This Article Full Text Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kim, S. K. Articles by O'Callaghan, D. J. Search for Related Content PubMed PubMed Citation Articles by Kim, S. K. Articles by O'Callaghan, D. J.

A Negative Regulatory Element (Base Pairs –204 to –177) of the EICP0 Promoter of Equine Herpesvirus 1 Abolishes the EICP0 Protein's trans-Activation of Its Own Promoter

Department of Microbiology and Immunology and Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, Louisiana

Received 22 April 2004/ Accepted 21 June 2004

The early EICP0 protein is a powerful trans-activator that activates all classes of equine herpesvirus 1 (EHV-1) promoters but, unexpectedly, trans-activates its own promoter very weakly. Transient transfection assays that employed constructs harboring deletions within the EICP0 promoter indicated that EICP0 cis-acting sequences within bp –224 to –158 relative to the first ATG abolished the EICP0 protein's trans-activation of its own promoter. When inserted into the promoters of other EHV-1 genes, this sequence also downregulated activation of the immediate-early IE(–169/+73), early thymidine kinase TK(–215/+97), and late glycoprotein K gK(–83/+14) promoters, indicating that the cis-acting sequence (–224 to –158) downregulated expression of representative promoters of all classes of EHV-1 genes and contains a negative regulatory element (NRE). To define the cis-acting element(s), three synthetic oligonucleotides (Na [bp –224 to –195], Nb [bp –204 to –177], and Nc [bp –185 to –156]) were synthesized and cloned upstream of the EICP0(–157/–21) promoter. Of the three synthetic sequences, only the Nb oligonucleotide caused the downregulation of the EICP0 promoter. The NRE was identified as a 28-bp element to lie at –204 to –177 that encompassed the sequence of ([–204]AGATACAGATGTTCGATAAATTGGAACC[–177]). Gel shift assays performed with mouse L-M, rabbit RK-13, and human HeLa cell nuclear extracts and -³²P-labeled wild-type and mutant NREs demonstrated that a ubiquitous nuclear protein(s) (NRE-binding protein, NREBP) binds specifically to a sequence (bp –193 to –183) in the NRE. The NREBP is also present in the nucleus of EHV-1-infected cells; however, the amount of NREBP in EHV-1-infected L-M cells that bound to the Nb oligonucleotide was reduced compared to that in uninfected L-M cells. Transient transfection assays showed that deletions or mutations within the NREBP-binding site abolished the NRE activity of the EICP0 promoter. These results suggested that the NREBP may mediate the NRE activity of the EICP0 promoter and may function in the coordinate expression of EHV-1 genes.

This article has been cited by other articles:

• Kim, S. K., Ahn, B. C., Albrecht, R. A., O'Callaghan, D. J. (2006). The Unique IR2 Protein of Equine Herpesvirus 1 Negatively Regulates Viral Gene Expression.. J. Virol. 80: 5041-5049 [Abstract] [Full Text]  
• Smith, P. M., Kahan, S. M., Rorex, C. B., von Einem, J., Osterrieder, N., O'Callaghan, D. J. (2005). Expression of the Full-Length Form of gp2 of Equine Herpesvirus 1 (EHV-1) Completely Restores Respiratory Virulence to the Attenuated EHV-1 Strain KyA in CBA Mice. J. Virol. 79: 5105-5115 [Abstract] [Full Text]