
PstI-N fragment blocks cell division. SF-21 cells (0.5 × 106 per 35-mm-diameter dish) were transfected either
with 0.5 µg of plasmid pBs-PstN (A, C, and E) or with the same amount
of the control vector plasmid, pBs (B, D, and F). At 48 h
posttransfection, the cells were fixed in methanol and then double
stained with DAPI (C and D) and DM1 anti-alpha tubulin (E and F), and
the same field of cells was examined by phase-contrast (A and B) and
immunofluorescence (C to F) microscopy. All cells were photographed at
the same magnification; note the larger sizes of the cells transfected
with pBs-PstN. Also, one of the four cells in panels A, C, and E does
not appear to have been transfected with pBs-PstN. In panels B and F,
mitotic spindles can be observed in the cell on the right. Bar, 25 µm. (G) SF-21 cells were transfected with either pBs or pBs-PstN and
harvested after 24, 48, 72, and 96 h, and the numbers of viable
cells were counted in the presence of trypan blue.
|
|
To test whether enlargement of the cells was accompanied by enlargement
of the nucleus, SF-21 cells were transfected with
either the pBs-PstN
plasmid or pBs and stained at 48 h posttransfection
with DAPI,
which is specific for DNA. The pBs-PstN-transfected
cells were observed
to contain a single enlarged nucleus (Fig.
1; compare panels C and D).
We also analyzed the effect of pBs-PstN
transfection on the microtubule
network by immunofluorescence
staining of pBs-PstN-transfected cells.
The microtubule network
was characteristic of nonmitotic cells and was
similar to that
of nonmitotic pBs-transfected cells (Fig.
1; compare
panels E
and F). There was no evidence of the extension of mitotic
spindles
in the enlarged pBs-PstN-transfected cells (Fig.
1E), whereas
mitotic spindle formation was observed in some of the control
pBs-transfected cells (Fig.
1B and F).
To determine if transfection with pBs-PstN affected cell division, the
number of viable SF-21 cells was quantified by staining
of the
pBs-PstN- or pBs-transfected cells with 0.04% trypan blue
(Fig.
1G).
By 48 h posttransfection, the number of cells in the
control
pBs-transfected culture had increased more than fourfold,
and by
96 h the cells had undergone three to four rounds of division.
In
contrast, no significant increase in cell number was obtained
in the
culture transfected with pBs-PstN from 24 to 96 h
posttransfection.
By 72 h, the cell numbers in the
pBs-PstN-transfected culture
were less than 30% of those observed for
the control cells. The
gradual increase in viable cells observed in the
pBs-PstN-transfected
culture is probably due to division of cells which
did not acquire
pBs-PstN during the transfection process. There was no
evidence
of apoptosis or necrotic cell death in the cultures; there
were
no signs of membrane blebbing, oligonucleosomal DNA fragmentation,
or cell debris (data not shown). Thus, transfection of SF-21 cells
with
pBs-PstN blocked cell division.
The
PstI-N fragment of the Ac
MNPV genome
contains
ie2 and three smaller ORFs (Fig.
2). Transfection
of pBs-PstNfs, a plasmid
containing the
PstI-N fragment with
a frameshift mutation at the
BglII site within the
ie2 coding sequence (Fig.
2),
failed to
block cell division (data not shown). These results suggest
that
ie2 was probably the gene affecting cell cycle
progression upon
transfection of SF-21 cells with pBs-PstN.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2.
Physical map of the 96.9- to 0.0-m.u. region of
AcMNPV with a partial restriction map. Locations and
directions of ORFs between 96.9 and 0.0 m.u. are based on the
sequence determined by Ayres et al. (1). Schematic
representations of wild-type and mutant forms of ie2 are
shown below the lines representing each plasmid. The RING finger motif
is indicated by the shaded R box. Restriction sites are abbreviated as
follows: HIII, HindIII; PI,
PstI; HI, HpaI; B,
BglII; S, SnaBI; D,
DraI; HI*, HpaI-like site (see
Materials and Methods).
|
|
To determine if expression of the
ie2 coding sequence alone
was able to block cell division, we transiently expressed
ie2 by transfecting SF-21 cells with pHSP70FLAG-IE2, a
plasmid containing
the N-terminally FLAG-tagged, PCR-amplified ORF of
IE2 under the
transcriptional control of the
D. melanogaster
hsp70 promoter.
Plasmid pHSP70PLVI
+CAT, which
expresses the CAT gene, served as a control. Less than
a
twofold increase in the number of viable cells was observed
for
cells transfected with pHSP70FLAG-IE2 through 72 h
posttransfection,
whereas pHSP70PLVI
+CAT-transfected
cells underwent normal cell division (SF-21 cells
normally double every
18 to 24 h [
31]) and increased in number
more
than fivefold by 72 h posttransfection (Fig.
3). This effect
of pHSP70FLAG-IE2 was
also confirmed by light microscopy analysis
of the transfected cells;
by 48 h posttransfection, pHSP70FLAG-IE2-transfected
cells had
become enlarged compared with control transfected cells
(see
below). Thus, IE2 blocked cell division and caused cell enlargement
following transient expression.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of ie2 arrests the cell cycle.
SF-21 cells were transfected with either pHSP70FLAG-IE2 or control
pHSP70PLVI+CAT and heat shocked at 18 h
posttransfection. At 48, 72, and 96 h posttransfection, the cells
were harvested and counted as described in Materials and Methods.
|
|
IE2 arrested the cell cycle in the S phase.
To determine
whether IE2 prevented cell division by arresting cells at a specific
point in the cell cycle, we analyzed the DNA content of
ie2-transfected cells by flow cytometry (Fig.
4). Cells transfected with the control
plasmid pBs had similar DNA profiles at 24, 48, and 72 h
posttransfection (Fig. 4), correlating with stable 4N:2N DNA content
ratios of 0.93, 0.92, and 0.94, respectively (Table
1). In contrast, significant changes
occurred in the cell cycle distribution of SF-21 cells transfected with pBs-PstN expressing ie-2 (Fig. 4). At 24 h
posttransfection, a lower proportion of pBs-PstN-transfected cells
appeared to have a 4N complement of DNA, and greater proportions were
found in the G1 and S phases (Fig. 4; Table 1). At 48 h posttransfection, a large proportion of
ie2-expressing cells contained a 4N or higher amount of DNA
compared with cells transfected with the control, pBs (Fig. 4; Table
1). By 48 h, the 4N:2N DNA content ratio had increased to 5.4 in
pBs-PstN-transfected cells, compared to 0.92 in control cells (Table
1). By 72 h posttransfection, more than 50% of the
pBs-PstN-transfected cells had abnormal DNA contents of greater than 4N
(Fig. 4; Table 1), indicating that expression of ie2 blocks
cell division and that cellular DNA replication continues. On the basis
of these data and the lack of mitotic spindle formation, it appears
that ie2 arrested SF-21 cells in the S phase of the cell
cycle and that the normal control of cellular DNA replication was
altered.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 4.
DNA content analysis in ie2-transfected
cells. SF-21 cells were transfected with either pBs-PstN expressing
ie2 or the vector alone (pBs). The cells were washed, fixed,
and stained with DAPI at the indicated times. Histograms show the
results of flow cytometric analysis of DAPI staining intensity. The
abscissas show relative amounts of DAPI fluorescence, reflecting DNA
content, and the ordinates show cell numbers. The results shown are
representative of at least two independent experiments.
|
|
Deletion of the RING finger region blocked the ability of IE2 to
arrest the cell cycle.
To determine if a specific region of IE2
was important for its ability to arrest the cell cycle, we constructed
two deletion mutants of IE2 and tested their transactivation
capabilities and their effects on cell cycle progression in transient
assays. Plasmid pBs-IE2
(215-274) has an in-frame deletion of the
DraI-HpaI* fragment resulting in the deletion of
amino acids 215 to 274, thereby eliminating the RING finger motif from
IE2 (Fig. 2). In pBs-IE2
(94-173), the
HpaI-SnaBI fragment of PstI-N was
deleted, leaving the RING finger domain intact but deleting amino acids
94 to 173 (Fig. 2), including several arginine, proline, and serine
residues that are conserved between the AcMNPV and
OpMNPV ie2 genes. To ensure that the
ie2 deletion mutants could be expressed in SF-21 cells, we
also constructed plasmids containing FLAG-tagged coding sequences of
the ie2 mutants under hsp70 promoter control.
These constructs, pHSP70FLAG-IE2
(94-173) and
pHSP70FLAG-IE2
(215-274), as well as pHSP70FLAG-IE2, were
tested for expression in
SF-21 cells (Fig. 5). Plasmids pHSP70FLAG-IE2
(94-173), pHSP70FLAG-IE2
(215-274),
and pHSP70FLAG-IE2 were transfected into SF-21 cells, followed by heat
shock treatment. FLAG-IE2 and IE2
(94-173) showed comparable levels
of expression (Fig. 5; compare lanes 1 and 2). Slightly higher levels
of expression were observed for the IE2
(215-274) mutant protein
(Fig. 5, lane 3).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 5.
Expression of FLAG-IE2 and FLAG-IE2 mutants. SF-21 cells
were transfected with 2.5 µg of pHSP70FLAG-IE2 (lane 1),
pHSP70FLAG-IE2 (94-173) (lane 2), pHSP70FLAG-IE2 (215-274)
(lane 3), or pHSP70FLAG-IE2C251A (lane 4), heat shocked at
18 h posttransfection, and harvested 3 h after heat shock.
Equal amounts of cell lysates were analyzed by SDS-12% polyacrylamide
gel electrophoresis followed by Western blotting with anti-FLAG
monoclonal antibody.
|
|
To test if these deletion mutants were able to arrest cell division,
SF-21 cells were transfected with plasmids expressing
either the normal
or FLAG-tagged versions of
ie2
(94-173) or
ie2
(215-274)
and examined by light microscopy as well as
by flow cytometry.
Enlarged cells were not observed in cultures
transfected with
pBs-IE2

(215-274), while pBs-IE2

(94-173) caused
the enlarged
cell phenotype (data not shown). At 24 and 48 h
posttransfection,
pBs-IE2

(94-173)-transfected cells had DNA
profiles similar to
those of cells transfected with pBs-PstN expressing
intact
ie2 (compare Fig.
6,
middle row, with Fig.
4, bottom row). Thus, deletion
of residues 94 to
173 of IE2 did not affect its ability to block
the cell cycle. SF-21
cells transfected with pBs-IE2

(215-274)
had a stable cell cycle
distribution, similar to that of cells
transfected with the vector
alone (Fig.
6). This demonstrated
that deletion of the RING finger
region eliminated the ability
of IE2 to affect the cell cycle.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 6.
DNA content analysis of SF-21 cells transfected with
deletion mutants of ie2. SF-21 cells were transfected with
pBs-IE2 (94-173), pBs-IE2 (215-274), or the control vector
plasmid, pBs. Transfected cells were harvested at 24 or 48 h
posttransfection. After being washed, fixed, and stained with DAPI, the
cells were analyzed by flow cytometry. DAPI fluorescence is plotted on
the x axes and is proportional to DNA content. Cell numbers
are shown on the y axes.
|
|
Transactivation properties of IE2 mutants.
To determine if the
IE2 deletion mutants retained transregulatory activity, we analyzed
their abilities to activate expression from phcIE1, a reporter plasmid
containing the CAT gene under ie1 promoter control. When
SF-21 cells were cotransfected with phcIE1 and pBs-PstN or
pHSP70FLAG-IE2 expressing ie2 under the control of either
its own promoter or the hsp70 promoter, the levels of CAT
activity increased approximately threefold compared with that in cells
transfected with the reporter plasmid alone (Fig.
7; compare lane 1 with lanes 2 and 3).
Higher levels of CAT activity were also observed for cells
cotransfected with phcIE1 and plasmids expressing
ie2
(215-274) (Fig. 7, lanes 6 and 7). Thus, deletion of
the RING finger motif did not impair the ability of IE2 to activate the
ie1 promoter. Plasmids pBs-IE2
(94-173) and
pHSP70FLAG-IE2
(94-173) were not able to transactivate the CAT gene
under ie1 promoter control (Fig. 7, lanes 4 and 5).
Moreover, the levels of CAT activity in these cells were approximately
twofold lower than in cells transfected with the reporter plasmid
alone, suggesting interference with factors responsible for
ie1 promoter activation or direct repression of the
ie1 promoter.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 7.
Transactivation of the ie1 promoter by IE2
deletion mutants. SF-21 cells were transfected with the reporter
plasmid phcIE1 alone or cotransfected with phcIE1 and pBs-PstN,
pBs-IE2 (94-173), pBs-IE2 (215-274), pHSP70FLAG-IE2,
pHSP70FLAG-IE2 (94-173), pHSP70FLAG-IE2 (215-274), or
pHSP70FLAG-IE2C251A. CAT activity relative to that from phcIE1
cotransfected with wild-type ie2 under its own promoter
(lane 2, 100%) was determined. The data are averages of two or more
experiments, and standard errors are indicated.
|
|
Site-specific mutation of the IE2 RING finger.
To determine if
the RING finger was specifically involved in blocking cell cycle
progression, we constructed pHSP70FLAG-IE2C251A, a plasmid containing
FLAG-tagged IE2 with an alanine in place of one of the seven conserved
cysteine residues of the IE2 RING finger motif. Transient expression of
pHSP70FLAG-IE2C251A in SF-21 cells did not result in an enlargement of
the cell size (Fig. 8). Analysis of the
trans-regulatory activity of FLAG-IE2C251A showed that this
mutant was able to stimulate levels of CAT activity from the
ie1 promoter comparable to that determined for wild-type IE2
(Fig. 7; compare lanes 3 and 8). Thus, modification of a single conserved residue of the RING finger motif of IE2 abolished its ability
to arrest the cell cycle but did not affect its
trans-regulatory activity.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 8.
Effects of FLAG-IE2C251A on cell size and growth. SF-21
cells were transfected with plasmids expressing the FLAG-tagged version
of wild-type (pHSP70FLAG-IE2) or RING finger mutant
(pHSP70FLAG-IE2C251A) IE2 or with the control CAT gene
(pHSP70PLVI+CAT) and examined by light microscopy at
72 h posttransfection. Bar, 50 µm.
|
|
These results confirmed that the RING finger motif of IE2 is important
for the ability of this gene to block cell division
but is not
responsible for the ability of IE2 to transactivate
the
ie1
promoter. Furthermore, this transactivation ability of
IE2 is distinct
from its ability to block the cell cycle, since
the IE2

(94-173)
mutant lacking transactivation potential can
block cell division.
Effects of ie2 expression in different cell lines.
Since the requirement for IE2 in transient expression assays is cell
line specific, we analyzed the ability of IE2 to arrest cell division
in cell lines derived from other insect species. SF-21, TN-368,
BTI-TN-5B1-4, and Hz-AM1 cells were transfected with
pHSP70FLAG-IE2 and heat shocked at 18 h posttransfection. At
72 h posttransfection, approximately 50% of the normal numbers of
viable cells were obtained in the pHSP70FLAG-IE2-transfected TN-368,
BTI-TN-5B1-4, and Hz-AM1 cells at 72 h posttransfection (Fig.
9A), similar to the reduction in cell
numbers observed in the pHSP70FLAG-IE2-transfected SF-21 cell
culture. There was no evidence of apoptosis or necrotic cell death in
any of the transfected cultures. Thus, IE2 expression affected the
ability of cells to divide, and this resulted in decreases in the
numbers of viable cells. This result was confirmed by light microscopic
analysis of pHSP70FLAG-IE2-transfected cells (Fig. 9B). No enlarged
cells were observed in control
pHSP70PLVI+CAT-transfected cells. In contrast, many
of the TN-368, BTI-TN-5B1-4, and Hz-AM1 cells transfected with
ie2 exhibited altered cellular morphologies at 72 h
posttransfection. A dramatic enlargement of cells was
observed in pHSP70FLAG-IE2-transfected BTI-TN-5B1-4 cells. A less
dramatic but nevertheless noticeable increase in cell size was observed
in TN-368 cells transfected with pHSP70FLAG-IE2, whereas Hz-AM1 cells
expressing IE2 became elongated and had long protrusions at 72 h
posttransfection (Fig. 9B). We conclude that AcMNPV
ie2 was able to affect the cell division of cell lines derived from other species.

View larger version (44K):
[in this window]
[in a new window]

View larger version (149K):
[in this window]
[in a new window]
|
FIG. 9.
Effects of ie2 expression in different cell
lines. (A) Percentage of viable cells in pHSP70FLAG-IE2-transfected
cultures relative to that observed in control cells transfected with
pHSP70PLVI+CAT in each cell line. The cells (0.5 × 106 cells per 35-mm-diameter dish) were transfected with
0.5 µg of pHSP70FLAG-IE2 and heat shocked at 18 h
posttransfection. The cells were harvested, stained, and counted at
72 h posttransfection. (B) Morphology of TN-368, BTI-TN-5B1-4, and
Hz-AM1 cells transfected with pHSP70FLAG-IE2 or control plasmid.
Transfected cells were heat shocked at 18 h posttransfection and
photographed at the same magnification at 72 h posttransfection.
Cells transfected with pHSP70PLVI+CAT served as controls
for normal cell growth and regular morphology. Bar, 50 µm.
|
|
 |
DISCUSSION |
We have identified a new activity of IE2: cell cycle arrest. SF-21
cells transfected with ie2 cease dividing and eventually contain a single enlarged nucleus with a greater than 4N complement of
DNA. Cell cycle arrest appears to occur in the S phase, based on
several observations. During the first 24 h following
transfection, cells were able to progress from G2 through M
to G1 and S, based on the fact that the proportion of cells
with a 4N complement of DNA decreased during this period while the
proportion of cells in the G1 and S phase (2N and 2N to 4N)
increased (Table 1). By 48 h, however, cells with a 4N or greater
complement of DNA predominated, indicating that DNA synthesis continued
in these cells in an unregulated fashion which precluded transition
into G2 and M. There were also no signs of mitotic spindle
formation in the ie2-enlarged cells.
The purpose of arresting the cell cycle in S phase remains unclear,
although the most obvious possibility would be to provide a nuclear
environment which is more conducive to viral DNA replication. However,
ie2 is a dispensable gene for both AcMNPV and
BmNPV replication in at least some cell lines (13, 35), so
cell cycle arrest does not appear to be essential for virus replication
in those cell lines. IE2 of BmNPV appears to accelerate viral DNA
replication slightly but reproducibly (13), although it is
not known whether this effect is due to the transactivation or cell
cycle arrest properties of IE2.
The ability of IE2 to arrest the cell cycle requires the presence of
the RING finger but appears to be independent of the ability of IE2 to
trans-activate gene expression. Deletion of residues 215 to
274, which encompass the majority of the RING finger motif of IE2 (only
the first two cysteines of the motif remain), eliminated the ability of
IE2 to block the cell cycle but did not eliminate its ability to
trans-activate expression from the ie1 promoter.
A similar effect was observed for an IE2 mutant with an alteration in a
single conserved residue of the RING finger motif. Our observation that
modification or deletion of the RING finger motif did not affect the
ability of IE2 to trans-activate the ie1 promoter
contrasts with the properties of an IE2 mutant described by Yoo and
Guarino (48) which precisely eliminated the RING finger
motif (residues 207 to 254). This 207-to-254 mutant was found to be
severely impaired in its ability to transactivate the ie1
promoter (48). Since a mutant lacking the nine residues just
N-terminal of the RING finger (i.e., a mutant deleted between residues
198 and 206) also lacked the ability to trans-activate the
ie1 promoter (48), it is possible that residues
207 to 215 are crucial for IE2 trans-activation potential in
our 215-to-274 mutant.
The IE2 mutant lacking residues 94 to 173 was unable to
trans-activate the ie1 promoter but retained the
ability to block the cell cycle, reinforcing the view that the
trans-activation activity of IE2 may be unrelated to its
ability to influence the cell cycle. Interestingly, the IE2
(94-173)
mutant not only failed to trans-activate the ie1
promoter but also had a negative effect on its expression. It is
possible that this negative effect on ie1-promoted gene
expression is due to the arrest of the cells in S phase, in which case
IE2 would require a transactivation activity in order to compensate for
this negative regulatory effect. However, it is also possible that the
mutant form of IE2 interacts with factors affecting ie1
expression in a negative fashion. It is clear that gene regulation by
IE2 is far more complex than originally envisioned.
A number of other viruses are known to affect the cell cycle during
infection. Smaller DNA viruses such as simian virus 40, papillomaviruses, and adenoviruses depend on many cellular enzymes for
viral DNA replication and induce cellular replication factors (reviewed
in references 30 and 43). Simian
virus 40 stimulates cells to synthesize DNA, and the majority of cells
acquire a greater-than-G2 tetraploid DNA content. Human
adenovirus E1A proteins induce quiescent cells to enter S phase of the
cell cycle by deregulating checkpoint controls, while the E1B proteins
block apoptosis and promote a favorable cellular environment for viral
replication (10, 14, 36, 39, 45). Large mammalian DNA
viruses also arrest the cell cycle during infection. Human
cytomegalovirus, for example, seems to inhibit cell cycle progression
at multiple points, including the transition from G1 to S
(4, 9, 27). The Vpr protein of human immunodeficiency virus
type 1 causes the accumulation of cells in the G2 phase of
the cell cycle and stimulates replication (19, 38). In
contrast to human immunodeficiency virus type 1, the oncoviruses
require host cell proliferation for productive infection
(2).
Baculovirus infection has long been known to induce significant changes
in infected cells during the first 6 h of infection, including
cytoskeletal rearrangements and host chromatin dispersal within the
nucleus, which enlarges during this period (47). The ability
of baculoviruses to arrest the cell cycle has not been previously
reported, and the involvement of a RING finger protein in this process
is especially intriguing. Understanding the interaction between
baculoviruses and the cell cycle should lead to new insights into viral
pathogenesis. We intend to investigate the basis of the host range
dependence on IE2 in the context of virus infections.
 |
ACKNOWLEDGMENTS |
We thank Grigori G. Prikhod'ko, Somasekar Seshagiri, and Jeanne
McLachlin for technical advice. We are grateful to C. H. Keith (University of Georgia Department of Cellular Biology) for the assistance and reagents necessary for immunofluorescence. We thank S. Hilliard (University of Georgia Cell Analysis Facility) for assistance
with flow cytometry.
This research was supported in part by Public Health Service grant
AI23719 from the National Institute of Allergy and Infectious Diseases.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Entomology, The University of Georgia, 413 Biological Sciences
Building, Athens, GA 30602-2603. Phone: (706) 542-2294. Fax: (706)
542-2279. E-mail: Miller{at}bscr.uga.edu.
 |
REFERENCES |
| 1.
|
Ayres, M. D.,
S. C. Howard,
J. Kuzio,
M. Lopez-Ferber, and R. D. Possee.
1994.
The complete DNA sequence of Autographa californica nuclear polyhedrosis virus.
Virology
202:586-605[Medline].
|
| 2.
|
Bieniasz, P. D.,
R. A. Weiss, and M. O. McClure.
1995.
Cell cycle dependence of foamy retrovirus infection.
J. Virol.
69:7295-7299[Abstract].
|
| 3.
|
Birnbaum, M. J.,
R. J. Clem, and L. K. Miller.
1994.
An apoptosis-inhibiting gene from a nuclear polyhedrosis virus encoding a polypeptide with Cys/His sequence motifs.
J. Virol.
68:2521-2528[Abstract/Free Full Text].
|
| 4.
|
Bresnahan, W. A.,
I. Boldogh,
E. A. Thompson, and T. Albrecht.
1996.
Human cytomegalovirus inhibits cellular DNA synthesis and arrests productively infected cells in late G1.
Virology
224:150-160[Medline].
|
| 5.
|
Carson, D. D.,
L. A. Guarino, and M. D. Summers.
1988.
Functional mapping of an AcNPV immediately early gene which augments expression of the ie-1 trans-activated 39k gene.
Virology
162:444-451[Medline].
|
| 6.
|
Carson, D. D.,
M. D. Summers, and L. A. Guarino.
1991.
Molecular analysis of a baculovirus regulatory gene.
Virology
182:279-286[Medline].
|
| 7.
|
Clem, R. J., and L. K. Miller.
1994.
Control of programmed cell death by the baculovirus genes p35 and iap.
Mol. Cell. Biol.
14:5212-5222[Abstract/Free Full Text].
|
| 8.
|
Crook, N. E.,
R. J. Clem, and L. K. Miller.
1993.
An apoptosis-inhibiting baculovirus gene with a zinc finger-like motif.
J. Virol.
67:2168-2174[Abstract/Free Full Text].
|
| 9.
|
Dittmer, D., and E. S. Mocarski.
1997.
Human cytomegalovirus infection inhibits G1/S transition.
J. Virol.
71:1629-1634[Abstract].
|
| 10.
|
Dyson, N., and E. Harlow.
1992.
Adenovirus E1A targets key regulators of cell proliferation.
Cancer Surv.
12:161-195[Medline].
|
| 11.
|
Everett, R. D.,
P. Barlow,
A. Milner,
B. Luisi,
A. Orr,
G. Hope, and D. Lyon.
1993.
A novel arrangement of zinc-binding residues and secondary structure in the C3HC4 motif of an alpha herpes virus protein family.
J. Mol. Biol.
2334:1038-1047.
|
| 12.
|
Freemont, P. S.,
I. M. Hanson, and J. Trowsdale.
1991.
A novel cysteine-rich sequence motif.
Cell
64:483-484[Medline].
|
| 13.
|
Gomi, S.,
C. E. Zhoi,
W. Yih,
K. Majima, and S. Maeda.
1997.
Deletion analysis of four of eighteen late gene expression factor gene homologues of the baculovirus, BmNPV.
Virology
230:35-47[Medline].
|
| 14.
|
Goodrum, F. D., and D. A. Ornelles.
1997.
The early region 1B 55-kilodalton oncoprotein of adenovirus relieves growth restrictions imposed on viral replication by the cell cycle.
J. Virol.
71:548-561[Abstract].
|
| 15.
|
Gorman, C. M.,
L. F. Moffat, and B. H. Howard.
1982.
Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells.
Mol. Cell. Biol.
2:1044-1051[Abstract/Free Full Text].
|
| 16.
|
Guarino, L. A., and M. D. Summers.
1986.
Functional mapping of a trans-activating gene required for expression of a baculovirus delayed-early gene.
J. Virol.
57:563-571[Abstract/Free Full Text].
|
| 17.
|
Guarino, L. A., and M. D. Summers.
1987.
Nucleotide sequence and temporal expression of a baculovirus regulatory gene.
J. Virol.
61:2091-2099[Abstract/Free Full Text].
|
| 18.
|
Guarino, L. A., and W. Dong.
1994.
Functional dissection of the Autographa californica nuclear virus enhancer element hr5.
Virology
200:328-335[Medline].
|
| 19.
|
He, J.,
S. Choe,
R. Walker,
P. Di Marzio,
D. O. Morgan, and N. R. Landau.
1995.
Human immunodeficiency virus type 1 viral protein R (Vpr) arrests cells in the G2 phase of the cell cycle by inhibiting p34cdc2 activity.
J. Virol.
69:6705-6711[Abstract].
|
| 20.
|
Hink, W. F.
1970.
Established insect cell line from the cabbage looper, Trichoplusia ni.
Nature
226:466-467.
|
| 21.
|
Kool, M.,
P. Van den Berg,
J. Tramper,
R. W. Goldbach, and J. M. Vlak.
1993.
Location of two putative origins of DNA replication of Autographa californica nuclear polyhedrosis virus.
Virology
192:94-101[Medline].
|
| 22.
|
Krappa, R., and D. Knebel-Mörsdorf.
1991.
Identification of the very early transcribed baculovirus gene PE-38.
J. Virol.
65:805-812[Abstract/Free Full Text].
|
| 23.
|
Krappa, R.,
R. Roncarati, and D. Knebel-Mörsdorf.
1995.
Expression of PE38 and IE2, viral members of the C3HC4 finger family, during baculovirus infection: PE38 and IE2 localize to distinct nuclear regions.
J. Virol.
69:5287-5293[Abstract].
|
| 24.
|
Lovering, R.,
I. M. Hanson,
K. L. B. Borden,
S. Martin,
N. A. O'Reilly,
G. I. Evan,
D. Rahman,
D. I. C. Pappin,
J. Trowsdale, and P. S. Freemont.
1993.
Identification and preliminary characterization of a protein motif related to the zinc finger.
Proc. Natl. Acad. Sci. USA
90:2112-2116[Abstract/Free Full Text].
|
| 25.
|
Lu, A., and L. K. Miller.
1995.
Differential requirements for baculovirus late expression factor genes in two cell lines.
J. Virol.
69:6265-6272[Abstract].
|
| 26.
|
Lu, A., and L. K. Miller.
1995.
The roles of eighteen baculovirus late expression factor genes in transcription and DNA replication.
J. Virol.
69:975-982[Abstract].
|
| 27.
|
Lu, M., and T. Shenk.
1996.
Human cytomegalovirus infection inhibits cell cycle progression at multiple points, including the transition from G1 to S.
J. Virol.
70:8850-8857[Abstract].
|
| 28.
|
McIntosh, A. H., and C. M. Ignoffo.
1983.
Characterization of 5 cell lines established from species of Heliothis.
Appl. Entomol. Zool.
18:262-269.
|
| 29.
|
Morris, T. D., and L. K. Miller.
1992.
Promoter influence on baculovirus-mediated gene expression in permissive and nonpermissive insect cell lines.
J. Virol.
66:7397-7405[Abstract/Free Full Text].
|
| 30.
|
Nevins, J. R.
1995.
Adenovirus E1A: transcription regulation and alteration of cell growth control.
Curr. Top. Microbiol. Immunol.
199:25-32.
|
| 31.
|
O'Reilly, D. A.,
L. K. Miller, and V. A. Luckow.
1992.
.
Baculovirus expression vectors: a laboratory manual. W. H.
Freeman and Company, New York, N.Y.
|
| 32.
|
Passarelli, A. L., and L. K. Miller.
1993.
Three baculovirus genes involved in late and very late gene expression: ie-1, ie-n, and lef-2.
J. Virol.
67:2149-2158[Abstract/Free Full Text].
|
| 33.
|
Person, M.,
R. Bjornson,
G. Pearson, and G. Rohrmann.
1992.
The Autographa californica baculovirus genome: evidence for multiple replication origin.
Science
257:1382-1384[Abstract/Free Full Text].
|
| 34.
|
Prikhod'ko, E. A., and L. K. Miller.
1996.
Induction of apoptosis by baculovirus transactivator IE1.
J. Virol.
70:7116-7124[Abstract/Free Full Text].
|
| 35.
| Prikhod'ko, E. A., A. Lu, and L. K. Miller. Unpublished data.
|
| 36.
|
Quinlan, M. P.
1994.
Enhanced proliferation, growth factor induction and immortalization by adenovirus E1A 12S in the absence of E1B.
Oncogene
9:2639-2647[Medline].
|
| 37.
|
Rankin, C.,
B. G. Ooi, and L. K. Miller.
1988.
Eight base pairs encompassing the transcriptional start point are the major determinant for baculovirus polyhedrin gene expression.
Gene
70:39-50[Medline].
|
| 38.
|
Re, F.,
D. Braaten,
E. K. Franke, and J. Luban.
1995.
Human immunodeficiency virus type 1 Vpr arrests the cell cycle in G2 by inhibiting the activation of p34cdc2-cyclin B.
J. Virol.
69:6859-6864[Abstract].
|
| 39.
|
Shepherd, S. E.,
J. A. Howe,
J. S. Mymryk, and S. T. Bayley.
1993.
Induction of the cell cycle in baby rat kidney cells by adenovirus type 5 E1A in the absence of E1B and a possible influence of p53.
J. Virol.
67:2944-2949[Abstract/Free Full Text].
|
| 40.
|
Theilmann, D. A., and S. Stewart.
1992.
Molecular analysis of the trans-activating IE-2 gene of Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus.
Virology
187:84-96[Medline].
|
| 41.
|
Thiem, S. M., and L. K. Miller.
1989.
A baculovirus gene with a novel transcription pattern encodes a polypeptide with a zinc finger and a leucine zipper.
J. Virol.
63:4489-4497[Abstract/Free Full Text].
|
| 42.
|
Toeroek, L., and F. Karch.
1980.
Nucleotide sequences of heat shock activated genes in Drosophila melanogaster. I. Sequences in the regions of the 5' and 3' ends of the hsp70 gene in the hybrid plasmid 56h8.
Nucleic Acids Res.
8:3105-3123[Abstract/Free Full Text].
|
| 43.
|
Tooze, J. E. (ed.).
1981.
.
DNA tumor viruses. (Molecular biology of DNA tumor viruses, part 2.) Cold Spring Harbor Laboratory
Cold Spring Harbor, N.Y.
|
| 44.
|
Vaughn, J. L.,
R. H. Goodwin,
G. J. Tompkins, and P. McCawley.
1977.
The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera: Noctuidae).
In Vitro
13:213-217[Medline].
|
| 45.
|
Vousden, K. H.
1995.
Regulation of the cell cycle by viral oncoproteins.
Semin. Cancer Biol.
6:109-116[Medline].
|
| 46.
|
Wickhman, T. J.,
T. T. Davis,
R. R. Granados,
M. L. Shuler, and H. A. Wood.
1992.
Screening insect cell lines for the production of recombinant virus in the baculovirus expression system.
Biotechnol. Prog.
8:391-396[Medline].
|
| 47.
|
Williams, G. V., and P. Faulkner.
1997.
Cytological changes and viral morphogenesis during baculovirus infection, p. 61-96. In
L. K. Miller (ed.), The baculoviruses.
Plenum Press, New York, N.Y.
|
| 48.
|
Yoo, S., and L. A. Guarino.
1994.
Functional dissection of the ie2 gene product of the baculovirus Autographa californica nuclear polyhedrosis virus.
Virology
202:164-172[Medline].
|
J Virol, January 1998, p. 684-692, Vol. 72, No. 1
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Liu, C. Y.-Y., Wang, C.-H., Hsiao, W.-K., Lo, H.-R., Wu, C. P., Chao, Y. C.
(2009). RING and Coiled-Coil Domains of Baculovirus IE2 Are Critical in Strong Activation of the Cytomegalovirus Major Immediate-Early Promoter in Mammalian Cells. J. Virol.
83: 3604-3616
[Abstract]
[Full Text]
-
Katsuma, S., Fujii, T., Kawaoka, S., Shimada, T.
(2008). Bombyx mori nucleopolyhedrovirus SNF2 global transactivator homologue (Bm33) enhances viral pathogenicity in B. mori larvae. J. Gen. Virol.
89: 3039-3046
[Abstract]
[Full Text]
-
Huang, J., Hao, B., Deng, F., Sun, X., Wang, H., Hu, Z.
(2008). Open reading frame Bm21 of Bombyx mori nucleopolyhedrovirus is not essential for virus replication in vitro, but its deletion extends the median survival time of infected larvae. J. Gen. Virol.
89: 922-930
[Abstract]
[Full Text]
-
Wu, W., Lin, T., Pan, L., Yu, M., Li, Z., Pang, Y., Yang, K.
(2006). Autographa californica Multiple Nucleopolyhedrovirus Nucleocapsid Assembly Is Interrupted upon Deletion of the 38K Gene. J. Virol.
80: 11475-11485
[Abstract]
[Full Text]
-
Imai, N., Matsuda, N., Tanaka, K., Nakano, A., Matsumoto, S., Kang, W.
(2002). Ubiquitin Ligase Activities of Bombyx mori Nucleopolyhedrovirus RING Finger Proteins. J. Virol.
77: 923-930
[Abstract]
[Full Text]
-
Crouch, E. A., Passarelli, A. L.
(2002). Genetic Requirements for Homologous Recombination in Autographa californica Nucleopolyhedrovirus. J. Virol.
76: 9323-9334
[Abstract]
[Full Text]
-
Lock, M. J., Thorley, N., Teo, J., Emery, V. C.
(2002). Azidodeoxythymidine and didehydrodeoxythymidine as inhibitors and substrates of the human herpesvirus 8 thymidine kinase. J Antimicrob Chemother
49: 359-366
[Abstract]
[Full Text]
-
Braunagel, S. C., Guidry, P. A., Rosas-Acosta, G., Engelking, L., Summers, M. D.
(2001). Identification of BV/ODV-C42, an Autographa californica Nucleopolyhedrovirus orf101-Encoded Structural Protein Detected in Infected-Cell Complexes with ODV-EC27 and p78/83. J. Virol.
75: 12331-12338
[Abstract]
[Full Text]
-
Prikhod'ko, E. A., Miller, L. K.
(1999). The Baculovirus PE38 Protein Augments Apoptosis Induced by Transactivator IE1. J. Virol.
73: 6691-6699
[Abstract]
[Full Text]
-
Prikhod'ko, E. A., Lu, A., Wilson, J. A., Miller, L. K.
(1999). In Vivo and In Vitro Analysis of Baculovirus ie-2 Mutants. J. Virol.
73: 2460-2468
[Abstract]
[Full Text]
-
Prikhod'ko, G. G., Wang, Y., Freulich, E., Prives, C., Miller, L. K.
(1999). Baculovirus p33 Binds Human p53 and Enhances p53-Mediated Apoptosis. J. Virol.
73: 1227-1234
[Abstract]
[Full Text]
-
Rapp, J. C., Wilson, J. A., Miller, L. K.
(1998). Nineteen Baculovirus Open Reading Frames, Including LEF-12, Support Late Gene Expression. J. Virol.
72: 10197-10206
[Abstract]
[Full Text]
-
Belyavskyi, M., Braunagel, S. C., Summers, M. D.
(1998). The structural protein ODV-EC27 of Autographa californica nucleopolyhedrovirus is a multifunctional viral cyclin. Proc. Natl. Acad. Sci. USA
95: 11205-11210
[Abstract]
[Full Text]
-
Lyngso, C., Bouteiller, G., Damgaard, C. K., Ryom, D., Sanchez-Munoz, S., Norby, P. L., Bonven, B. J., Jorgensen, P.
(2000). Interaction between the Transcription Factor SPBP and the Positive Cofactor RNF4. AN INTERPLAY BETWEEN PROTEIN BINDING ZINC FINGERS. J. Biol. Chem.
275: 26144-26149
[Abstract]
[Full Text]
-
Dai, K.-S., Liew, C.-C.
(2001). A Novel Human Striated Muscle RING Zinc Finger Protein, SMRZ, Interacts with SMT3b via Its RING Domain. J. Biol. Chem.
276: 23992-23999
[Abstract]
[Full Text]