Previous Article | Next Article 
J Virol, January 1998, p. 366-379, Vol. 72, No. 1
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Defective Growth Correlates with Reduced Accumulation of a Viral
DNA Replication Protein after Low-Multiplicity Infection by a Human
Cytomegalovirus ie1 Mutant
Richard F.
Greaves1,* and
Edward S.
Mocarski2
Department of Medicine, Cambridge University
Clinical School, Addenbrookes Hospital, Cambridge CB2 2QQ, United
Kingdom,1 and
Department of Microbiology
and Immunology, Stanford University School of Medicine, Stanford,
California 94305-54022
Received 26 June 1997/Accepted 19 September 1997
 |
ABSTRACT |
To investigate the importance of the IE1 p72 regulatory protein
during human cytomegalovirus replication, a recombinant virus unable to
synthesize IE1 p72 was constructed. The Towne strain mutant CR208
lacked exon 4 of the major immediate-early gene and was isolated and
complemented in an IE1-expressing immortalized human fibroblast line
(ihfie1.3). Replication of CR208 in primary human fibroblasts was
completed after an input multiplicity of 10 PFU/cell but was severely
impaired at 0.1 PFU/cell. CR208 formed plaques with lower efficiency on
primary fibroblasts than on ihfie1.3 cells, and the relationship
between the CR208 inoculum size and the resulting number of undersized
plaques was nonlinear, indicating that multiple particles of CR208 were
required to initiate lytic replication in a single primary fibroblast.
After infection of primary fibroblasts with CR208 at 5 PFU/cell, a
normal pattern of viral antigens was detected, although IE1 p72 was
absent. During lower-multiplicity infections, IE2 protein was
consistently detected at similar levels in a similar proportion of
CR208-infected cells relative to the case for a Towne infection, but
many fewer CR208-infected cells contained the ppUL44 polymerase
accessory protein when evaluated at 24 or 48 h after infection.
Furthermore, fibroblasts infected with CR208 at a low multiplicity
failed to form viral DNA replication compartments, despite having
expressed IE2 p86. These low-multiplicity growth and expression defects
were corrected in two rescued derivatives of CR208 able to synthesize
IE1 p72. One rescued virus (CR249) carried a deletion removing the
large intron between exons 1 and 2 of the ie1-ie2 locus,
revealing that this intron was dispensable for growth in cell culture.
 |
INTRODUCTION |
Human cytomegalovirus (HCMV) is a
widespread herpesvirus, which infects 50 to 100% of the human
population. HCMV disease is a significant medical problem, although it
is mostly restricted to patients with immature or compromised immune
systems (5). HCMV gene expression during productive
infection of cultured human fibroblast cells follows an ordered cascade
of expression of immediate-early (IE or
) genes, followed by
expression of delayed-early (DE or
) genes, followed after viral DNA
replication by strong expression of late (L or
) genes. HCMV also
modulates the expression of many cellular genes during the virus life
cycle (47).
IE1 p72 (IE1491aa) is the most abundant product of the
strongly transcribed major IE locus of HCMV and is detected in the nuclei of infected cells both in culture and in infected individuals. RNA transcripts originating from the major IE enhancer-promoter (MIEP)
immediately after infection span five major exons and are alternately
spliced and polyadenylated to produce messages for either IE1 p72
(exons 1 to 4) or IE2 p86 (IE2579aa) (exons 1 to 3 and 5)
(74, 75). The large exon unique to the IE2 p86 message, originally termed exon 7 (75), is here termed exon 5 (47). Translation of IE1 p72 and IE2 p86 initiates in exon
2, and the proteins share 85 identical residues at their amino termini.
IE2 p86 is thought to be the major specific transcriptional regulator
of the lytic cycle of HCMV. Consistent with a such a role, IE2 p86 is a
sequence-specific DNA binding protein, which autoregulates by binding
adjacent to the transcription start site of the MIEP (12, 32, 40,
41, 44, 53, 83) and also binds to specific sites in other HCMV
promoters (3, 66, 67). IE2 p86 interacts with diverse
components of the cellular transcription machinery, including TBP,
TFIIB, CREB, CBP, and c-Jun (7, 23, 33, 39, 65, 67), and in
transient-cotransfection assays IE2 activates transcription from a wide
range of HCMV and cellular promoters (15, 28, 35, 45, 54, 70,
73). Transactivation by IE2 p86 may be mediated by upstream
promoter elements (39, 65), but promiscuous activation of
heterologous promoters is frequently TATA box mediated (23).
In contrast, IE1 p72 acts via discrete promoter elements to stimulate a
relatively limited number of viral and cellular promoters. Notably, IE1
p72 transactivates its own promoter, the HCMV MIEP (13, 45,
73), acting via NF-
B sites in the 18-bp repeat sequences of
the enhancer (13, 62). IE1 p72 also activates the human
immunodeficiency virus type 1 long terminal repeat and the cellular DNA
polymerase
, dihydrofolate reductase, and prointerleukin-1
gene
promoters (26, 29, 80, 82). IE1 p72 physically interacts with the cellular transcription factors SP-1, E2F-1, and CTF-1 (26, 43, 46), but binding of IE1 to the basal transcription factors TFIIB and TFIID has not been detected (7, 23). As distinct from its promoter-specific transactivator functions, coexpression of IE1 p72 augments the promiscuous transactivating activities of IE2 p86 on a wide variety of viral and cellular promoters
(9, 35, 43, 45, 73). However, the accessory viral
transactivators TRS1/IRS1, UL36-UL38, and UL112-UL113 are in addition
required for the maximal stimulation of a number of HCMV DE promoters
(30, 71).
Several other distinct activities have been described for IE1 p72, but
considered together, these do not form a clear picture of the probable
functions of IE1 in the context of the virus life cycle. IE1 p72
colocalizes in stable cell lines and in infected cells with cellular
chromatin, a property shared with the EBNA-1 latent antigen of
Epstein-Barr virus (38). IE1 p72 also interacts with the
pocket protein p107 (56), inhibits tumor necrosis factor alpha-driven apoptosis in HeLa cells (85), and causes the
relocalization of PML protein from nuclear ND10 subdomains (1, 34,
37). Together with IE2 p86, IE1 p72 is one of six auxiliary
factors required in trans, alongside core viral DNA
replication proteins, for the replication in transfected cells of a
plasmid containing the HCMV lytic origin of replication
(51). Although this may partly reflect a requirement for IE1
p72 to fully activate core replication gene promoters (30),
IE1 p72 was nevertheless required for efficient viral origin
replication in permissive human fibroblasts, even when the core
replication proteins were constitutively expressed (63).
IE1 p72 and IE2 p86 are widely thought to be the central regulators of
the cascade of viral and cellular gene expression during lytic HCMV
infection. There is, however, very little direct evidence for this
assertion, other than that obtained by the use of antisense phosphorothioate oligonucleotides and antisense RNA expression to
inhibit ie1 and ie2 expression and hence viral
replication (2, 4, 6). For other herpesviruses, most notably
herpes simplex virus type 1 (HSV-1), spontaneous and recombinant viral mutants with defects in gene-regulatory proteins have provided vital
experimental information, facilitating a better understanding of the
important functions of these proteins in the context of viral infection
(59). As HCMV mutants with mutations in ie1 and
ie2 had not been described, we set out to generate such
mutants through construction of recombinant viruses. We have previously reported the isolation and preliminary characterization of an HCMV
ie1 mutant (RC303
Acc) by reconstruction from cosmids
derived from the Towne and Toledo strains (48). Here, we
report the isolation and characterization of an ie1 mutant
HCMV in a pure Towne strain background (CR208), derived by
recombination between wild-type virus and plasmid DNA containing the
selectable marker gene gpt. The two ie1 mutant
viruses share a low-multiplicity growth defect in primary fibroblasts;
however, viral gene expression during an attenuated low-multiplicity
infection by CR208 was more extensive than was previously observed for
RC303
Acc, indicating that IE1 p72 function may have a strong impact
at multiple stages of the virus life cycle.
 |
MATERIALS AND METHODS |
Plasmids.
Plasmid DNAs were maintained and propagated in
Escherichia coli DH5
, except for
gpt-containing plasmids, which were maintained and
propagated as previously described in the E. coli gpt mutant strain WB-1 (22). Plasmid pON303G (13) contained
the 7.4-kbp SalI IE fragment of HCMV Towne strain (AD169
equivalent nucleotides [nt] 168820 to 176220) (10) ligated
into the SalI site of pGEM2 (Promega). pON303G was deleted
between two NaeI sites to construct pON2535, which contained
a 5.7-kbp viral NaeI-SalI fragment (AD169 equivalent nt 170512 to 176620). Exon 4 was deleted from pON303G by
using endonuclease Bst1107I, which cuts at AccI
sites in the flanking introns, to produce plasmid pON2551. A 2.6-kbp
XhoI-ScaI fragment of pON303G (AD169 equivalent
nt 170233 to 172863) was ligated between XhoI and
EcoRV sites of pUC21 (79) to make plasmid pON2517. A 2.6-kbp SalI-BglII fragment of pON303G
(AD169 equivalent nt 168820 to 171443) was cloned as an
XbaI-BglII fragment into pBluescript SK+
(Stratagene) to produce plasmid pON2512. Plasmid pON2523 contained a
3-kbp EcoRI-XbaI fragment of pXbaE
(78) ligated between EcoRI and XbaI
sites of pUC21. Viral sequences in pON2523 commence at the
EcoRI site in UL129 (AD169 equivalent nt 175524) and proceed
away from the MIEP into Towne sequences not shared with AD169
(8). Plasmid pON308G (13) contained the 3.9-kbp
ClaI IE fragment of HCMV (Towne) (AD169 equivalent nt 170811 to 174751) ligated into the AccI site of pGEM2.
A 1.9-kbp HpaI-PstI fragment of pON308G was
ligated between StuI and PstI sites in the
E. coli guanosine phosphoribosyl transferase (gpt
gene) expression vector pON1101 (22) to produce plasmid pON2518. pON2518 thus contained an HpaI-ClaI
viral fragment (AD169 equivalent nt 172892 to 174751), including the
MIEP and part of UL127, placed upstream of a gpt expression
cassette. A 2.2-kbp EagI-BamHI fragment of
pON2518 containing the MIEP and gpt expression cassette was
then ligated between EagI and EcoRI sites of
pON2535 to construct plasmid pON2540. pON2540 effectively contains a
5.7-kbp NaeI-SalI fragment of the HCMV Towne
strain (AD169 equivalent nt 170512 to 176220) with a gpt
expression cassette cloned between ClaI and EcoRI
sites (AD169 equivalent nt 174751 to 175524), replacing UL127 to UL129.
The EagI-HindIII fragment of pON2540
containing the gpt insertion was used to replace the
EagI-HindIII fragment of pON2551, producing
plasmid pRG208. Plasmid pRG208 effectively contained the 7.4-kbp
SalI IE fragment of HCMV Towne, with the following
alterations: the deletion of exon 4 sequences between two
Bst1107I sites (AD169 equivalent nt 170954 to 172367) and the replacement of the open reading frames (ORFs) UL127 to UL129 between ClaI and EcoRI sites (AD169 equivalent nt
174751 to 175524) with an expression cassette containing the HSV
tk promoter, E. coli gpt, and the simian virus 40 early poly(A) signal. pRG208 is represented in Fig.
1a.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 1.
(a) Genomic structures of Towne, RC2540, and CR208
viruses in the SalI fragment containing the IE locus,
together with the structure of plasmid pRG208. The positions of ORFs
UL121 and UL127 to UL130 are shown, together with those of the MIEP
(shaded) and exons 1 to 5 of the major IE gene. The gpt
expression cassette consists of the HSV-1 thymidine kinase gene
promoter (tk), guanosine phosphoribosyl transferase-coding sequences
(gpt) (shaded), and the simian virus 40 early
polyadenylation signal (a). , HCMV sequences deleted from pRG208 and
CR208. Restriction enzyme sites used in Southern blot analysis and for
gpt insertion: A, AccI (Bst1107I); B,
BamHI; C, ClaI; E, EcoRI; S,
SalI; X, XhoI. Probe fragments are shown next to
viral sequences as solid blocks. (b) Southern blot analysis of Towne
and CR208 DNAs cut with the restriction enzymes shown and hybridized
with an exon 4 probe or an exon 5 probe (see panel a). Molecular sizes
of standards are shown to the left. (c) Southern blot analysis of
Towne, CR208, and RC2540 DNAs cut with EcoRI and hybridized
to probes from gpt, UL130, and UL128 and -129 (see panel a).
Molecular sizes of standards are shown to the left.
|
|
A 933-bp EagI-XhoI fragment from the IE2 p86 cDNA
expression vector pON2206 (31) was ligated between the
unique EagI and XhoI sites of pRG208 to produce
plasmid pRG232. Ligation into pON303G of a 535-bp
NdeI-ApaI fragment from pRG232 (containing the
proximal MIEP and the spliced exon 1-exon 2 boundary) yielded plasmid
pRG249. pRG249 effectively contained the 7.4-kbp SalI IE
fragment of the HCMV Towne strain, with the first intron of the major
IE gene (AD169 equivalent 172783 to 173609) removed, exactly as occurs
in spliced IE mRNAs.
Cell lines and culture.
All cell lines were cultured in
Dulbecco modified Eagle medium (GIBCO-BRL) supplemented with
penicillin, streptomycin, nonessential amino acids, and 10% (vol/vol)
NuSerum I (Collaborative Research). All procedures were carried out
with cells cultured at 37°C and with 5% CO2. The human
fetal lung fibroblast (HFL) line GM05387 and the human foreskin
fibroblast (HFF) line GM03468A were obtained from the National
Institute of General Medical Sciences, Camden, N.J.
Approximately 5 × 105 freshly plated early-passage
HFFs were treated with 3 ml of filtered (0.45-µm-pore-size filter)
culture supernatant from amphotropic PA317-N2-CMVIE packaging cells
(60), a gift from Eli Gilboa. After overnight absorption,
cells were plated at a low dilution and were cultured in the presence
of 400 µg of G418 (GIBCO-BRL) per ml. After 3 weeks of selection, the
resulting G418-resistant cells were pooled, and approximately 5 × 105 freshly plated cells were treated as described above
with filtered culture supernatant from the amphotropic PA317-LXSN16E6E7
packaging cell line (24), a gift from Denise Galloway. The
resulting rapidly growing G418-resistant clones were pooled and were
termed ihfie1.3 cells. A G418-resistant polyclonal immortalized cell
line was made by treatment of primary HFFs with filtered
PA317-LXSN16E6E7 cell supernatant and was called ihf-2.
Virus culture and generation of recombinant HCMV strains.
Cell-free virus stocks were prepared in HFL cells (for Towne, RC2540,
CRQ208, and CR249) or ihfie1.3 cells (for CR208). Cells infected with
approximately 0.01 PFU/cell were cultured until a cytopathic effect was
apparent in 100% of cells and were then refed with fresh culture
medium. After 5 days, the culture supernatant was passed through a
0.45-µm-pore-size filter, mixed 1:1 with a 9% (wt/vol) nonfat milk
solution (autoclaved), and stored at
70°C.
Detailed procedures for the isolation of recombinant HCMV strains
containing the gpt gene have been described previously
(22). Viral recombinant RC2540 was isolated by recombination
between SalI/NaeI-linearized pON2540 and the HCMV
Towne strain and was purified by these standard procedures. To isolate
CR208, 8 µg of SalI-linearized pRG208 DNA was transfected
(11) into 5 × 105 HFL cells, which were
infected 24 h later with 3 PFU of HCMV (Towne strain) per cell.
Progeny virus, enriched for gpt expression during three
passages on ihfie1.3 cells, was plaque purified twice on ihfie1.3
cells, once with selection for gpt (22) and once without selection. By Southern blot analysis, the first-round viral
isolate lacked detectable exon 4 sequences but had heterogenous sequences in the UL127 to -129 region. A homogenous isolate lacking exon 4 and derived from the second round of plaque purification was
designated CR208.
To generate CR208 derivatives, 8 µg of SalI-linearized
pON303G or pRG249 was transfected into 5 × 105 HFL
cells, which were then productively infected at a high multiplicity (approximately 10 PFU/cell) with CR208. A single passage of progeny virus on HFL cells at a low multiplicity (approximately 0.05 PFU/cell) resulted in the outgrowth of a small number of rapidly growing plaques.
Viruses from these growth-selected stocks were then plaque purified on
HFL cells. A derivative virus from the pON303G recombination was termed
CRQ208; a derivative of pRG249 was termed CR249.
Assays of viral growth.
Virus plaque assays were performed
on HFLs, HFFs, or ihfie1.3 cells. Virus samples were serially diluted
in serum-free medium and absorbed in duplicate onto 105
cells plated 16 to 24 h previously in 12-well dishes, and the inoculum was replaced after 1 h with culture medium supplemented with 0.16 mg of purified human gamma globulin per ml. After growth for
10 days, cells were fixed in 100% methanol (5 min) and stained with
0.04% (wt/vol) Giemsa stain in 10% methanol (20 min), and darkly
staining foci or plaques were counted.
For growth curves, 2 × 105 freshly plated cells in
six-well dishes were infected with the desired inoculum of virus in
serum-free culture medium. After absorption for 1 h, the inoculum
was replaced with normal culture medium. Samples of infected-cell
medium were removed at each time point and were stored at
70°C. The
infected cells were fed with fresh culture medium after each sampling. Duplicate plaque assays of frozen samples were subsequently performed on ihfie1.3 cells.
Analysis of viral DNA.
Viral DNA was isolated from the
cytoplasm of the same infected cells from which culture supernatant
stocks were harvested. DNA was purified from proteinase K-digested
cytoplasmic extracts (69), either by phenol extraction and
isopropanol precipitation or by sodium iodide equilibrium density
centrifugation (81).
For Southern blot analysis, approximately 0.25 µg of viral DNA was
digested with the appropriate restriction endonuclease and was
separated by electrophoresis on 0.6% agarose-Tris-borate-EDTA gels.
DNA was transferred by capillary blotting overnight to Hybond N+
membranes (Amersham) in 0.2 M NaOH-0.6 M NaCl. Filters were hybridized, as described previously (22), to DNA probes
radiolabelled with [
-32P]dCTP (Amersham) by random
hexamer priming. Probe fragments for Southern hybridization were
generated as follows and were purified from low-melting-point agarose
gels: an exon 4-specific probe was isolated as a 474-bp
BamHI-BglII fragment of pON2517 (AD169 equivalent
nt 170969 to 171443), a 455-bp SacI-NcoI fragment
of pON2512 was used to detect exon 5 sequences (AD169 nt 170678 to 170223), a 1-kbp PvuII-BamHI fragment of pON1101
was used to detect gpt sequences, a 626-bp
HindIII-SalI fragment of pON2523 detected the
UL130 ORF (AD169 nt 176844 to 176218), a 341-bp
EcoRI-XhoI fragment of pON303G detected the UL128
and UL129 ORFs (AD169 nt 175524 to 175183), and a 728-bp
SacI fragment of pG308 detected intron 1 and exon 1 of the
major IE gene (AD169 nt 173016 to 173744). Filters were stripped in
0.1% sodium dodecyl sulfate (SDS) at 100°C and were scanned on an
Instant Imager (Hewlett Packard) to assess probe removal prior to
subsequent hybridizations with different probes. The results of
Southern blotting were visualized by autoradiography.
Direct sequencing of iodide gradient-purified viral DNA was performed
by using the Thermo-Sequenase kit (U.S. Biochemicals/Amersham), by
direct incorporation of [
-33P]dATP label and according
to the manufacturer's instructions. Viral DNA (2.5 µg) was digested
with SalI and ethanol precipitated, and sequence was
obtained by using either primer P127 (5'TGGCGATATCAGTTACACAG3') (AD169 equivalent nt 174683 to 174702) or P129
(5'GAAAACCGCGCGTCATGAGT3') (AD169 equivalent nt 175636 to
175617).
Analysis of viral antigens and DNA replication.
Hybridoma
supernatants of mouse monoclonal antibodies p63-27 (55), SMX
(55), and BS510 (64), which recognize IE1 p72, IE2 p86, and ppUL44, respectively, were the gifts of Bodo Plachter. Mouse monoclonal antibody CH160 ascites (16), which
recognizes an amino-terminal epitope shared by IE1 p72 and IE2 p86, was
the gift of Lenore Pereira. Mouse monoclonal antibody 2A6 ascites, specific for the pp65 virion phosphoprotein (57), was kindly provided by Maria Grazia Revello. Human convalescent serum from a
patient recovering from primary HCMV infection was kindly provided by
Mark Wills. Antibromodeoxyuridine (anti-BrdU) rat monoclonal antibody
MAS-250 hybridoma supernatant and Texas red-linked goat anti-mouse
immunoglobulin G (IgG) conjugate were purchased from Sera-Labs.
Fluorescein isothiocyanate-conjugated goat anti-mouse IgG antibody was
purchased from Cappell.
For Western blot analysis, total proteins from 2 × 105 cells were harvested by a phosphate-buffered saline
(PBS) wash and direct lysis into 0.3 ml of SDS-polyacrylamide gel
electrophoresis sample buffer. Cells were infected beforehand with
appropriate multiplicities of virus, as described for the growth curve
experiments. Protein samples were stored at
20°C prior to analysis.
Boiled proteins derived from the equivalent of 6 × 103 cells were separated on SDS-8.5% polyacrylamide gels
and were electrophoretically blotted onto nitrocellulose filters.
Protein transfer was confirmed by Ponceau S staining of filters.
Filters were blocked for 1 h in 3% (wt/vol) bovine serum albumin
in PBS and were then incubated for 3 h with primary antibody
diluted in 10% fetal calf serum in PBS (PBS-FCS). After three 5-min
washes in PBS-0.5% Nonidet-P40, the filters were rinsed in PBS and
incubated for 1 h with rabbit anti-mouse IgG-horseradish
peroxidase (HRP) conjugate (DAKO) or rabbit anti-human Ig-HRP
conjugate (DAKO), each diluted 1/1,000 in PBS-FCS. After three further
PBS-0.5% Nonidet P-40 washes, bound HRP was visualized by using
nickel-enhanced diaminobenzidine-hydrogen peroxide as a substrate
(25).
For immunocytochemical staining, 105 cells grown on
19-mm-diameter glass coverslips were infected with virus diluted in
serum-free medium, and the culture medium was replaced after a 1-h
absorption step. Where indicated, sodium phosphonoformate (PFA) (200 µg/ml) was included in the culture medium. At the appropriate time
after infection, cells were washed in PBS and fixed in 1%
paraformaldehyde in PBS for 15 min. Cells were then permeabilized by a
5-min incubation in 0.1% Triton X-100 in PBS. PBS-washed fixed
monolayers were incubated with primary antibody (diluted as appropriate
in PBS-FCS) for 1 h, rinsed three times in PBS, and incubated with
fluorescence-labelled secondary antibody diluted 1:100 in PBS-FCS for
1 h. Cell nuclei were counterstained by the inclusion of Hoechst
33258 at 100 ng/ml during the final incubation step. PBS-washed stained
cells were mounted in glycerol-PBS (Citifluor) and were visualized by
fluorescence microscopy. To double label IE2 protein and viral DNA
replication compartments, cells were pulse-labelled by the addition of
10 µM BrdU to the culture medium for 30 min prior to fixation,
treated after fixation with 4 N HCl for 10 min, neutralized in PBS, and then incubated for 1 h with a 1:1 mixture of mouse anti-IE2
monoclonal antibody SMX and rat anti-BrdU monoclonal antibody MAS-250,
followed by a 1-h incubation with a mixture of non-cross-reactive
anti-rat IgG-tetramethyl rhodamine isothiocyanate and anti-mouse
IgG-fluorescein isothiocyanate secondary antibodies (Chemicon) (each
diluted 1:100 in PBS-FCS). All antibody incubations were carried out at
room temperature.
 |
RESULTS |
Generation of an ie1 mutant virus.
To complement a
viral ie1 mutant, a permissive cell line expressing IE1 p72
was required. As human fibroblasts immortalized by the E6 and E7 genes
of human papillomavirus type 16 support HCMV growth to high titers
(14), the immortalized IE1-expressing cell line ihfie1.3
(48) was generated by the sequential transduction of an
early-passage HFF culture with retroviral vectors expressing IE1 p72
and the human papillomavirus type 16 E6 and E7 products.
As IE1 p72 shares two coding exons with IE2 p86, the disruption of IE1
was accomplished by removing exon 4 of the major IE gene, which encodes
all residues unique to IE1 p72. A deletion which removes exon 4 via
AccI sites in the flanking introns precludes IE1 p72
expression yet leaves important splicing signals intact and results in
the expression of functional IE2 p86 in transient assays (12, 15,
27, 28, 45, 54, 73). The deletion does not disrupt the consensus
polyadenylation signal downstream of exon 4. This AccI
deletion was linked on a single plasmid to the insertion of a
gpt expression cassette into ORFs UL127 to UL129, upstream
of the MIEP. The sequences replaced by the gpt insertion overlapped the upstream end of the modulator region of the
MIEP (42) but did not include the dyad symmetry element which has been shown to be important for modulator function in undifferentiated teratocarcinoma cells (68). The structure
of plasmid pRG208 is depicted in Fig. 1a. Plasmid pON2540, which contained the same gpt cassette insertion into ORFs UL127 to
-129 but had a wild-type IE gene region, was also constructed.
Recombinant virus RC2540 was readily isolated by recombination between
plasmid pON2540 and Towne virus and carried the expected gpt
insertion, which was stable upon repeated passage. No major
differences between the growth characteristics of RC2540 and the
parental Towne strain (21) were detected.
A recombinant between pRG208 and HCMV Towne was generated and purified
as described in Materials and Methods and was designated CR208. A
Southern blot analysis comparing CR208 genomic DNA to parental Towne
DNA is shown in Fig. 1b. A probe to exon 4 sequences detected the
expected fragments in Towne DNA (21.3-kbp HindIII, 9.9-kbp BamHI, 10.9-kbp EcoRI, 7.4-kbp
SalI, and 5-kbp XhoI fragments) but did not
hybridize to CR208 DNA. Hybridization of the same blot to a probe for
exon 5 sequences detected similarly sized fragments in Towne DNA,
except that a different 5.3-kbp fragment hybridized in the
BamHI digest, consistent with the known presence of a
BamHI site separating exons 4 and 5. Exon 5 sequences were also detected in CR208 DNA, and in the cases of EcoRI,
SalI, and XhoI digests, the fragment sizes (9.5, 6, and 3.6 kbp, respectively) were consistent with a 1.4-kbp deletion
of exon 4. Differences in HindIII fragment sizes were
barely visible, and the BamHI digest revealed a novel
13.8-kbp fragment, consistent with the loss of a BamHI site
in the 1.4-kbp exon 4 deletion and the consequent fusion of adjoining
9.9- and 5.3-kbp BamHI fragments.
As shown in Fig. 1c, a blot of EcoRI-digested viral DNAs
from Towne, RC2540, and CR208 was sequentially hybridized to probes representing gpt, UL130, and UL128-UL129 sequences. A
6.2-kbp fragment of RC2540 DNA hybridized to the gpt probe,
but gpt sequences were not detected in the Towne control.
Surprisingly, gpt sequences were not detected in the CR208
genome. Conversely, 10.9-kbp Towne and 9.5-kbp CR208 fragments
hybridized to the UL128-UL129 probe, which did not recognize sequences
in the RC2540 genome. All three genomes contained UL130 sequences, but
the EcoRI fragment detected in RC2540 (6.4 kbp) was altered
relative to that in Towne (5.5 kbp), consistent with the loss of an
EcoRI site at the point of the gpt insertion in
UL129 and the introduction of a new site in the HSV tk
promoter of the gpt expression cassette. The size of the
EcoRI fragment detected in CR208 (5.5 kbp) was identical to
that in Towne.
Together, these results implied that the UL127- to UL129 region in
CR208 was unaltered from the wild type. To establish this fully,
genomic DNAs from CR208 and Towne were directly sequenced by using
synthetic primers derived from the UL127 and UL129 ORFs, flanking the
expected site of gpt insertion, as described in Materials and Methods. The resulting sequence data confirmed that the CR208 genome matched Towne sequences over the boundaries of the missing insertion. Thus, the gpt expression cassette, which
presumably enabled the selection of viruses lacking exon 4, was lost
from the CR208 genome and was replaced with wild-type sequences. This loss was surprising in the light of the stability of the RC2540 isolate
and suggested an influence of the exon 4 deletion upon the stability of
the UL127 to -129 gpt insertion. CR208 probably arose by an
early homologous recombination event between an exon 4 mutant bearing
the gpt insertion and a wild-type virus and became enriched
and isolated once selection for gpt was removed during plaque purification. When purified viral DNAs from CR208 and
Towne were digested with BamHI, EcoRI,
HindIII, or XbaI, separated on agarose gels,
and ethidium bromide stained to reveal all DNA fragments, no gross
differences besides those expected from the exon 4 deletion were seen
(data not shown). The genomic structure of CR208, containing a
wild-type UL127 to -129 region, simplified the interpretation of the
following experiments, as the intended deletion of exon 4 was the only
detectable physical lesion in this virus.
The ie1 cDNA in ihfie1.3 cells did not contain any sequences
homologous to regions directly flanking the exon 4 deletion in CR208.
ihfie1.3 cells contained exon 4 sequences from the 5' boundary to
the BamHI site in the 3' noncoding region (AD169 equivalent nt 172221 to 170969), and the deletion in CR208 spanned AD169 equivalent nt 172367 to 170954. Upstream of exon 4, CR208 and ihfie1.3
cells had homology in the enhancer and exons 1, 2, and 3 of the major
IE gene. However, homologous recombination through any of these shared
sequences to restore exon 4 to the viral genome should have resulted in
the loss of the exon 3-intron 3 boundary, the site of differential
splicing of the messages for IE1 p72 and IE2 p86 (75). The
loss of this potential for alternate splicing would be expected to
preclude IE2 p86 expression from such a viral genome. The spontaneous
occurrence in CR208 stocks of revertant viruses able to express both
IE1 and IE2 was therefore not anticipated, and it has not been
observed.
The ie1 mutant was replication deficient after
low-multiplicity infection of primary human fibroblasts.
Working
stocks of the CR208 deletion mutant were grown and titrated in ihfie1.3
cells. Peak titers reached in the culture medium of infected cells were
similar to those generally obtained from Towne virus grown in primary
HFL cells, approximately 107 PFU/ml. Prior to all
subsequent experiments, CR208 and Towne stocks were titrated in
parallel on ihfie1.3 cells. Thus, PFUs in comparative experiments were
always defined on an ihfie1.3 background. Towne and CR208 plaques
formed on ihfie1.3 cells had similar sizes and morphologies.
Virus replication was assayed after both high (10-PFU/cell)- and low
(0.1-PFU/cell)-multiplicity infections of ihfie1.3 cells and primary
fibroblasts. The culture medium was sampled at various times
postinfection and was titrated on ihfie1.3 cells. In ihfie1.3 cells,
the two viruses accumulated to similar levels after infection at high
(data not shown) and low (Fig. 2b) input
multiplicities. After high-multiplicity infection of primary
fibroblasts, the two viruses again accumulated to similar levels (data
not shown), consistent with results obtained with a similar
ie1 mutant virus generated by cosmid reconstruction
(48). As previously observed (48), ie1
mutant progeny from primary HFL cells readily infected fresh primary
HFL cultures, and cell-free CR208 was thus passaged over three
generations without loss of infectivity and without the appearance of
detectable exon 4 sequences in the resulting viral genomes
(21). During the first round of infection in HFLs, the
assembly of IE1 p72 into CR208 virions released from ihfie1.3 cells
could theoretically account for the ability of these virions to undergo
a single productive round of infection in the absence of
complementation. The demonstration of the serial passage of cell-free
CR208 virus in primary HFL cells argued against this explanation and
showed that after high-multiplicity input, CR208 could replicate to
high levels in the absence of IE1 p72 protein. In contrast, when Towne
and CR208 were used to infect primary fibroblasts at a multiplicity of
0.1 PFU/cell, a marked reduction in the subsequent accumulation of
replicated virus was seen (Fig. 2a). Replication of CR208 was severely
defective compared with that of the parental Towne strain, reaching
titers 3 orders of magnitude lower after 9 days of incubation. In
addition, the viral cytopathic effect apparent by light microscopy was
much reduced, with only a few foci of infection visible in the
CR208-infected culture after 10 days.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 2.
(a and b) Multiple-step growth curve analysis of Towne
and CR208 viruses in HFL cells (a) and ihfie1.3 cells (b). The results
are a time course of the total PFU of infectious virus present in 4 ml
of culture supernatant at the indicated sampling times, as measured by
plaque formation on ihfie1.3 cells. Experiments were performed with
2 × 105 cells at an input multiplicity of 0.1 PFU/cell. The results of a single experiment are shown; titers are the
mean results from two parallel titrations. (c) Plot of titration data
taken from a single plaque assay (Table 1), relating the plaque numbers
formed on 2 × 105 HFFs or ihfie1.3 cells by various
inocula of Towne or CR208 virus stocks. Log plaque number is plotted
against log inoculum volume.
|
|
Another manifestation of this low-multiplicity growth defect was
revealed by plaque assays performed with ihfie1.3 cells, HFLs, HFFs, or
the control immortalized ihf-2 cell line. CR208 had a much-reduced
plaquing efficiency in each of the three IE1-negative cell lines
compared with ihfie1.3 cells. In addition, there was a strongly
nonlinear relationship between the input CR208 inoculum volume and the
resulting plaque number on HFLs, HFFs, or ihf-2 cells. Plaques formed
by CR208 were much smaller than those formed by Towne strain virus on
noncomplementing cells and were also much smaller than CR208 plaques
formed on the complementing ihfie1.3 cell line. Although there was
always considerable variability in HCMV plaque sizes, CR208 plaques on
noncomplementing cells would typically consist of 5 to 10 intensely
Giemsa-stained cells, at times when Towne plaques comprised 50 to 100 such cells. The results of a representative experiment are shown in
Table 1, comparing plaque formation by
Towne and CR208 on 2 × 105 ihfie1.3 cells or primary
HFFs. The two virus stocks had similar titers when assayed on ihfie1.3
cells and showed reasonably linear relationships between inoculum size
and plaque number. In HFFs, Towne virus formed plaques with an
efficiency similar to that in ihfie1.3 cells and again showed a
reasonably linear relationship between inoculum size and plaque number.
In strong contrast, dilution of the CR208 inoculum resulted in a
disproportionate drop in the number of small plaques formed on HFF
cells. As an example, a 60% reduction in the CR208 inoculum reduced
the plaque number 11-fold, from 543 to 50.
These data are consistent with a requirement for multiple CR208
particles to initiate a fully productive viral infection in a single
cell. The small size of CR208 plaques might be the consequence of
slower virus spread, resulting from the reduced infectivity of single
particles. Assuming that the number of particles required to initiate a
plaque (n) is relatively constant, at low inputs a likely
relationship between inoculum volume (i) and plaque number produced (P) could be approximated by P = ain, where a is a constant for any
fixed value of n and depends on n itself, the
virus stock titer, and the number of target cells. Therefore, log
P = log a + nlog
i, so plotting log P against log i
should give a straight line with gradient n. The data from
Table 1 were treated in this way, and straight lines were fitted to the
data points by the least-squares method of linear regression (Fig. 2c).
For CR208, n was estimated as 1.22 in ihfie1.3 cells but
rose to 2.69 in HFFs. The estimates of n for Towne virus
were 1.19 and 1.24 in ihfie1.3 cells and HFFs, respectively. Thus, two
or three CR208 particles appeared to be necessary to initiate formation
of a plaque.
Growth defects of CR208 were repaired by the restoration of exon 4 sequences: the large intron of the major IE gene and ORFs UL124 and
UL125 are dispensable for lytic viral growth.
To produce rescued
derivatives of CR208, HFLs were transfected with linearized DNAs
containing exon 4 and sequences flanking the exon 4 deletion in CR208.
pON303G contained a wild-type IE locus. pRG249 lacked the large first
intron of the major IE gene but was otherwise identical to pON303G.
pGEM3ZF was included as a negative control. Transfected HFLs were then
infected at a high multiplicity with CR208 virus. Progeny viruses from
these recombinations were then used to infect primary HFL fibroblasts
at a low multiplicity. Only stocks derived from the pON303G and pRG249
transfections gave rise to rapidly expanding foci of viral infection in
this noncomplementing background. Viruses derived from these rapidly spreading infections were plaque purified and were termed CRQ208 and
CR249, respectively. Figure 3a shows the
expected genomic structures of CR208, CRQ208, and CR249. Figure 3b
shows a Southern blot of XhoI digests of DNAs from these
three viruses and the HCMV Towne strain. An exon 4 probe failed to
recognize CR208 genomic DNA but detected fragments in Towne (5 kbp),
CRQ208 (5 kbp), and CR249 (4.1 kbp). The same blot was hybridized to a
probe containing 600 bp of the first intron of the IE gene but also
containing 130 bp of exon 1. Fragments were then detected in the
genomes of Towne (5 kbp), CR208 (3.6 kbp), and CRQ208 (5 kbp). The
4.1-kbp XhoI fragment of CR249 was recognized only very
weakly, due to the deletion of 80% of the sequences homologous to the
probe. Thus, the blot confirmed the expected structures of the rescued viruses shown in Fig. 3a. The failure to derive fully growth-competent viruses from the control pGEM3ZF+ recombination showed that the starting CR208 stocks were not contaminated to any detectable level by
wild-type virus. The parallel demonstration of a coupled rescue and
deletion in the isolation of CR249 provided additional evidence that
CRQ208 was a bona fide rescued derivative of CR208.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3.
(a) Genomic structures of viruses CR208, CRQ208, and
CR249 in the SalI fragment containing the IE locus. The
positions of ORFs UL121 and UL127 to UL130 are shown, together with
those of the MIEP (shaded) and exons 1 to 5 of the major IE gene. ,
HCMV sequences deleted from CR208 and CR249. X, XhoI sites
used in Southern blot analysis. Probe fragments used are shown next to
viral sequences as solid blocks. (b) Southern blot analysis of CR208,
CRQ208, and CR249 DNAs cut with XhoI and hybridized
sequentially to an exon 4 probe and to an exon 1 plus intron 1 probe
(see panel a). CR249 DNA was inadvertently underloaded in this
experiment. Molecular sizes of standards are shown to the left.
|
|
The growth of CR208 derivatives was evaluated by multiple-step viral
growth curve analysis. Working stocks of CRQ208 and CR249 were grown in
HFLs, and titers were determined in ihfie1.3 cells. HFLs or ihfie1.3
cells were infected at a low multiplicity (0.1 PFU/cell) with the
viruses Towne, CR208, CRQ208, and CR249. The resulting accumulations of
cell-free virus were titrated in ihfie1.3 cells, and the results are
shown in Fig. 4. Growth of CR208 after a
low-multiplicity infection of primary fibroblasts was defective (Fig.
4a), as presented above. The rescued viruses CRQ208 and CR249 grew as
well as the Towne strain in HFLs. The equivalent experiment carried out
with ihfie1.3 cells demonstrated similar growth kinetics for all four
viruses (Fig. 4b). Parallel plaque assays of CRQ208 and CR249 in
ihfie1.3 and HFL cells showed that these viruses plated efficiently in
either cell type, showing full-sized plaques and a linear relationship
between input inoculum size and plaque numbers formed (data not shown).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
Multiple-step growth curve analysis of Towne, CR208,
CRQ208, and CR249 viruses in HFL cells (a) and ihfie1.3 cells (b). The
results are a time course of the total PFU of infectious virus present
in 4 ml of culture supernatant at the indicated sampling times, as
measured by plaque formation on ihfie1.3 cells. Experiments were
performed with 2 × 105 cells at an input multiplicity
of 0.1 PFU/cell. The results of a single experiment are shown; titers
are the mean results from two parallel titrations.
|
|
Thus, the restoration of exon 4 sequences into two independently
derived rescued viral clones repaired the growth defect of CR208. The
absence of any appreciable growth defect for CR249 showed that the
presence of the 900-bp first intron in the major IE gene was not
necessary for lytic viral replication in primary human fibroblasts.
ORFs UL124 and UL125 underlie the large first intron and are present in
latent transcripts detected in the bone marrow of healthy HCMV carriers
(36). Antibodies to the protein product of UL124 have been
identified in the sera of some carriers (36), and expression
of pUL124 can be detected during the productive infection of cultured
HFFs (84). The normal growth of CR249 demonstrated that the
protein products of these putative latency genes were not required for
productive lytic infection in cultured primary fibroblasts.
Full expression of viral antigens by CR208 after high-multiplicity
infection of primary fibroblasts.
An analysis of viral proteins
produced during productive high-multiplicity infections of HFLs was
undertaken. Figure 5a shows a Western
blot comparing proteins from HFLs infected at 5 PFU/cell with Towne,
CR208, CRQ208, and CR249 viruses. IE1 p72 and IE2 p86 were detected in
parallel by using antibody CH160, which recognizes a shared epitope
encoded in exon 2. CR208 clearly failed to express IE1 p72 at 24 and
72 h postinfection (hpi) but produced IE2 p86 at normal levels.
The rescued CRQ208 and CR249 viruses showed patterns of IE antigen
expression indistinguishable from that of the wild-type Towne virus.
Figure 5b and c show Western blots of total viral antigens expressed
during high-multiplicity infections (5 PFU/cell) of HFLs by Towne and
CR208 viruses, respectively. Viral antigens were detected by using a
human convalescent antiserum. CR208 produced a profile of viral
antigens almost identical to that produced by wild-type virus. The
accumulation of viral antigens was, however, slower in CR208-infected
cells, demonstrating that although CR208 completed the lytic cycle
after a high-multiplicity input, the kinetics of total viral protein
production were delayed relative to those for wild-type virus.
Furthermore, the cytopathic effect observed in cells infected at high
multiplicity by CR208 was distinguishable from that in cells infected
by Towne, with clearly reduced cell rounding.

View larger version (75K):
[in this window]
[in a new window]
|
FIG. 5.
(a) Western blot analysis of total cellular proteins,
detecting IE1 and IE2 proteins produced in HFLs after 24 or 72 h
of infection at 5 PFU/cell by Towne, CR208, CRQ208, or CR249 virus.
Monoclonal antibody CH160, diluted 1:100, was used. uninf,
uninfected-cell proteins. Molecular masses of standards are shown on
the left. (b and c) Western blot analysis of time courses of viral
proteins produced by Towne (b) and CR208 (c) after high-multiplicity
infection (5 PFU/cell) of HFL cells. Viral antigens were detected
specifically in total cellular proteins by using human antiserum,
diluted 1:50, from a patient convalescing from primary HCMV infection.
Molecular masses of standards are shown to the left of each panel.
|
|
Viral antigens expressed by Towne and CR208 after high-multiplicity
infections (5 PFU/cell) were also analyzed by immunofluorescence (Fig.
6). HFFs were used for all cell-staining
experiments, as their morphology when grown on glass coverslips
provided better resolution. As already described above, CR208 showed
defects in plaque formation after low-multiplicity infection of HFFs
that were similar to those seen in HFLs. Consistent with the genotype, an IE1 p72-specific monoclonal antibody (p63-27) did not detect nuclear
antigen in cells infected by CR208 (Fig. 6b), while Towne-infected cells showed a characteristic diffuse nuclear stain (Fig. 6a). At 72 hpi, the virion structural protein pp65 was detected in the nuclei and
cytoplasm of cells infected by either virus by using monoclonal
antibody 2A6 (Fig. 6c and d). Immunocytochemical staining has revealed
the presence of several other specific viral antigens in cells infected
productively with CR208. These include the IE2 protein and the ppUL44
(ICP36) protein (see below).

View larger version (115K):
[in this window]
[in a new window]
|
FIG. 6.
Photomicrographs of immunofluorescence analysis of viral
antigens expressed after high-multiplicity infection (5 PFU/cell) of
HFFs by Towne (a and c) or CR208 (b and d). (a and b) Staining with
IE1-specific antibody p63-27 (undiluted) at 24 hpi. (c and d) Staining
with pp65-specific antibody 2A6, diluted 1:100, at 72 hpi. Color
positive transparencies were digitized by using a Nikon Coolscan
scanner, converted to greyscale using Adobe Photoshop software, and
printed as a composite image by using Powerpoint software. Images
within a pair were processed identically. The scale bar in panel a
applies to all images.
|
|
Accumulation of the core viral DNA replication protein ppUL44 was
defective after infection of primary fibroblasts at low multiplicity by
CR208.
To investigate the nature of the block to viral replication
after low-multiplicity infection by CR208, HFLs were infected at
various multiplicities and viral proteins were analyzed. The 50-kDa
protein product of the UL44 ORF was chosen as a representative protein
expressed at DE times. ppUL44 (ICP36) is the processivity factor for
the viral DNA polymerase (17) and is necessary in assays of
trans-acting factors required for viral DNA replication (52). Expression of antisense RNA to UL44 inhibits virus
replication in otherwise permissive U373 astrocytoma cells, apparently
by preventing viral DNA replication (58). Thus, although
ppUL44 is maximally expressed at late times of infection and UL44 has been described as a late gene (20), DE expression of ppUL44 is very likely required for the progression of infection from the DE to
the late phase. The ppUL44 protein is abundant during viral infection
of cultured cells, and good specific antibodies are available (49,
64).
Figure 7 shows a parallel Western blot
analysis of IE1 p72, IE2 p86, and ppUL44 proteins. In Fig. 7a and b,
HFLs were infected with Towne or CR208 at 5 PFU/cell, and total cell
proteins were harvested from parallel samples over a time course. The
blots show that IE2 p86 accumulated with similar kinetics during
infection by either viral strain, as did the ppUL44 protein. IE1 p72
was detected only in Towne-infected cells. Figure 7c and d show a very
similar experiment, conducted in parallel after an input multiplicity
of 0.2 PFU/cell. Although IE2 p86 once again accumulated with similar
kinetics in both cultures, ppUL44 accumulated at later times, and to
lower levels, in the CR208-infected culture. To confirm that this
difference between the two viruses was due to the absence of IE1 p72,
the experiment shown in Fig. 7c and d was repeated with ihfie1.3 cells.
In these complementing cells, IE2 p86 and ppUL44 accumulation by CR208
occurred with kinetics similar to those for the wild type (data not
shown). Thus, the defect in ppUL44 accumulation at a low multiplicity
was corrected by the provision of IE1 p72 in trans.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 7.
Western blot analysis of total cellular proteins,
detecting IE1 p72, IE2 p86, and ppUL44 proteins produced in HFL cells
over an infection time course. A mixture of monoclonal antibodies CH160
(diluted 1:100) and BS510 (diluted 1:25) was used to detect the three
viral antigens simultaneously. Molecular masses of standards are shown
to the sides. (a and b) Analysis performed after high-multiplicity
infection (5 PFU/cell) by Towne (a) or CR208 (b) virus. The death of
many Towne-infected cells at 144 h caused reduced protein loading
compared to other lanes. (c and d) Analysis performed after
low-multiplicity infection (0.2 PFU/cell) by Towne (c) or CR208 (d)
virus.
|
|
Western blots provide only a semiquantitative measure of steady-state
protein levels, and these results must therefore be interpreted with
caution. However, this preliminary observation of a discrepancy between
IE2 p86 and ppUL44 accumulation after low-multiplicity infection by
CR208 was reproducible (21) and was considered worthy of
further investigation. In particular, it was necessary to improve
sensitivity under genuinely DE conditions, to establish whether any
defect in ppUL44 accumulation occurred prior to viral DNA replication
or whether it might itself be caused by a failure of viral DNA
replication. In addition, our model of a requirement for multiple viral
particles to initiate a productive infection predicted that if
infection was blocked upstream of ppUL44 expression, the reduction in
ppUL44 levels seen by bulk protein analysis should reflect a reduction
in the number of infected cells proceeding through the lytic cycle. An
analysis of viral antigen accumulation at the single-cell level was
therefore undertaken. Monolayers of HFFs infected at various
multiplicities with Towne or CR208 were stained in parallel with
monoclonal antibodies specific for either IE2 or ppUL44 protein.
Antibody SMX, used to detect IE2 antigens in these experiments, is
reactive both to IE2 p86 and to the IE2 p40 product, which is made from
a late transcript initiating internally within exon 5 (55,
72).
Photomicrographs of cells stained at 48 hpi are shown in Fig.
8. Figure 8a to p show
immunostained fields; Fig. 8a' to h' show the same respective fields
visualized by Hoechst staining. After a high-multiplicity input (5 PFU/cell), high levels of IE2 and ppUL44 were detected in the nuclei of
a large percentage of cells infected by Towne or CR208 (Fig. 8a to d).
In addition, each protein had a subnuclear distribution which was
similar in wild-type- and mutant-infected cells. After a
lower-multiplicity input (1 PFU/cell), IE2 was again detected in
similar proportions of cells in both Towne- and CR208-infected cultures
(Fig. 8e and f). A similar staining pattern was observed in
CR208-infected cultures by using antibody CH160, which is reactive to
an amino-terminal epitope on IE2 p86 (21), suggesting that
full-length IE2 p86 was present in these cells. Similarly to the IE2
staining, approximately 40% of cells in the Towne-infected culture
stained for ppUL44 (Fig. 8g). In sharp contrast, ppUL44 staining was
seen in many fewer cells in the CR208-infected culture (Fig. 8h), and
most of these cells had a diffuse nuclear distribution of antigen, as
opposed to the bright patchy pattern characteristic of replication compartment formation during a wild-type infection. At multiplicities of 0.2 PFU/cell and below, cells containing ppUL44 were readily detected in Towne-infected cultures but became extremely scarce in
CR208-infected cultures, even though IE2-containing cells were present
in numbers similar to those for the wild type in parallel experiments.
Thus, many cells infected by CR208 contained IE2 but did not accumulate
ppUL44. Similar results were also obtained at 24 hpi (data not shown).

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 8.
Photomicrographs of immunofluorescence analysis of viral
antigens expressed after different-multiplicity infections by Towne and
CR208 at 48 hpi. (a to p) Immunostained cells; (a' to h') same
respective fields visualized by Hoechst staining. (a, c, e, g, i, k, m,
and o) Towne infection; (b, d, f, h, j, l, n, and p) CR208 infection.
(a to d) HFFs infected at 5 PFU/cell and stained either for IE2 protein
with antibody SMX diluted 1:2 (a and b) or for ppUL44 with antibody
BS510 diluted 1:25 (c and d). (e to h) HFFs infected at 1 PFU/cell and
stained either for IE2 (e and f) or for ppUL44 (g and h). (i to l) HFFs
infected at 1 PFU/cell in the presence of PFA (200 µg/ml) and stained
either for IE2 (i and j) or for ppUL44 (k and l). (m to p) ihfie1.3
cells stained for ppUL44 and infected at 5 PFU/cell (m and n) or 1 PFU/cell (o and p). Color positive transparencies were digitized as for
Fig. 6 and printed as a composite image by using Quark Express
software. All IE2-stained images were exposed and processed
identically, except for panels i and j, which received a doubled
exposure time. All ppUL44-stained images were exposed and processed
identically, except for panels k and l, which received a doubled
exposure time. The scale bar in panel d applies to all images.
|
|
To establish that the defect in ppUL44 accumulation was specific to DE
phase, the experiments of Fig. 8e to h were performed in the presence
of PFA (200 µg/ml), which specifically blocks viral DNA replication.
The results are shown in Fig. 8i to l. IE2 staining (Fig. 8i and j) was
again approximately equivalent for both viruses and was seen in about
40% of cells, although staining was weaker than in the absence of PFA.
Again, many fewer nuclei stained positively for ppUL44 in the CR208
infection than in the Towne infection (Fig. 8k and l). Bright patchy
nuclear ppUL44 staining became diffuse in the presence of PFA, probably reflecting the inhibition of the formation of viral DNA replication compartments. Thus, the accumulation of the ppUL44 protein at 24 and
48 h and at 48 h in the presence of PFA was defective during a low-multiplicity infection by CR208. To confirm that the absence of
IE1 p72 was responsible for this defect, infections were carried out in
ihfie1.3 cells at inputs of 5 and 1 PFU/cell (Fig. 8m to p). In these
experiments, no differences in ppUL44 accumulation between Towne and
CR208 at either input multiplicity were observed. Most cells contained
ppUL44 after infection with 5 PFU of either virus per cell (Fig. 8m and
n), and approximately 30% of cells infected at 1 PFU/cell contained
ppUL44 (Fig. 8o and p). This equivalence in ihfie1.3 cells was apparent
at input multiplicities of as low as 0.008 PFU/cell (21) and
demonstrated that the provision of IE1 p72 in trans
corrected the low-multiplicity ppUL44 accumulation defect of CR208,
just as it corrected the low-multiplicity growth defect of the mutant
virus. Rescued viruses CRQ208 and CR249 were also used in similar
immunofluorescence experiments and had no demonstrable defects in
ppUL44 accumulation relative to a wild-type virus (21).
Two representative fields of cells from HFF monolayers infected at
multiplicities of 5, 1, 0.2, and 0.04 PFU/cell and stained after
48 h for either IE2 (antibody SMX) or ppUL44 (antibody BS510) were
photographed for specific immunofluorescence and for the Hoechst
counterstain. Proportions of cells containing the two antigens were
then calculated by comparing numbers of specifically staining nuclei
with numbers of Hoechst-staining nuclei. The resulting data (Table
2) are a more quantitative representation
of the results of Fig. 8a to h. These data show that IE2 was contained in similar proportions of cells infected with equivalent multiplicities of Towne or CR208 virus, independent of that multiplicity. In Towne
infections, accumulation of ppUL44 followed a pattern similar to that
for IE2, but in CR208 infections, the effect of reducing the inoculum
was much more profound for ppUL44 accumulation, with the percentage of
positively staining cells dropping very sharply upon dilution.
Viral DNA replication compartments were not formed after
low-multiplicity infection by CR208.
Our analysis of the ppUL44
antigen showed that the defect in the CR208 life cycle after a
low-multiplicity input correlated with a deficiency in ppUL44
accumulation at DE times. As ppUL44 is a core DNA replication complex
protein, which is very likely required for viral DNA replication, our
results predict that viral DNA replication may not occur after a
low-multiplicity infection by the ie1 mutant virus. To
establish this, and to investigate the fate of individual
CR208-infected cells over a longer time course, HFFs were infected at a
low multiplicity (0.05 PFU/cell) with Towne or CR208 virus. The cells
were then analyzed over a time course by combined staining for IE2
protein and for the incorporation of the thymidine analog BrdU into
viral DNA replication structures.
Figure 9 shows photomicrographs of
representative single infected cells that were fixed and stained at
various times after infection. At 24 hpi, similar proportions of
infected cells (approximately 2 to 5%) were detected in either culture
by staining with an IE2-specific antibody. The staining pattern for IE2
p86, i.e., a diffuse nuclear stain with punctate highlights, was
similar in cells infected by either virus (Fig. 9a and b). At 48 hpi,
similar proportions of IE2-expressing cells were again detected in each
culture (Fig. 9c and d). At 72 hpi, CR208-infected nuclei retained the
original IE2 staining pattern, and no DNA replication structures were
detected by BrdU incorporation (Fig. 9f and j). In contrast, the
majority of Towne-infected cells had a bright patchy configuration of
IE2 staining (Fig. 9e), with BrdU incorporation coincident with the brighter patches (Fig. 9i), in the irregular lobed pattern
characteristic of CMV DNA replication compartments (63). It
is likely that a significant proportion of staining by SMX at this and
later stages of productive infection may be due to the accumulation of
the late IE2 p40 protein (55, 72). At 144 hpi, cells
staining for IE2 were still detectable in the CR208-infected culture,
though they had decreased approximately fivefold relative to those at 24 hpi, and the IE2 staining pattern had often become very punctate (Fig. 9h). BrdU incorporation into viral DNA replication structures was
not detected in the vast majority of these IE2-containing cells (Fig.
9l), although a careful examination of the culture revealed a very
small percentage of the total population (approximately 0.01%) in
which viral DNA replication compartments were discernible although
retarded relative to the case for a wild-type infection. At 144 hpi,
the majority of cells in the Towne-infected culture contained IE2
proteins. The original infected cells were identified by a brighter IE2
stain corresponding to extensive viral DNA replication compartments and
were surrounded by other infected cells with earlier staining patterns
(Fig. 9g). BrdU incorporation into replication compartments was still
strong at 144 hpi and was also detectable in some of the secondarily
infected cells (Fig. 9k).

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 9.
Time course immunofluorescence experiment, showing the
progression of infection in individual cells after the low-multiplicity
inoculation (0.05 PFU/cell) of HFFs with Towne (a, c, e, g, i, and k)
or CR208 (b, d, f, h, j, and l). (a and b) Fixation at 24 hpi; IE2
staining (antibody SMX diluted 1:2). (c and d) Fixation at 48 hpi; IE2
staining. (e and f) BrdU pulse and fixation at 72 hpi; IE2 staining. (g
and h) BrdU pulse and fixation at 144 hpi; IE2 staining. (i and j) Same
fields as panels e and f, respectively, with parallel BrdU uptake
staining (antibody MAS-250 diluted 1:2). (k and l) Same fields as
panels g and h, respectively, with parallel BrdU uptake staining. Color
transparency images were processed as for Fig. 8. All IE2-stained
images were exposed and processed identically. All BrdU-stained images
were exposed and processed identically. The scale bar in panel a
applies to all images.
|
|
A parallel experiment was performed by using double staining for ppUL44
and BrdU incorporation (21). In the Towne-infected culture,
ppUL44 staining was widespread from 24 hpi onwards, and a large
proportion colocalized with BrdU incorporation in cells containing
viral DNA replication compartments. Most cells in the Towne-infected
culture contained ppUL44 at 144 hpi. In contrast, ppUL44-staining cells
were extremely rare in the CR208-infected culture at all time points,
but ppUL44 was found to be present in the nuclei of those very rare
cells which had formed viral DNA replication compartments at 144 hpi.
Similar double-labelling experiments were conducted with the rescued
viruses CRQ208 and CR249 (21). Infection with these viruses
at low multiplicities resulted in the normal accumulation of IE2 and
ppUL44 antigens and the normal establishment of viral DNA replication
compartments.
We conclude from these experiments that viral DNA replication
compartments were not assembled over 6 days in cells infected at a low
multiplicity with CR208 virus, even though IE2 protein was expressed.
This result correlated with reduced accumulation of ppUL44 and suggests
that viral DNA replication was blocked in the abortively infected
cells.
 |
DISCUSSION |
We have isolated a recombinant HCMV (CR208) from which all unique
coding sequences for the abundant nuclear IE1 p72 protein were deleted.
IE1 protein was provided in trans in a complementing immortalized fibroblast line, demonstrating the general applicability of these methods to the isolation of HCMV mutants with deletions in
essential viral genes.
IE1 functions were not required for lytic replication upon infection of
primary fibroblasts at a high multiplicity, although there were
indications that the cascade of viral gene expression was slower in the
absence of IE1, and there were also alterations in the viral cytopathic
effect. Thus, the most abundant viral IE protein was not absolutely
essential for virus replication in cultured fibroblasts. However, after
infection at low input multiplicities, replication of the
ie1 mutant virus exhibited a marked deficiency. The
phenotype of CR208 during plating and growth assays suggested that IE1
p72 function was essential when single virions initiated infection.
After low-multiplicity infection, the mutant virus life cycle was
apparently stalled between the IE and DE phases, with synthesis of the
major regulatory protein IE2 p86 but with defective accumulation of the
core DNA replication protein ppUL44 and a failure to establish viral
DNA replication compartments. The failure to accumulate ppUL44 in the
absence of IE1 p72 was independent of viral DNA replication and
occurred in the presence of the inhibitor PFA. The faulty accumulation of ppUL44 observed at 24 and 48 hpi may have contributed to the failure
of the formation of viral DNA replication compartments in
mutant-infected cells. All of the phenotypic differences observed in
viral replication, ppUL44 accumulation, and establishment of DNA
replication compartments were corrected in two independently derived
rescued derivatives of CR208. The defects were also corrected by the
provision of the IE1 protein in trans in the complementing ihfie1.3 cell line. Thus, the observed multiplicity-dependent defects
in growth and ppUL44 accumulation by the ie1 mutant CR208 were directly related to the inability to code for IE1 p72.
The previously reported ie1 null mutant RC303
Acc
(48) exhibited growth properties similar to those of CR208
when growth in HFFs was compared to that in ihfie1.3 cells. Because
RC303
Acc exhibited a striking multiplicity-dependent expression of
IE2 p86, the growth defect was attributed to a defect in IE1
p72-mediated autoregulation (48). This virus also exhibited
a reduced expression of other viral antigens, but these effects
correlated with the reduced expression of IE2 p86. Expression of IE2
p86 by CR208 appears to be less dependent upon multiplicity (Fig. 7 and
8), a characteristic which might be due to the differences in the genetic backgrounds used to construct RC303
Acc and CR208. CR208, characterized here, is purely Towne based, whereas RC303
Acc is a
chimera of the Towne and Toledo strains. The most relevant differences between these two mutants are probably in the region upstream of the
ie1-ie2 enhancer, where the Toledo strain carries a 15-kbp segment that includes a major rearrangement of sequences
(8). This difference may account for the different impact of
the absence of IE1 p72 on levels of ie2 expression.
Irrespective of these differences, or of the possible impact of IE1 p72
on autoregulation in certain strains of virus or under certain
circumstances, the phenotype of CR208 demonstrates that IE1 p72
function is important even under conditions when IE2 p86 is synthesized
and that the impact of IE1 p72 therefore goes well beyond the IE phase
of infection.
A consideration of the characterized activities of IE1 p72 suggests
several additional mechanisms which alone or in combination could
account for the low-multiplicity growth and expression defects of
CR208. First, and most consistent with the data presented here, cooperation between IE1 p72 and IE2 p86 to activate HCMV DE and late
promoters has been well documented in transient-assay experiments (9, 35, 43, 45, 73). Further analysis showed that the UL44
promoter and those of other core replication genes require accessory
functions IRS1/TRS1, UL112-UL113, and UL36-UL38 in addition to IE2 p86
and IE1 p72 to be fully activated (30, 71). The absence of
IE1 p72 during infection could thus lead directly to reduced activation
of the UL44 promoter, as observed in these transient assays, or may
result in reduced levels of the accessory transactivators. Either
mechanism could account for the observed defects in ppUL44 accumulation
during CR208 infection. Our data cannot exclude the additional
possibility that IE1 p72 up-regulates ppUL44 levels by a
posttranscriptional mechanism. Regardless of their exact cause,
insufficient levels of ppUL44 or any critical replication protein might
result in the attenuation of CR208 infection prior to DNA replication.
Another possibility is that IE1, either alone or acting with other
viral functions, sustains the host cell through viral infection. IE1
p72 and IE2 p86 have been attributed antiapoptotic effects (85), and IE1 p72 was the stronger of the two. While we
did not directly evaluate apoptosis in this study, it is possible that cells infected nonproductively with CR208 are lost through apoptosis. However, a large population of CR208-infected cells containing IE2 but not ppUL44 was observed at both 24 and 48 hpi. The
apparent stability of this abortively infected cell population argues
that the observed failure in ppUL44 accumulation occurs prior to any
apoptotic events.
Finally, expression of ie2 products mediates a shutoff of
ie1-ie2 gene expression via crs (12, 41,
53) that may be accentuated in the absence of IE1 p72. Shutoff of
the MIEP may thus occur more readily in cells infected with CR208.
However, many CR208-infected cells accumulated significant amounts of
the major regulatory protein IE2 p86 without accumulating ppUL44,
while wild-type-infected cells containing similar amounts of IE2
p86 had also accumulated ppUL44 (Fig. 8). This observation suggests
that even if MIEP shutoff is increased in CR208 infections, the absence
of IE1 p72 probably impacts directly on downstream gene expression
also.
We do not anticipate that altered ppUL44 levels are the sole mediator
of the loss of replicative potential in the absence of IE1 p72. As
suggested above, levels of accessory viral transactivators may also be
reduced during CR208 infection, as may levels of other viral DE
products. The levels during CR208 infection of a wider range of viral
IE and DE gene products are currently being investigated. We also do
not yet know which features of high-multiplicity infection by CR208
bypass the requirement for IE1 function in ppUL44 accumulation and
productive infection. These effects could potentially be mediated either by an increased dosage of the viral genomic template, by an
increased dosage of virion transactivator proteins, or by some other
stimulatory signal delivered to cells upon infection with HCMV.
The growth phenotype of the ie1 mutants in primary
fibroblasts
lytic growth at high multiplicities, a low plating
efficiency, small plaques, and a nonlinear relationship between
inoculum size and plaque number
is strikingly similar to the growth
phenotype of mutants of HSV that are unable to express the IE
regulatory protein ICP0 or Vmw110 (61, 77). Other
similarities between the two proteins include their synergistic
transactivating functions in combination with the major transcriptional
transactivators IE2 p86 and ICP4 (18, 45, 50, 73) and the
abilities of both proteins to target and modify PML-associated nuclear
domain 10 (ND10) bodies (1, 19, 34, 37). It has also been
observed that HCMV coinfection can supply functions which complement
the low-multiplicity plating defect of an HSV-1 ICP0 mutant
(76), although the HCMV gene products responsible have not
been identified. It is attractive to speculate that HCMV IE1 and HSV-1
ICP0, although apparently not homologs, may have evolved to perform
fundamentally similar functions in these two distantly related
herpesviruses.
 |
ACKNOWLEDGMENTS |
This work was supported by a Wellcome Career Development
Fellowship held by R.F.G. at Cambridge University and by NIH grant PHS
RO1 AI33852 to E.S.M.
We thank Denise Galloway, Eli Gilboa, Lenore Pereira, Bodo Plachter,
Maria Grazia Revello, and Mark Wills for their generous gifts of
reagents. R.F.G. thanks John Sinclair and Patrick Sissons for their
active support of his work at Cambridge and Mat Bentham for his
technical assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Medicine, Level 5 Addenbrookes Hospital, Hills Rd., Cambridge CB2 2QQ, United Kingdom. Phone: 44-1223-336860. Fax: 44-1223-336846. E-mail: rfg{at}mole.bio.cam.ac.uk
 |
REFERENCES |
| 1.
|
Ahn, J.-H., and G. S. Hayward.
1997.
The major immediate-early proteins IE1 and IE2 of human cytomegalovirus colocalize with and disrupt PML-associated nuclear bodies at very early times in infected permissive cells.
J. Virol.
71:4599-4613[Abstract].
|
| 2.
|
Anderson, K. P.,
M. C. Fox,
V. Brown-Driver,
M. J. Martin, and R. F. Azad.
1996.
Inhibition of human cytomegalovirus immediate-early gene expression by an antisense oligonucleotide complementary to immediate-early RNA.
Antimicrob. Agents Chemother.
40:2004-2011[Abstract].
|
| 3.
|
Arlt, H.,
D. Lang,
S. Gebert, and T. Stamminger.
1994.
Identification of binding sites for the 86-kilodalton IE2 protein of human cytomegalovirus within an IE2-responsive viral early promoter.
J. Virol.
68:4117-4125[Abstract/Free Full Text].
|
| 4.
|
Azad, R. F.,
V. Brown-Driver,
K. Tanaka,
R. M. Crooke, and K. P. Anderson.
1993.
Antiviral activity of a phosphorothioate oligonucleotide complementary to RNA of the human cytomegalovirus major immediate-early region.
Antimicrob. Agents Chemother.
37:1945-1954[Abstract/Free Full Text].
|
| 5.
|
Britt, W. J., and C. A. Alford.
1996.
Cytomegalovirus, p. 2493-2523. In
B. N. Fields (ed.), Virology.
Lippincott-Raven, Philadelphia, Pa.
|
| 6.
|
Bryant, L. A., and J. H. Sinclair.
1993.
Inhibition of human cytomegalovirus majo |