Previous Article | Next Article 
J Virol, January 1998, p. 380-387, Vol. 72, No. 1
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Infectious Transcripts from Cloned Genome-Length
cDNA of Porcine Reproductive and Respiratory Syndrome Virus
J. J. M.
Meulenberg,*
J. N. A.
Bos-de Ruijter,
R.
van
de Graaf,
G.
Wensvoort, and
R. J. M.
Moormann
Institute for Animal Science and Health,
NL-8200 AJ Lelystad, The Netherlands
Received 19 June 1997/Accepted 14 September 1997
 |
ABSTRACT |
The 5'-terminal end of the genomic RNA of the Lelystad virus
isolate (LV) of porcine reproductive and respiratory syndrome virus was
determined. To construct full-length cDNA clones, the 5'-terminal
sequence was ligated to cDNA clones covering the complete genome of LV.
When RNA that was transcribed in vitro from these full-length cDNA
clones was transfected into BHK-21 cells, infectious LV was produced
and secreted. The virus was rescued by passage to porcine alveolar lung
macrophages or CL2621 cells. When infectious transcripts were
transfected to porcine alveolar lung macrophages or CL2621 cells, no
infectious virus was produced due to the poor transfection efficiency
of these cells. The growth properties of the viruses produced by BHK-21
cells transfected with infectious transcripts of LV cDNA resembled the
growth properties of the parental virus from which the cDNA was
derived. Two nucleotide changes leading to a unique PacI
restriction site directly downstream of the ORF7 gene were introduced
in the genome-length cDNA clone. The virus recovered from this mutated
cDNA clone retained the PacI site, which confirmed the de
novo generation of infectious LV from cloned cDNA. These results
indicate that the infectious clone of LV enables us to mutagenize the
viral genome at specific sites and that it will therefore be useful for
detailed molecular characterization of the virus, as well as for the
development of a safe and effective live vaccine for use in pigs.
 |
INTRODUCTION |
Porcine reproductive and
respiratory syndrome virus (PRRSV) is a member of the
Arteriviridae family, which also comprises equine arteritis
virus (EAV), lactate dehydrogenase-elevating virus, and simian
hemorrhagic fever virus (SHFV) (20). Recently, the
International Committee on the Taxonomy of Viruses has decided to
incorporate this family in a new order of viruses, the
Nidovirales, together with the Coronaviridae, and
Toroviridae (3). The order Nidovirales
represents enveloped RNA viruses that contain a positive-stranded RNA
genome and synthesize a 3' nested set of subgenomic RNAs during replication. The subgenomic RNAs of coronaviruses and arteriviruses contain a leader sequence which is derived from the 5' end of the viral
genome (27, 32). However, the subgenomic RNAs of toroviruses
lack this leader sequence (31). Open reading frames 1a and
1b (ORF1a and ORF1b), which encode the RNA-dependent RNA polymerase,
are expressed from the genomic RNA, but the smaller ORFs at the 3' end
of the genomes of Nidovirales, which encode the structural
proteins, are thought to be expressed from the subgenomic mRNAs. The
genomes of arteriviruses (approximately 13 to 15 kb) are much smaller
than those of coronaviruses (28 to 30 kb) and toroviruses (26 to 28 kb).
The causative agent of a new disease, now known as porcine reproductive
and respiratory syndrome, was first identified in 1991 by Wensvoort et
al. (39) and was named Lelystad virus (LV). The main
symptoms of the disease are respiratory problems in pigs and abortions
in sows. Although major outbreaks, such as those observed at first in
the United States in 1987 and in Europe in 1991, have diminished, this
virus still causes significant economic losses in herds in the United
States, Europe, and Asia. PRRSV preferentially grows in porcine
alveolar lung macrophages (PAMs) (39). A few cell lines,
such as CL2621 and other cell lines cloned from the monkey kidney cell
line MA-104, are also susceptible to the virus (1, 5, 13).
The genomic cDNA sequence of LV and other isolates of PRRSV was
determined (6, 20, 25). In addition to the RNA-dependent RNA
polymerase (ORF1a and ORF1b), the genomic sequence encodes
four envelope glycoproteins named GP2 (ORF2),
GP3 (ORF3), GP4 (ORF4), and GP5
(ORF5), as well as a nonglycosylated membrane protein M (ORF6) and the
nucleocapsid protein N (ORF7) (18, 21, 22, 35).
Immunological characterization and nucleotide sequencing of U.S.
strains have indicated that they are antigenically different from
European strains (25, 26, 37).
The production of cDNA clones from which infectious RNA can be
transcribed in vitro has become an essential step in the molecular genetic analysis of positive-strand RNA viruses. These clones are
useful in studies focused on genetic expression, replication, function
of viral proteins, and recombination of RNA viruses, as well as for the
development of new viral vectors and vaccines (for a review, see
reference 2). The technology is applicable to
positive-strand RNA viruses, whose RNA genomes function as mRNA and
initiate a complete infectious cycle upon introduction into appropriate
host cells. Although infectious clones have been described for several
other positive-strand RNA viruses, no infectious cDNA clone has been
described for PRRSV until now. In this study, we generated for the
first time an infectious clone of the LV isolate of PRRSV and used it
to produce LV mutants.
 |
MATERIALS AND METHODS |
Cells and viruses.
The Ter Huurne strain of LV
was isolated in 1991 (39) and grown in PAMs. Passage 6 of
the Ter Huurne strain (TH) was used in this study, as well
as a derivative of this strain, LV4.2.1, which was adapted for growth
on CL2621 cells by serial passage. PAMs were maintained in RPMI 1640 growth medium (Flow), whereas CL2621 cells were maintained in Hanks'
minimal essential medium (Gibco-BRL/Life Technologies). Virus titers
(expressed as 50% tissue culture infective doses
[TCID50] per milliliter) were determined on PAMs or
CL2621 cells by end point dilution, as described previously (38). BHK-21 cells were maintained in Dulbecco's minimal
essential medium. For transfection experiments, the BHK-21 cells were
grown in Glasgow minimal essential medium (GIBCO-BRL/Life Technologies) by the method of Liljeström and Garoff (17).
Isolation of viral RNAs.
At 24 h after infection,
intracellular LV RNA was isolated from PAMs or CL2621 cells infected
with TH and LV4.2.1, respectively, at a multiplicity of infection of 1 as described previously (20). To isolate virion genomic RNA,
virions were purified on sucrose gradients as described by van
Nieuwstadt et al. (35) and were resuspended in TNE (10 mM
Tris-HCl [pH 7.2], 100 mM NaCl, 1 mM EDTA). A 1-ml volume of
proteinase K buffer (100 mM Tris-HCl [pH 7.2], 25 mM EDTA, 300 mM
NaCl, 2% [wt/vol] sodium dodecyl sulfate) and 0.4 mg of proteinase K
(Boehringer Mannheim) were added to 1 ml of purified LV virions
(108 TCID50). This reaction mixture was
incubated at 37°C for 30 min. The RNA was extracted once with
phenol-chloroform (1:1) and precipitated with ethanol. The RNA was
stored in ethanol at
20°C. One-tenth of this RNA preparation was
used in reverse transcription reactions.
Cloning of the 5' and 3' termini of the LV genome.
The 5'
end of the viral genome of LV was cloned by a modified single-strand
ligation to single-stranded cDNA procedure (11). Virion RNA,
prepared as described above, was used in a reverse transcription
reaction with primer 11U113 (5' TACAGGTGCCTGATCCAAGA 3'),
which is complementary to nucleotides 1242 to 1261 of the genome
of LV. The reverse transcription reaction was performed in a final
volume of 20 µl, as described previously (19). Then the
single-stranded cDNA was ligated to an anchor primer, ALG3 (5'
CACGAATTCACTATCGATTCTGGATCCTTC 3'), as specified in the protocol of the 5'-Amplifinder rapid amplification of cDNA ends kit (Clontech). Primer ALG3 contains EcoRI, ClaI, and
BamHI sites, and its 3' end is modified with an
amino-blocking group to prevent self-ligation. The ligated cDNA was
used as template in a PCR with primers LV69 (5'
AGGTCGTCGACGGGCCCCGTGATCGGGTACC 3') and ALG4 (5'
GAAGGATCCAGAATCGATAG 3'). Primer LV69 is complementary to
nucleotides 604 to 625 of the LV genome, whereas ALG4 is complementary
to anchor primer ALG3. The PCR conditions were as described by
Meulenberg et al. (19), and the product obtained was
digested with EcoRI and SalI and cloned in
pGEM-4Z. A similar strategy was used to clone the 5' terminus of the LV
genome from intracellular LV RNA. For these experiments, 10 µg of
total cellular RNA isolated from CL2621 cells infected with LV4.2.1 was
used.
A 3'-end cDNA clone containing a long poly(A) tail was constructed by
reverse transcription of LV RNA with primer LV76 [5' TCTAGGAATTCTAGACGATCG(T)403'], which contains
EcoRI, XbaI, and PvuI sites. The
reverse transcription reaction was followed by PCR with primers LV75
(5' TCTAGGAATTCTAGACGATCGT 3'), which is identical to LV76
except for the poly(T) stretch, and 39U70R (5' GGAGTGGTTAACCTCGTCAA 3'), a sense primer corresponding to
nucleotides 14576 to 14595 of the LV genome and containing an
HpaI site. The resulting PCR products were digested with
HpaI and EcoRI and cloned in cDNA clone pABV39
restricted with the same enzymes (see Fig. 2A). One cDNA clone
containing a poly(A) stretch of 109 A's (pABV392) was used in further
experiments.
Sequence analysis.
The correct genomic sequence of newly
generated cDNA clones was assessed by oligonucleotide sequencing.
Oligonucleotide sequences were determined with the PRISM Ready Reaction
Dye Deoxy Terminator cycle-sequencing kit and automatic sequencer
(Applied Biosystems).
Construction of full-length genomic cDNA clones of LV.
cDNA
clones generated previously to determine the nucleotide sequence of the
genome of LV (20) were ligated at convenient restriction
sites in high-copy-number plasmid pGEM-4Z (see Fig. 2A). Plasmid
pABV254 was constructed from pABV clones 25, 11, 12, and 100 and had
been used in a previous study (8). Standard cloning
procedures were carried out as described by Sambrook et al.
(29). Plasmid pABV369 is derived from pABV331 but encodes a
Leu instead of a Pro at amino acid 1084 in ORF1a and was generated by
substituting nucleotides 3413 to 3615 with a newly generated reverse
transcription-PCR fragment encoding the Leu residue. To establish
overlap between pABV20 and pABV5, two new cDNA fragments were generated
by reverse transcription-PCR. The XbaI site (incorporated in
the PCR primer), the internal ApoI site (nucleotide 6016), and the BamHI site (nucleotide 6750) were used to ligate
these fragments in pABV20 (see Fig. 2A). Since further ligation of cDNA fragments in pGEM-4Z resulted in unstable clones, the inserts of
pABV331/369, pABV384, and pABV368 were ligated to each other and to the
5' and 3' cDNA fragments in low-copy-number vector pOK12 (see Fig. 2B)
(36). The plasmids were transformed to Escherichia coli DH5
and grown at 32°C in the presence of 5 to 15 µg of
kanamycin per ml to keep their copy number as low as possible. First,
the cDNA fragment of pABV392 [(A)109] was excised by
digestion with EcoRI, modification of this site with Klenow
polymerase (Pharmacia) to a blunt end, and digestion with
BamHI. This fragment was cloned in pOK12 digested with
BamHI and FspI (the latter site was also modified
to a blunt end), resulting in pABV395. A 5' cDNA clone, which contained
the T7 RNA polymerase promoter directly fused to the newly determined
5' terminus of the LV genome, was amplified by PCR from pABV387 with
primers LV83 (5' GAATTCACTAGTTAATACGACTCACTATAGATGATGTGTAGGGTATTCC 3') and LV69. LV83 is composed of, in order from 5' to 3', an EcoRI site and a SpeI site, a T7 RNA polymerase
promoter sequence, a single G for initiation of transcription, and
nucleotides 1 to 19 of the LV genome. The PCR fragment was cloned in
the EcoRI and SalI sites of pOK12, resulting in
pABV396. Subsequently, the 5' cDNA fragment of pABV396 and the 3' cDNA
fragment of pABV395 were ligated to the cDNA fragments of pABV331/369,
pABV384, and pABV368, using the restriction sites indicated in Fig. 2B.
In this way, two genome-length cDNA clones were obtained; they were designated pABV414 and pABV416. These genome-length cDNA clones encode
identical viral protein sequences except for one amino acid at position
1084 in ORF1a, which is a Pro in pABV414 and a Leu in pABV416.
To introduce a unique PacI site in the genome-length cDNA
clone directly downstream of the ORF7 gene, the T and A at nucleotides 14987 and 14988 were both replaced by an A in a PCR with sense primer
LV108 (5' GGAGTGGTTAACCTCGTCAAGTATGGCCGGTAAAAACCAGAGCC 3')
plus antisense primer LV112 (5'
CCATTCACCTGACTGTTTAATTAACTTGCACCCTGA 3') and with sense primer
LV111 (5' TCAGGGTGCAAGTTAATTAAACAGTCAGGTGAATGG 3') plus
antisense primer LV75. The PCR fragments were ligated in pABV395 with
the created PacI site and flanking HpaI and
XbaI sites, resulting in pABV427. This fragment was then
inserted in pABV414 with the same unique HpaI and
XbaI sites, resulting in pABV437 (see Fig. 6A). To detect
the marker mutation in the virus recovered from transcripts of pABV437,
RNA was isolated from the supernatant of infected PAMs. This RNA was
used in reverse transcription-PCR to amplify a fragment of
approximately 0.6 kb [spanning nucleotide 14576 to the poly(A) tail of
variable length] with primers LV76, LV75, and 39U70R. The presence of
the genetic marker was detected by digesting the PCR fragments with
PacI.
In vitro transcription and transfection of RNA.
Full-length
genomic cDNA clones were linearized with PvuI, which is
located directly downstream of the poly(A) stretch. Plasmid pABV296,
consisting of Semliki Forest virus (SFV) vector pSFV1 expressing the
GP4 protein encoded by ORF4 of LV (23), served as control for in vitro transcription and transfection experiments and
was linearized with SpeI. The linearized plasmids were
precipitated with ethanol, and 1.5 µg of these plasmids was used for
in vitro transcription with T7 RNA polymerase (full-length cDNA clones) or Sp6 RNA polymerase (pABV296) by the methods described for SFV by
Liljeström and Garoff (16, 17). The in
vitro-transcribed RNA was precipitated with isopropanol, washed with
70% ethanol, and stored at
20°C until use.
BHK-21 cells were seeded in 35-mm wells (approximately 106
cells/well) and were transfected with 2.5 µg of in vitro-transcribed RNA or 2.5 µg of intracellular LV RNA mixed with 10 µl of
Lipofectin in Optimem as described by Liljeström and Garoff
(17). Alternatively, RNA was introduced into BHK-21 cells by
electroporation. In this case, 10 µg of in vitro-transcribed RNA or
10 µg of intracellular LV RNA was transfected to approximately
107 BHK-21 cells under the electroporation conditions of
Liljeström and Garoff (17). The electroporated cells
were seeded in four 35-mm wells. The medium was harvested 24 h
after transfection and transferred to CL2621 cells or PAMs to rescue
infectious virus. Transfected and infected cells were tested for the
expression of LV proteins by an immunoperoxidase monolayer assay
(IPMA), essentially as described by Wensvoort et al. (38).
Monoclonal antibodies (MAbs) 122.13, 122.59, 122.9, and 122.17, directed against the GP3, GP4, M, and N
proteins, respectively (35), were used for staining in this
assay.
 |
RESULTS |
Infectivity of LV RNA.
Although it has been assumed that
genomic RNA of LV is infectious, experiments to prove the infectivity
of genomic LV RNA had failed until now, because we were unable to
transfect PAMs with nucleic acids. Since cell line CL2621 and other
clones derived from the monkey kidney cell line MA-104 are the only
cells which were shown to propagate LV and other isolates of PRRSV
(1, 5, 13), we first tested these in transfection
experiments to demonstrate the infectivity of LV RNA. When
intracellular RNA isolated from CL2621 cells infected with LV was
transfected to CL2621 cells at different doses by using different
transfection reagents, such as Lipofectin, Lipofectamin, DEAE-dextran
or electroporation, no cythopathic effect or plaques were observed and
no production of structural proteins could be detected in IPMA with
LV-specific MAbs. RNA transcribed in vitro from pABV296 (23)
was used as control in these experiments. This RNA was transfected most
efficiently by electroporation. However, only 0.01% of the CL2621
cells stained with GP4-specific MAbs in IPMA. In contrast,
when BHK-21 cells were electroporated under similar conditions, 90 to
100% of the cells stained. Since these results indicated that BHK-21
cells were much more efficiently transfected than CL2621 cells, we used them to test the infectivity of LV RNA. Therefore, intracellular LV RNA
(2.5 µg, which was estimated to contain approximately 1 to 2 ng of LV
genomic RNA) was transfected to 106 BHK-21 cells with
Lipofectin. At 24 h after transfection, approximately 5 to 15 individual cells were stained with LV-specific MAbs, but no infectious
centers or plaques were observed, indicating that the LV did not spread
to neighboring cells (Fig. 1D). The
number of positive cells increased two- to fourfold when the RNA was transfected to BHK-21 cells by electroporation. Transfection of the
control RNA transcribed from pABV296 resulted in 10 to 30% stained
BHK-21 cells when Lipofectin was used (Fig. 1A). At 24 h after
transfection, the supernatant of the BHK-21 cells transfected with
intracellular LV RNA or pABV296 RNA was transferred to PAMs and CL2621
cells. Cythopathic effect was observed in PAM cultures at 2 days and in
CL2621 cultures at 3 to 4 days after inoculation with the supernatant
from BHK-21 cells transfected with intracellular LV RNA. The infected
PAMs and CL2621 cells were positively stained with LV-specific MAbs in
IPMA (Fig. 1E and F). Similar results were obtained when RNA isolated
from purified virions of LV was transfected to BHK-21 cells (data not
shown). No cythopathic effect or staining with LV-specific MAbs
directed against the N protein (Fig. 1B and C) or GP4 (data
not shown) was observed in PAMs or CL2621 cells incubated with the
supernatant from BHK-21 cells transfected with pABV296 RNA. This was
expected since the SFV vector used to construct pABV296 lacks the genes
encoding the structural proteins of SFV, which are needed for the
assembly of new virus particles. Therefore, these results show that
BHK-21 cells can be used to demonstrate the infectivity of LV RNA.
Although LV cannot infect BHK-21 cells, probably because they lack the receptor for LV, new infectious virus particles are produced and excreted into the medium once the genomic RNA has been introduced in
BHK-21 cells.

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 1.
Infectivity of LV RNA. BHK-21 cells were transfected
with pABV296 RNA (expressing GP4) (A) or LV intracellular
RNA (D) by using Lipofectin, and at 24 h posttransfection they
were stained in IPMA with GP4-specific MAb 122.59 (A) or
N-specific MAb122.17 (D). The supernatant of BHK-21 cells transfected
with pABV296 RNA or LV intracellular RNA was used to infect CL2621
cells (B and E) and PAMs (C and F). These PAMs and CL2621 cells were
stained after 2 and 3 days, respectively, with N-specific MAb122.17.
|
|
Reconstruction of the 5'-terminal sequence of the genomic RNA of
LV.
It is generally admitted that the entire viral sequence,
including the 5' and 3' ends, are required to obtain infectious clones. To clone the 5' end of the LV genome, a modified single-strand ligation
to single-stranded cDNA (11) procedure was used. Twelve clones obtained from two independent PCRs on ligated products derived
from LV intracellular RNA and 14 clones derived from two independent
PCRs on ligated products derived from virion RNA were sequenced. Of
these 26 cDNA clones, 22 clones contained an extension of 10 nucleotides (5' ATGATGTGTA 3') compared to the cDNA
sequence, which was reported in our previous study (20). The
other four clones lacked 1 to 3 nucleotides at the 5' end of this
additional sequence (Table 1). This led
us to conclude that this 10-nucleotide sequence represents the utmost
5' end of the LV genome and it was therefore incorporated in the
genome-length cDNA clone. Due to the extension of 10 nucleotides, the
numbers of nucleotides, the position of primers, and the restriction
sites in the genome have been changed and are therefore different from
the numbers used in previous papers.
Construction of genome-length cDNA clones of LV.
A
genome-length cDNA clone of LV was constructed by the strategy depicted
in Fig. 2. A T7 RNA polymerase promoter
for in vitro transcription was directly linked to the newly determined
5' terminus of the genome of LV by PCR and inserted in the
genome-length cDNA clone. Resequencing of nucleotides 3420 to 3725 of
six newly generated and independent cDNA clones indicated that at
nucleotide 3472 a C and T were present at a ratio of 1:1,
resulting in a Pro or Leu at amino acid residue 1084 in ORF1a. Since we
could not predict the influence of the amino acid substitution at this
position on the infectivity of the RNA transcribed from the final
genome-length cDNA clone, we constructed two genome-length cDNA clones
encoding either a Leu or a Pro at this position. At the 3' end, a
poly(A) stretch of 109 A residues was incorporated in the genome-length cDNA clone.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 2.
Construction of genome-length cDNA clones of LV. (A)
Ligation of cDNA clones, which were previously sequenced
(20), in pGEM-4Z. The pABV numbers of the clones and the
restriction sites that were used are indicated. The black boxes
represent the parts of the cDNA clones that are fused in the next
cloning step. Light grey boxes are cDNA clones newly generated by
reverse transcription-PCR (indicated by R.T.) or PCR only. Assembly of
the larger cDNA clones pABV331/369, pABV384, and pABV368 with the
5'-end clone pABV396, containing a T7 RNA polymerase promoter, and the
3'-end clone pABV395, containing a poly(A) tail, in low-copy-number
vector pOK12. Abbreviations: A, ApaI; Ap, ApoI;
B, BamHI; Bg, BglII; Bs, BspE1; Bc,
BclI; E, EcoRI; Ec, EcoRV; H,
HindIII; K, KpnI; N, NarI; Nc,
NcoI; S, SacII; Sp, SpeI; Sa,
SalI; Sc, ScaI; P, PstI; Pm,
PmlI; X, XbaI; Xh, XhoI; MCS,
multiple-cloning site.
|
|
We tried to ligate the larger cDNA fragments of the pABV331/369,
pABV384, and pABV368 clones to the 5' and 3' ends in pGEM-4Z, but this
resulted in the accumulation of deletions. Therefore, we finally fused
these clones to each other in the low-copy-number vector pOK12
(36) and obtained the genome-length cDNA clones pABV414 (Pro) and pABV416 (Leu). These could be stably propagated in E. coli under the growth conditions used.
In vitro synthesis of infectious RNA.
Transcripts of
genome-length cDNA clones pABV414 and pABV416 were transfected to
BHK-21 cells to test their infectivity. These transcripts, synthesized
in vitro with T7 RNA polymerase, were expected to contain two nonviral
nucleotides at the 3' end (Fig. 3). In
addition, they were expected to contain a nonviral G at the 5' end,
which is the transcription start site of T7 RNA polymerase. Approximately 2.5 µg of RNA transcribed in vitro from pABV414 or
pABV416 was transfected to BHK-21 cells with Lipofectin, and at 24 h after the transfection, 800 to 2,700 cells stained positive with
N-protein-specific MAb122.17 in IPMA (Fig. 4A and
D). PAMs that were inoculated with the
supernatant derived from BHK-21 cells transfected with transcripts of
pABV414 or pABV416 displayed a cythopathic effect after 2 days.
Individual plaques were produced after 3 to 4 days in CL2621 cultures
that were inoculated with either of the supernatants. The infected PAMs
and CL2621 cells stained in the IPMA with MAb122.17 directed against
the N protein (Fig. 4B, C, E, and F) and with MAbs directed against the
M, GP4, and GP3 proteins (data not shown),
confirming that these proteins were all properly expressed. No
cythopathic effect or staining in IPMA was observed in CL2621 cultures
or PAMs that were incubated with the supernatant of BHK-21 cells
transfected with pABV296 RNA (negative control). Therefore, these
results clearly show that when RNA transcribed from genome-length
cDNA clones pABV414 and pABV416 is transfected to BHK-21 cells with
Lipofectin, infectious LV is produced and excreted. Moreover,
when transcripts of pABV414 or pABV416 were transfected to BHK-21
cells by electroporation instead of by Lipofectin complexes, a two- to
fourfold increase in the number of cells staining positive with
LV-specific MAbs was obtained. The titer of the recombinant viruses in
the supernatant of these electroporated BHK-21 cells was approximately
105 TCID50/ml.

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 3.
Terminal sequences of cloned genome-length cDNA of LV
and infectious RNA transcribed from this cDNA. Genome-length cDNA
clones pABV414 and pABV416 were linearized with PvuI and
were transcribed in the presence of the synthetic cap analog
m7G(5')ppp(5')G with T7 RNA polymerase. The resulting RNA
should contain one extra nucleotide (G) at the 5' end and two extra
nucleotides (CG) at the 3' end. The arrows in the RNA indicate the 5'-
and 3'-terminal nucleotides corresponding to the authentic LV RNA
sequence. The cDNA fragments of pABV414 and pABV416 encode identical
viral protein sequences except for one amino acid at position 1084 in
ORF1a, which is a Pro in pABV414 and a Leu in pABV416.
|
|

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 4.
Infectivity of transcripts from genome-length cDNA
clones pABV414 and pABV416. BHK-21 cells were transfected with
transcripts from pABV414 (A) or pABV416 (D) with lipofectin and were
stained at 24 h posttransfection with N-specific MAb122.17 in
IPMA. The supernatant of these transfected BHK-21 cells was used to
infect CL2621 cells (B and E) and PAMs (C and F). These PAMs and CL2621
cells were stained after 2 and 3 days, respectively, with N-specific
MAb122.17.
|
|
Growth characteristics of rescued virus.
The initial
transfection and infection experiments suggested that the rescued
recombinant viruses, designated vABV414 and vABV416, infect and grow
equally well in PAMs but grow more slowly on CL2621 cells than does the
virus rescued from BHK-21 cells transfected with intracellular LV RNA
(compare Fig. 1E with Fig. 4B and E, and compare Fig. 1F with Fig. 4C
and F). This intracellular LV RNA was isolated from CL2621 cells
infected with LV4.2.1, which has been adapted for growth on CL2621
cells. To study the growth properties of vABV414 and
vABV416 more thoroughly, growth curves were determined and were
compared with those of wild-type LV that has been passaged only on PAMs
(TH) and with those of LV4.2.1 grown on CL2621 cells. CL2621 cells and
PAMs were infected at a multiplicity of infection of 0.05 with these
viruses. The culture media were harvested at various intervals, and
virus titers were determined by end point dilution on macrophages. The
growth rates of the two recombinant viruses did not differ in PAMs; the
viruses grew equally well regardless of whether they were derived
directly from BHK-21 or further passaged in PAMs (Fig.
5A). The titers of vABV416 derived from
BHK-21 were higher than those of vABV416 derived from PAMs, when grown
in CL2621 cells (Fig. 5B). Since a similar difference was not observed
for vABV414, its biological significance remains unclear. The titers of
the recombinant viruses (7.1 to 7.9 TCID50/ml) in PAMs
peaked around 32 h postinfection, whereas the titers in CL2621
were lower and had not yet peaked even at 96 h postinfection. TH
virus had similar growth characteristics to the recombinants. In
contrast, the CL2621-adapted virus LV4.2.1 grew faster on CL2621 cells
than did the viruses vABV414, vABV416, and TH (Fig. 5B). This confirmed
the larger plaque size of this virus than that of vABV414, vABV416, and
TH observed in CL2621 cells. In summary, these results demonstrate that
the growth properties of the recombinant viruses are similar to those
of the TH virus. This was expected, since the cDNA sequence used to
construct the infectious clones was derived from the parental
"nonadapted" TH virus.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 5.
Growth curves of LV wild-type virus TH, LV4.2.1, and
recombinant viruses vABV414 and vABV416 in PAMs (A) and CL2621 cells
(B). The recombinant viruses vABV414 and vABV416 produced in BHK-21
cells were either used directly (BHK) or used after multiplication in
PAMs (PAM). The TH virus was prepared in PAMs (PAM), whereas LV4.2.1
was prepared in CL2621 cells (CL). The cell cultures were infected in
duplicate with the indicated viruses at a multiplicity of infection of
0.05 and harvested at the indicated time points. Virus titers were
determined on PAMs by end point dilution, as described previously
(38). The mean titers of two independent experiments are
shown for each time point. The pooled standard deviation was ±0.2 log
TCID50/ml.
|
|
Introduction of a genetic marker in the infectious clone of
LV.
To demonstrate that the genome-length cDNA clone can be used
to generate mutant LV strains, a unique PacI site was
introduced directly downstream of the ORF7 gene by PCR-directed
mutagenesis (Fig. 6A). When RNA
transcribed from the genome-length cDNA clone pABV437 containing the
PacI site was transfected to BHK-21 cells and the
supernatant was transferred to PAMs and CL2621 cells 24 h after
transfection, infectious virus was produced. The rescued virus,
vABV437, had similar growth properties in PAMs and CL2621 cells to the
parental virus, vABV414 (data not shown). A specific region of
approximately 0.6 kb [nucleotide 14576 to the poly(A) tail] was
amplified by reverse transcription-PCR of viral RNA isolated from the
supernatant of PAMs infected with vABV414 and vABV416. Digestion with
PacI showed that this restriction site was indeed present in
the fragment derived from vABV437 but was absent from the fragment
derived from vABV414 (Fig. 6B). Therefore, we were able to exclude the
possibility of contamination with wild-type virus and hence we
confirmed the identity of vABV437.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 6.
(A) Introduction of a unique PacI site in the
infectious cDNA clone of LV. The PacI site was created by
PCR-directed mutagenesis, as described in detail in Materials and
Methods. The cDNA fragment containing the PacI site was
exchanged in pABV414 by using its unique HpaI and
XbaI sites, which are indicated. This resulted in pABV437.
UTR, untranslated region (B) Identification of the PacI
marker in recombinant virus vABV437. In vitro transcripts synthesized
from pABV437 were transfected to BHK-21 cells. The supernatant
containing the recombinant virus vABV437 was harvested 24 h after
transfection. A fragment of approximately 0.6 kb was amplified by
reverse transcription-PCR from RNA extracted from recombinant virus
vABV437 and its parent vABV414. The PCR fragments were digested with
PacI and analyzed together with undigested fragments on a
1.5% agarose gel. Lane C represents a control PCR lacking template
DNA; lane M shows the size markers in kilobases.
|
|
 |
DISCUSSION |
In this study, we generated for the first time an infectious clone
of the LV isolate of PRRSV. In most instances, a prerequisite for the
construction of infectious clones is the identification of the
sequences at the termini of the respective viral genome, which are
usually crucial for replication of viral RNA (2, 7, 14, 30).
In a previous report, it was shown that LV contains a poly(A) tail at
the 3' end (20). In the present study, the exact 5' end of
the LV genome was determined by ligation of an oligonucleotide with a
specified sequence to a first-strand primer extension product and
amplification by PCR. An extension of 10 nucleotides (ATGATGTGTA)
with respect to the published sequence was found in several
independent clones and was therefore assumed to represent the utmost 5'
end of the viral genome. Addition of this 10-nucleotide sequence to the
5' cDNA sequences determined previously (20) formed a
complete leader sequence of 221 nucleotides, which is similar in length
to the leader of EAV (207 nucleotides) (9) and simian
hemorrhagic fever virus (208 nucleotides) (40) but longer
than the leader of lactate dehydrogenase-elevating virus (LDV) (155 nucleotides) (4). However, no significant identity exists
between the leader sequences of these closely related arteriviruses.
The newly determined 5'-terminal sequence ligated to cDNA fragments
covering the entire LV genome resulted in a genome-length cDNA clone of
15.2 kb, from which infectious transcripts could be produced. The
infectious clone, described here, is to our knowledge the longest
infectious clone of a positive-strand RNA virus thus far developed.
Recently, an infectious clone of another arterivirus, EAV, has been
reported which is 12.7 kb in length (34). A major problem
with the generation of infectious clones is the instability of the
virus sequences when cloned in high-copy-number plasmids in bacteria
(15, 24, 28, 33). Although initial attempts to assemble a
genome-length cDNA clone of LV in high-copy-number plasmid pGEM-4Z
failed, the genomic cDNA fragment of 15,207 nucleotides remained stable
in low-copy-number plasmid pOK12. However, in subsequent cloning
experiments to introduce mutations in the genome-length cDNA clone, we
often observed deletions and a decrease in the length of the poly(A)
stretch. Our results showed that an extra nonviral G at the 5' end as
well as a nonviral CG at the 3' end of transcripts of the genome-length
cDNA clones of LV did not keep them from being infectious. However,
transcripts of full-length cDNA of LV lacking a cap structure were not
infectious (data not shown). This indicated that the cap structure is
most probably essential for translation of the genomic RNA. No
significant difference in the stability of the RNAs transcribed in
vitro in the presence or absence of the cap was observed. The
infectivity of genomic RNA or transcripts of infectious cDNA clones of
other positive-strand RNA viruses has always been tested in cell lines
that are susceptible to the virus. This was not possible for LV, due to
the poor transfection efficiency of CL2621 cells and PAMs. However,
transfection of transcripts from full-length cDNA clones, intracellular
LV RNA, and virion RNA to BHK-21, a cell line which is not susceptible to infection with LV, resulted in the production and release of infectious virus, which could be rescued in CL2621 cells and PAMs. The
specific infectivity of these transcripts by using Lipofectin was
roughly 400 to 1,500 positive cells per µg of RNA. This specific infectivity was two- to fourfold higher in transfections performed by
electroporation. It should be mentioned that on the basis of our
experiments, the specific infectivity of the infectious transcripts cannot be compared exactly with that of authentic LV RNA, since (i) the
intracellular LV RNA used for transfections contained only a very small
fraction (roughly estimated to be 0.05 to 0.1%) of genomic LV RNA;
(ii) the amount of genomic RNA isolated from virions, which was used
for transfections was too small to allow accurate quantification; and
(iii) the infectivity of RNA in BHK-21 cells was measured by detecting
the expression of structural proteins in IPMA with LV-specific MAbs,
which does not necessarily correlate with the production of infectious
virus. However, it was clear that the specific infectivity of
transcripts from infectious cDNA clones of LV was much lower than that
of SFV cDNAs, which were used for comparison. Since infectious virus is
produced when LV RNA is transfected into BHK-21 cells but not when
these cells are inoculated with LV particles, we hypothesize that it is
impossible for LV to enter BHK-21 cells because these cells lack the
receptor of LV. A similar difference in the infectivity of LDV and its virion RNA in various cell types has been observed (12). The growth properties of the two recombinant viruses vABV414 and vABV416, which differ only at one amino acid at position 1084 in ORF1a (Pro
versus Leu), were similar to those of the parental TH strain, from
which the cDNA was originally derived. The wild-type nature of these
viruses still has to be confirmed by experimental infection of pigs.
The unique PacI site, which was introduced in the infectious
clone downstream of the ORF7 gene at the 5' end of the 3' untranslated region of LV, will facilitate the insertion of mutations in the ORFs
encoding structural proteins. The virus that could be recovered from
this mutated full-length clone had the same growth properties as its
parent. This demonstrates that the infectious clone of LV is an
excellent tool for site-directed mutagenesis and is an important
finding for future projects whose aim is to construct new live vaccines
against PRRSV. It might be helpful to develop a so-called marker
vaccine by mutagenesis of the genome, so that vaccinated pigs can be
distinguished from field virus-infected pigs on the basis of
differences in serum antibodies. In addition, the infectious clone of
LV might open new opportunities for studies directed at the
pathogenesis, host tropism, replication, and transcription of this
virus. Arteriviruses and coronaviruses share a discontinuous transcription mechanism, which involves the generation of a nested set
of subgenomic RNAs containing a common 5' leader (27, 32). This specific transcription mechanism is a complex process, which is
not yet fully understood. Studies by coronavirus virologists to
elucidate the underlying mechanism of leader-primed transcription are
restricted to analyses and site-directed mutagenesis of cDNAs of
defective interfering RNAs, since the large size of the genome (28 to
30 kb) has impeded the construction of an infectious clone. The
infectious clone of the LV isolate of PRRSV might provide a model
system to study and unravel the intriguing mechanism of transcription
and replication of arteriviruses and coronaviruses.
 |
ACKNOWLEDGMENTS |
This work was supported by Boehringer, Ingelheim, Germany.
We thank J. Castrop for critical reading of the manuscript and F. van
Poelwijk for fruitful discussions.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute for
Animal Science and Health, P.O. Box 365, NL-8200 AJ Lelystad, The
Netherlands. Phone: 31-320238804. Fax: 31-320238668. E-mail:
J.J.M.Meulenberg{at}id.dlo.nl.
 |
REFERENCES |
| 1.
|
Benfield, D. A. E.,
E. Nelson,
J. E. Collins,
L. Harris,
S. M. Goyal,
D. Robison,
W. T. Christianson,
R. B. Morrison,
D. E. Gorcyca, and D. W. Chladek.
1992.
Characterization of swine infertility and respiratory syndrome virus (isolate ATCC-VR2332) J.
Vet. Diagn. Invest.
4:127-133.
|
| 2.
|
Boyer, J., and A. Haenni.
1994.
Infectious transcripts and cDNA clones of RNA viruses.
Virology
198:415-426[Medline].
|
| 3.
|
Cavanagh, D.
1997.
Nidovirales: a new order comprising Coronaviridae and Arteriviridae.
Arch. Virol.
142:629-633[Medline].
|
| 4.
|
Chen, Z.,
K. S. Faaberg, and P. G. W. Plagemann.
1994.
Determination of the 5' end of the lactate dehydrogenase-elevating virus genome by two independent approaches.
J. Gen. Virol.
75:925-930[Abstract/Free Full Text].
|
| 5.
|
Collins, J. E.,
D. A. Benfield,
W. T. Christianson,
L. Harris,
J. C. Hennings,
D. P. Shaw,
S. M. Goyal,
S. McCullough,
R. B. Morrison,
H. S. Joo,
D. E. Gorcyca, and D. W. Chladek.
1992.
Isolation of swine infertility and respiratory syndrome virus (isolate ATCC-VR-2332) in North America and experimental reproduction of the disease in gnotobiotic pigs.
J. Vet. Diagn. Invest.
4:117-126[Abstract/Free Full Text].
|
| 6.
|
Conzelmann, K. K.,
N. Visser,
P. van Woensel, and H. J. Tiel.
1993.
Molecular characterization of porcine reproductive and respiratory syndrome virus, a member of the Arterivirus group.
Virology
193:329-339[Medline].
|
| 7.
|
Davis, N. L.,
L. V. Willis,
J. F. Smith, and R. E. Johnston.
1989.
In vitro synthesis of infectious Venezuelan equine encephalitis virus RNA of an insect virus.
Proc. Natl. Acad. Sci. USA
83:63-66.
|
| 8.
|
den Boon, J. A.,
K. S. Faaberg,
J. J. M. Meulenberg,
A. L. M. Wassenaar,
P. G. M. Plagemann,
A. E. Gorbalenya, and E. J. Snijder.
1995.
Processing and evolution of the N-terminal region of the arterivirus replicase ORF1a protein: identification of two papainlike cysteine proteases.
J. Virol.
69:4500-4505[Abstract].
|
| 9.
|
den Boon, J. A.,
E. J. Snijder,
E. D. Chirnside,
A. A. F. de Vries,
M. C. Horzinek, and W. J. M. Spaan.
1991.
Equine arteritis virus is not a togavirus but belongs to the coronavirus superfamily.
J. Virol.
65:2910-2920[Abstract/Free Full Text].
|
| 10.
|
Deng, R., and R. Wu.
1981.
An improved procedure for utilizing terminal transferase to add homopolymers to the 3' termini of DNA.
Nucleic Acids Res.
9:4173-4188[Abstract/Free Full Text].
|
| 11.
|
Edwards, J. B. D. M.,
J. Delort, and J. Mallet.
1991.
Oligodeoxyribonucleotide ligation to single-stranded cDNAs: a new tool for cloning 5' ends of mRNAs and for constructing cDNA libraries by in vitro amplification.
Nucleic Acids Res.
19:5227-5232[Abstract/Free Full Text].
|
| 12.
|
Inada, T.,
H. Kikuchi, and S. Yamazaki.
1993.
Comparison of the ability of lactate dehydrogenase-elevating virus and its virion RNA to infect murine leukemia virus-infected or -uninfected cell lines.
J. Virol.
67:5698-5703[Abstract/Free Full Text].
|
| 13.
|
Kim, H. S.,
J. Kwang, and I. Y. Yoon.
1993.
Enhanced replication of porcine reproductive and respiratory syndrome virus in a homogeneous subpopulation of MA-104 cell line.
Arch. Virol.
133:477-483[Medline].
|
| 14.
|
Klump, W. M.,
I. Bergmann,
B. C. Muller,
D. Ameis, and R. Kandolf.
1990.
Complete nucleotide sequence of infectious coxsackie-virus B3 cDNA: two initial 5' uridine residues are regained during plus-strand RNA synthesis.
J. Virol.
64:1573-1583[Abstract/Free Full Text].
|
| 15.
|
Lai, C. J.,
B. Zhao,
H. Hori, and M. Bray.
1991.
Infectious RNA transcribed from stably cloned full-length cDNA of dengue type 4 virus.
Proc. Natl. Acad. Sci. USA
88:5139-5143[Abstract/Free Full Text].
|
| 16.
|
Liljeström, P., and H. Garoff.
1991.
A new generation of animal cell expression vectors based on the Semliki Forest virus replicon.
Bio/Technol.
9:1356-1361.
|
| 17.
|
Liljeström, P., and H. Garoff.
1993.
Expression of proteins using Semliki Forest virus vectors, p. 16.xx. 1-16.xx.00. In
F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. A. Smith, J. G. Seidman, and K. Struhl (ed.), Current protocols in molecular biology.
Greene Publishing Associates and Wiley Interscience, New York, N.Y.
|
| 18.
|
Mardassi, H.,
B. Massie, and S. Dea.
1996.
Intracellular synthesis, processing and transport of proteins encoded by ORFs 5 to 7 of porcine reproductive and respiratory syndrome virus.
Virology
221:98-112[Medline].
|
| 19.
|
Meulenberg, J. J. M.,
E. J. de Meijer, and R. J. M. Moormann.
1993.
Subgenomic RNAs of Lelystad virus contain a conserved junction sequence.
J. Gen. Virol.
74:1697-1701[Abstract/Free Full Text].
|
| 20.
|
Meulenberg, J. J. M.,
M. M. Hulst,
E. J. de Meijer,
P. L. J. M. Moonen,
A. den Besten,
E. P. de Kluyver,
G. Wensvoort, and R. J. M. Moormann.
1993.
Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome (PEARS) is related to LDV and EAV.
Virology
192:62-74[Medline].
|
| 21.
|
Meulenberg, J. J. M., and A. Petersen-den Besten.
1996.
Identification and characterization of a sixth structural protein of Lelystad virus: the glycoprotein GP2 encoded by ORF2 is incorporated in virus particles.
Virology
225:44-51[Medline].
|
| 22.
|
Meulenberg, J. J. M.,
A. Petersen-den Besten,
E. P. de Kluyver,
R. J. M. Moormann, and G. Wensvoort.
1995.
Characterization of proteins encoded by ORFs 2 to 7 of Lelystad virus.
Virology
206:155-163[Medline].
|
| 23.
|
Meulenberg, J. J. M.,
A. P. van Nieuwstadt,
A. van Essen-Zandbergen, and A. J. P. M. Langeveld.
1997.
Post-translational processing and identification of a neutralization site of the GP4 protein encoded by ORF4 of Lelystad virus.
J. Virol.
71:6061-6067[Abstract].
|
| 24.
|
Moormann, R. J. M.,
H. G. P. van Gennip,
G. K. W. Miedema,
M. M. Hulst, and P. A. van Rijn.
1996.
Infectious RNA transcribed from an engineered full-length cDNA template of the genome of a pestivirus.
J. Virol.
70:763-770[Abstract].
|
| 25.
|
Murtaugh, M. P.,
M. R. Elam, and L. T. Kakach.
1995.
Comparison of the structural protein coding sequences of the VR-2332 and Lelystad virus strains of the PRRS virus.
Arch. Virol.
140:1451-1460[Medline].
|
| 26.
|
Nelson, E. A.,
J. Christopher-Hennings,
T. Drew,
G. Wensvoort,
J. E. Collins, and D. A. Benfield.
1993.
Differentiation of United States and European isolates of porcine reproductive and respiratory syndrome virus by monoclonal antibodies.
J. Clin. Microbiol.
31:3184-3189[Abstract/Free Full Text].
|
| 27.
|
Plagemann, P. G. W., and V. Moennig.
1991.
Lactate dehydrogenase-elevating virus, equine arteritis virus, and simian hemorrhagic fever virus: a new group of positive-strand RNA viruses.
Adv. Virus Res.
41:99-192.
|
| 28.
|
Rice, C. M.,
R. Levis,
J. H. Strauss, and H. V. Huang.
1987.
Production of infectious RNA transcripts from Sindbis virus cDNA clones: mapping of lethal mutations, rescue of a temperature-sensitive marker, and in vitro mutagenesis to generate defined mutants.
J. Virol.
61:3809-3819[Abstract/Free Full Text].
|
| 29.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 30.
|
Sarnow, P.
1989.
Role of 3'-end sequences in infectivity of poliovirus transcripts made in vitro.
J. Virol.
63:467-470[Abstract/Free Full Text].
|
| 31.
|
Snijder, E. J., and M. C. Horzinek.
1993.
Toroviruses: replication, evolution and comparison with other members of the coronavirus-like superfamily.
J. Gen. Virol.
74:2305-2316[Abstract/Free Full Text].
|
| 32.
|
Spaan, W. J. M.,
D. Cavanagh, and M. C. Horzinek.
1988.
Coronaviruses: structure and genome expression.
J. Gen. Virol.
69:2939-2952[Abstract/Free Full Text].
|
| 33.
|
Sumiyoshi, H.,
C. H. Hoke, and D. W. Trent.
1992.
Infectious Japanese encephalitis virus RNA can be synthesized from in vitro-ligated cDNA templates.
J. Virol.
66:5425-5431[Abstract/Free Full Text].
|
| 34.
|
van Dinten, L. C.,
J. A. den Boon,
A. L. M. Wassenaar,
W. J. M. Spaan, and E. J. Snijder.
1997.
An infectious arterivirus cDNA clone: identification of a replicase point mutation that abolishes discontinuous mRNA transcription.
Proc. Natl. Acad. Sci. USA
94:991-996[Abstract/Free Full Text].
|
| 35.
|
van Nieuwstadt, A. P.,
J. J. M. Meulenberg,
A. van Essen-Zandbergen,
A. Petersen-den Besten,
R. J. Bende,
R. J. M. Moormann, and G. Wensvoort.
1996.
Proteins encoded by ORFs 3 and 4 of the genome of Lelystad virus (Arteriviridae) are structural proteins of the virion.
J. Virol.
70:4767-4772[Abstract].
|
| 36.
|
Viera, J., and J. Messing.
1991.
New pUC-derived cloning vectors with different selectable markers and DNA replication origins.
Gene
100:189-194[Medline].
|
| 37.
|
Wensvoort, G.,
E. P. de Kluyver,
E. A. Luijtze,
A. den Besten,
L. Harris,
J. E. Collins,
W. T. Christianson, and D. Chladek.
1992.
Antigenic comparison of Lelystad virus and swine infertility and respiratory (SIRS) virus.
J. Vet. Diagn. Invest.
4:134-138[Abstract/Free Full Text].
|
| 38.
|
Wensvoort, G.,
C. Terpstra,
J. Boonstra,
M. Bloemraad, and D. van Zaane.
1986.
Production of monoclonal antibodies against swine fever virus and their use in laboratory diagnosis.
Vet. Microbiol.
12:101-108[Medline].
|
| 39.
|
Wensvoort, G.,
C. Terpstra,
J. M. A. Pol,
E. A. ter Laak,
M. Bloemraad,
E. P. de Kluyver,
C. Kragten,
L. van Buiten,
A. den Besten,
F. Wagenaar,
J. M. Broekhuijsen,
P. L. J. M. Moonen,
T. Zetstra,
E. A. de Boer,
H. J. Tibben,
M. F. de Jong,
P. van 't Veld,
G. J. R. Groenland,
J. A. van Gennep,
M. T. Voets,
J. H. M. Verheijden, and J. Braamskamp.
1991.
Mystery swine disease in the Netherlands: the isolation of Lelystad virus.
Vet. Q.
13:121-130[Medline].
|
| 40.
|
Zeng, L.,
E. K. Godeny,
S. L. Methven, and M. A. Brinton.
1995.
Analysis of simian hemorrhagic fever virus (SHFV) subgenomic RNAs, junction sequences and 5' leader.
Virology
207:543-548[Medline].
|
J Virol, January 1998, p. 380-387, Vol. 72, No. 1
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lv, J., Zhang, J., Sun, Z., Liu, W., Yuan, S.
(2008). An infectious cDNA clone of a highly pathogenic porcine reproductive and respiratory syndrome virus variant associated with porcine high fever syndrome. J. Gen. Virol.
89: 2075-2079
[Abstract]
[Full Text]
-
Kroese, M. V., Zevenhoven-Dobbe, J. C., Bos-de Ruijter, J. N. A., Peeters, B. P. H., Meulenberg, J. J. M., Cornelissen, L. A. H. M., Snijder, E. J.
(2008). The nsp1{alpha} and nsp1 papain-like autoproteinases are essential for porcine reproductive and respiratory syndrome virus RNA synthesis. J. Gen. Virol.
89: 494-499
[Abstract]
[Full Text]
-
Calvert, J. G., Slade, D. E., Shields, S. L., Jolie, R., Mannan, R. M., Ankenbauer, R. G., Welch, S.-K. W.
(2007). CD163 Expression Confers Susceptibility to Porcine Reproductive and Respiratory Syndrome Viruses. J. Virol.
81: 7371-7379
[Abstract]
[Full Text]
-
van den Born, E., Posthuma, C. C., Knoops, K., Snijder, E. J.
(2007). An infectious recombinant equine arteritis virus expressing green fluorescent protein from its replicase gene. J. Gen. Virol.
88: 1196-1205
[Abstract]
[Full Text]
-
Fang, Y., Rowland, R. R. R., Roof, M., Lunney, J. K., Christopher-Hennings, J., Nelson, E. A.
(2006). A Full-Length cDNA Infectious Clone of North American Type 1 Porcine Reproductive and Respiratory Syndrome Virus: Expression of Green Fluorescent Protein in the Nsp2 Region. J. Virol.
80: 11447-11455
[Abstract]
[Full Text]
-
Pasternak, A. O., Spaan, W. J. M., Snijder, E. J.
(2006). Nidovirus transcription: how to make sense...?. J. Gen. Virol.
87: 1403-1421
[Abstract]
[Full Text]
-
Ansari, I. H., Kwon, B., Osorio, F. A., Pattnaik, A. K.
(2006). Influence of N-Linked Glycosylation of Porcine Reproductive and Respiratory Syndrome Virus GP5 on Virus Infectivity, Antigenicity, and Ability To Induce Neutralizing Antibodies.. J. Virol.
80: 3994-4004
[Abstract]
[Full Text]
-
Choi, Y.-J., Yun, S.-I., Kang, S.-Y., Lee, Y.-M.
(2006). Identification of 5' and 3' cis-Acting Elements of the Porcine Reproductive and Respiratory Syndrome Virus: Acquisition of Novel 5' AU-Rich Sequences Restored Replication of a 5'-Proximal 7-Nucleotide Deletion Mutant. J. Virol.
80: 723-736
[Abstract]
[Full Text]
-
van den Born, E., Posthuma, C. C., Gultyaev, A. P., Snijder, E. J.
(2005). Discontinuous Subgenomic RNA Synthesis in Arteriviruses Is Guided by an RNA Hairpin Structure Located in the Genomic Leader Region. J. Virol.
79: 6312-6324
[Abstract]
[Full Text]
-
Zevenhoven-Dobbe, J. C., Greve, S., van Tol, H., Spaan, W. J. M., Snijder, E. J.
(2004). Rescue of disabled infectious single-cycle (DISC) Equine arteritis virus by using complementing cell lines that express minor structural glycoproteins. J. Gen. Virol.
85: 3709-3714
[Abstract]
[Full Text]
-
Vanderheijden, N., Delputte, P. L., Favoreel, H. W., Vandekerckhove, J., Van Damme, J., van Woensel, P. A., Nauwynck, H. J.
(2003). Involvement of Sialoadhesin in Entry of Porcine Reproductive and Respiratory Syndrome Virus into Porcine Alveolar Macrophages. J. Virol.
77: 8207-8215
[Abstract]
[Full Text]
-
Nielsen, H. S., Liu, G., Nielsen, J., Oleksiewicz, M. B., Botner, A., Storgaard, T., Faaberg, K. S.
(2003). Generation of an Infectious Clone of VR-2332, a Highly Virulent North American-Type Isolate of Porcine Reproductive and Respiratory Syndrome Virus. J. Virol.
77: 3702-3711
[Abstract]
[Full Text]
-
Snijder, E. J., Dobbe, J. C., Spaan, W. J. M.
(2003). Heterodimerization of the Two Major Envelope Proteins Is Essential for Arterivirus Infectivity. J. Virol.
77: 97-104
[Abstract]
[Full Text]
-
Verheije, M. H., Olsthoorn, R. C. L., Kroese, M. V., Rottier, P. J. M., Meulenberg, J. J. M.
(2002). Kissing Interaction between 3' Noncoding and Coding Sequences Is Essential for Porcine Arterivirus RNA Replication. J. Virol.
76: 1521-1526
[Abstract]
[Full Text]
-
Verheije, M. H., Kroese, M. V., Rottier, P. J. M., Meulenberg, J. J. M.
(2001). Viable porcine arteriviruses with deletions proximal to the 3' end of the genome. J. Gen. Virol.
82: 2607-2614
[Abstract]
[Full Text]
-
Rebel, J. M. J., Leendertse, C. H., Dekker, A., van Poelwijk, F., Moormann, R. J. M.
(2000). Construction of a full-length infectious cDNA clone of swine vesicular disease virus strain NET/1/92 and analysis of new antigenic variants derived from it. J. Gen. Virol.
81: 2763-2769
[Abstract]
[Full Text]
-
Ziebuhr, J., Snijder, E. J., Gorbalenya, A. E.
(2000). Virus-encoded proteinases and proteolytic processing in the Nidovirales. J. Gen. Virol.
81: 853-879
[Full Text]
-
Allende, R, Lewis, T., Lu, Z, Rock, D., Kutish, G., Ali, A, Doster, A., Osorio, F.
(1999). North American and European porcine reproductive and respiratory syndrome viruses differ in non-structural protein coding regions. J. Gen. Virol.
80: 307-315
[Abstract]
-
Nelsen, C. J., Murtaugh, M. P., Faaberg, K. S.
(1999). Porcine Reproductive and Respiratory Syndrome Virus Comparison: Divergent Evolution on Two Continents. J. Virol.
73: 270-280
[Abstract]
[Full Text]