This Article
Right arrow Full Text
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chang, P.-J.
Right arrow Articles by Miller, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chang, P.-J.
Right arrow Articles by Miller, G.

 Previous Article  |  Next Article 

Journal of Virology, April 2002, p. 3168-3178, Vol. 76, No. 7
0022-538X/02/$04.00+0     DOI: 10.1128/JVI.76.7.3168-3178.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Open Reading Frame 50 Protein of Kaposi's Sarcoma-Associated Herpesvirus Directly Activates the Viral PAN and K12 Genes by Binding to Related Response Elements

Pey-Jium Chang,1 Duane Shedd,2 Lyn Gradoville,2 Myung-Sam Cho,3 Lee-Wen Chen,1 Jimmy Chang,1 and George Miller1,2,4*

Departments of Pediatrics,1 Epidemiology and Public Health,4 Molecular Biophysics and Biochemistry, Yale University School of Medicine, New Haven, Connecticut,3 Molecular and Cell Biology, Process Sciences, Biotechnology, Bayer Corporation, Berkeley, California2

Received 8 November 2001/ Accepted 8 January 2002

Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cells and B cells in the absence of other KSHV proteins. The responsive region of DNA can be transferred to a heterologous minimal promoter. Extensive point mutagenesis showed that a span of at least 20 nt is essential for a response to ORF 50 protein. However, a minimum of six positions within this region were ambiguous. The related 26-nt responsive element in the K12 promoter (K12p), 5' GGAAATGGGTGGCTAACCCCTACATA, shares 20 nt (underlined) with the comparable region of PANp. The divergence is primarily at the 3' end. The DNA binding domain of ORF 50 protein, encompassing amino acids 1 to 490, fused to a heterologous activation domain from herpes simplex virus VP16 [ORF 50(1-490)+VP] can mediate activation of reporter constructs bearing these response elements. Most importantly, ORF 50(1-490)+VP can induce PAN RNA and K12 transcripts in transfected cells. ORF 50(1-490)+VP expressed in human cells binds specifically to duplex oligonucleotides containing the responsive regions from PANp and K12p. These DNA-protein complexes were supershifted by antibody to VP16. ORF 50(1-490) without a VP16 tag also bound to the response element. There was a strong correlation between DNA binding by ORF 50 and transcriptional activation. Mutations within PANp and K12p that impaired transactivation by ORF 50 or ORF 50(1-490)+VP also abolished DNA binding. Only one of eight related complexes formed on PANp and K12p oligonucleotides was due to ORF 50(1-490)+VP. The other complexes were due to cellular proteins. Two KSHV lytic-cycle promoters are activated by a similar mechanism that involves direct recognition of a homologous response element by the DNA binding domain of ORF 50 protein in the context of related cellular proteins.


* Corresponding author. Mailing address: Room 420 LSOG, 333 Cedar St., New Haven, CT 06520. Phone: (203) 785-4758. Fax: (203) 785-6961. E-mail: George.Miller{at}Yale.edu.


Journal of Virology, April 2002, p. 3168-3178, Vol. 76, No. 7
0022-538X/02/$04.00+0     DOI: 10.1128/JVI.76.7.3168-3178.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Izumiya, Y., Izumiya, C., Hsia, D., Ellison, T. J., Luciw, P. A., Kung, H.-J. (2009). NF-{kappa}B Serves as a Cellular Sensor of Kaposi's Sarcoma-Associated Herpesvirus Latency and Negatively Regulates K-Rta by Antagonizing the RBP-J{kappa} Coactivator. J. Virol. 83: 4435-4446 [Abstract] [Full Text]  
  • Wen, H.-J., Minhas, V., Wood, C. (2009). Identification and characterization of a new Kaposi's sarcoma-associated herpesvirus replication and transcription activator (RTA)-responsive element involved in RTA-mediated transactivation. J. Gen. Virol. 90: 944-953 [Abstract] [Full Text]  
  • Bu, W., Palmeri, D., Krishnan, R., Marin, R., Aris, V. M., Soteropoulos, P., Lukac, D. M. (2008). Identification of Direct Transcriptional Targets of the Kaposi's Sarcoma-Associated Herpesvirus Rta Lytic Switch Protein by Conditional Nuclear Localization. J. Virol. 82: 10709-10723 [Abstract] [Full Text]  
  • Chang, P.-J., Shedd, D., Miller, G. (2008). A Mobile Functional Region of Kaposi's Sarcoma-Associated Herpesvirus ORF50 Protein Independently Regulates DNA Binding and Protein Abundance. J. Virol. 82: 9700-9716 [Abstract] [Full Text]  
  • Palmeri, D., Spadavecchia, S., Carroll, K. D., Lukac, D. M. (2007). Promoter- and Cell-Specific Transcriptional Transactivation by the Kaposi's Sarcoma-Associated Herpesvirus ORF57/Mta Protein. J. Virol. 81: 13299-13314 [Abstract] [Full Text]  
  • Carroll, K. D., Khadim, F., Spadavecchia, S., Palmeri, D., Lukac, D. M. (2007). Direct Interactions of Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 ORF50/Rta Protein with the Cellular Protein Octamer-1 and DNA Are Critical for Specifying Transactivation of a Delayed-Early Promoter and Stimulating Viral Reactivation. J. Virol. 81: 8451-8467 [Abstract] [Full Text]  
  • Bu, W., Carroll, K. D., Palmeri, D., Lukac, D. M. (2007). Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 ORF50/Rta Lytic Switch Protein Functions as a Tetramer. J. Virol. 81: 5788-5806 [Abstract] [Full Text]  
  • El-Guindy, A., Heston, L., Delecluse, H.-J., Miller, G. (2007). Phosphoacceptor Site S173 in the Regulatory Domain of Epstein-Barr Virus ZEBRA Protein Is Required for Lytic DNA Replication but Not for Activation of Viral Early Genes. J. Virol. 81: 3303-3316 [Abstract] [Full Text]  
  • Carroll, K. D., Bu, W., Palmeri, D., Spadavecchia, S., Lynch, S. J., Marras, S. A. E., Tyagi, S., Lukac, D. M. (2006). Kaposi's Sarcoma-Associated Herpesvirus Lytic Switch Protein Stimulates DNA Binding of RBP-Jk/CSL To Activate the Notch Pathway. J. Virol. 80: 9697-9709 [Abstract] [Full Text]  
  • Heston, L., El-Guindy, A., Countryman, J., Dela Cruz, C., Delecluse, H.-J., Miller, G. (2006). Amino Acids in the Basic Domain of Epstein-Barr Virus ZEBRA Protein Play Distinct Roles in DNA Binding, Activation of Early Lytic Gene Expression, and Promotion of Viral DNA Replication.. J. Virol. 80: 9115-9133 [Abstract] [Full Text]  
  • Ziegelbauer, J., Grundhoff, A., Ganem, D. (2006). Exploring the DNA Binding Interactions of the Kaposi's Sarcoma-Associated Herpesvirus Lytic Switch Protein by Selective Amplification of Bound Sequences In Vitro. J. Virol. 80: 2958-2967 [Abstract] [Full Text]  
  • Gonzalez, C. M., Wong, E. L., Bowser, B. S., Hong, G. K., Kenney, S., Damania, B. (2006). Identification and Characterization of the Orf49 Protein of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol. 80: 3062-3070 [Abstract] [Full Text]  
  • Bryan, B. A., Dyson, O. F., Akula, S. M. (2006). Identifying cellular genes crucial for the reactivation of Kaposi's sarcoma-associated herpesvirus latency.. J. Gen. Virol. 87: 519-529 [Abstract] [Full Text]  
  • Wong, E. L., Damania, B. (2006). Transcriptional Regulation of the Kaposi's Sarcoma-Associated Herpesvirus K15 Gene. J. Virol. 80: 1385-1392 [Abstract] [Full Text]  
  • CONRAD, N.K., FOK, V., CAZALLA, D., BORAH, S., STEITZ, J.A. (2006). The Challenge of Viral snRNPs. Cold Spring Harb Symp Quant Biol 71: 377-384 [Abstract]  
  • Lu, F., Day, L., Lieberman, P. M. (2005). Kaposi's Sarcoma-Associated Herpesvirus Virion-Induced Transcription Activation of the ORF50 Immediate-Early Promoter. J. Virol. 79: 13180-13185 [Abstract] [Full Text]  
  • Chen, L.-W., Chang, P.-J., Delecluse, H.-J., Miller, G. (2005). Marked Variation in Response of Consensus Binding Elements for the Rta Protein of Epstein-Barr Virus. J. Virol. 79: 9635-9650 [Abstract] [Full Text]  
  • Izumiya, Y., Ellison, T. J., Yeh, E. T. H., Jung, J. U., Luciw, P. A., Kung, H.-J. (2005). Kaposi's Sarcoma-Associated Herpesvirus K-bZIP Represses Gene Transcription via SUMO Modification. J. Virol. 79: 9912-9925 [Abstract] [Full Text]  
  • Chang, P.-J., Shedd, D., Miller, G. (2005). Two Subclasses of Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle Promoters Distinguished by Open Reading Frame 50 Mutant Proteins That Are Deficient in Binding to DNA. J. Virol. 79: 8750-8763 [Abstract] [Full Text]  
  • Rickabaugh, T. M., Brown, H. J., Wu, T.-T., Song, M. J., Hwang, S., Deng, H., Mitsouras, K., Sun, R. (2005). Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 RTA Reactivates Murine Gammaherpesvirus 68 from Latency. J. Virol. 79: 3217-3222 [Abstract] [Full Text]  
  • Ye, J., Shedd, D., Miller, G. (2005). An Sp1 Response Element in the Kaposi's Sarcoma-Associated Herpesvirus Open Reading Frame 50 Promoter Mediates Lytic Cycle Induction by Butyrate. J. Virol. 79: 1397-1408 [Abstract] [Full Text]  
  • Jung Song, M., Hwang, S., Wong, W., Round, J., Martinez-Guzman, D., Turpaz, Y., Liang, J., Wong, B., Johnson, R. C., Carey, M., Sun, R. (2004). The DNA Architectural Protein HMGB1 Facilitates RTA-Mediated Viral Gene Expression in Gamma-2 Herpesviruses. J. Virol. 78: 12940-12950 [Abstract] [Full Text]  
  • Chang, P.-J., Miller, G. (2004). Autoregulation of DNA Binding and Protein Stability of Kaposi's Sarcoma-Associated Herpesvirus ORF50 Protein. J. Virol. 78: 10657-10673 [Abstract] [Full Text]  
  • Wang, Y., Li, H., Chan, M. Y., Zhu, F. X., Lukac, D. M., Yuan, Y. (2004). Kaposi's Sarcoma-Associated Herpesvirus ori-Lyt-Dependent DNA Replication: cis-Acting Requirements for Replication and ori-Lyt-Associated RNA Transcription. J. Virol. 78: 8615-8629 [Abstract] [Full Text]  
  • Malik, P., Blackbourn, D. J., Cheng, M. F., Hayward, G. S., Clements, J. B. (2004). Functional co-operation between the Kaposi's sarcoma-associated herpesvirus ORF57 and ORF50 regulatory proteins. J. Gen. Virol. 85: 2155-2166 [Abstract] [Full Text]  
  • Liang, Y., Ganem, D. (2004). RBP-J (CSL) Is Essential for Activation of the K14/vGPCR Promoter of Kaposi's Sarcoma-Associated Herpesvirus by the Lytic Switch Protein RTA. J. Virol. 78: 6818-6826 [Abstract] [Full Text]  
  • Damania, B., Jeong, J. H., Bowser, B. S., DeWire, S. M., Staudt, M. R., Dittmer, D. P. (2004). Comparison of the Rta/Orf50 Transactivator Proteins of Gamma-2-Herpesviruses. J. Virol. 78: 5491-5499 [Abstract] [Full Text]  
  • Wang, S. E., Wu, F. Y., Chen, H., Shamay, M., Zheng, Q., Hayward, G. S. (2004). Early Activation of the Kaposi's Sarcoma-Associated Herpesvirus RTA, RAP, and MTA Promoters by the Tetradecanoyl Phorbol Acetate-Induced AP1 Pathway. J. Virol. 78: 4248-4267 [Abstract] [Full Text]  
  • Gwack, Y., Nakamura, H., Lee, S. H., Souvlis, J., Yustein, J. T., Gygi, S., Kung, H.-J., Jung, J. U. (2003). Poly(ADP-Ribose) Polymerase 1 and Ste20-Like Kinase hKFC Act as Transcriptional Repressors for Gamma-2 Herpesvirus Lytic Replication. Mol. Cell. Biol. 23: 8282-8294 [Abstract] [Full Text]  
  • Liao, W., Tang, Y., Kuo, Y.-l., Liu, B.-Y., Xu, C.-J., Giam, C.-Z. (2003). Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 Transcriptional Activator Rta Is an Oligomeric DNA-Binding Protein That Interacts with Tandem Arrays of Phased A/T-Trinucleotide Motifs. J. Virol. 77: 9399-9411 [Abstract] [Full Text]  
  • Song, M. J., Deng, H., Sun, R. (2003). Comparative Study of Regulation of RTA-Responsive Genes in Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8. J. Virol. 77: 9451-9462 [Abstract] [Full Text]  
  • Wang, S. E., Wu, F. Y., Yu, Y., Hayward, G. S. (2003). CCAAT/Enhancer-Binding Protein-{alpha} Is Induced during the Early Stages of Kaposi's Sarcoma-Associated Herpesvirus (KSHV) Lytic Cycle Reactivation and Together with the KSHV Replication and Transcription Activator (RTA) Cooperatively Stimulates the Viral RTA, MTA, and PAN Promoters. J. Virol. 77: 9590-9612 [Abstract] [Full Text]  
  • Liang, Y., Ganem, D. (2003). Lytic but not latent infection by Kaposi's sarcoma-associated herpesvirus requires host CSL protein, the mediator of Notch signaling. Proc. Natl. Acad. Sci. USA 100: 8490-8495 [Abstract] [Full Text]  
  • Dourmishev, L. A., Dourmishev, A. L., Palmeri, D., Schwartz, R. A., Lukac, D. M. (2003). Molecular Genetics of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Epidemiology and Pathogenesis. Microbiol. Mol. Biol. Rev. 67: 175-212 [Abstract] [Full Text]  
  • Nakamura, H., Lu, M., Gwack, Y., Souvlis, J., Zeichner, S. L., Jung, J. U. (2003). Global Changes in Kaposi's Sarcoma-Associated Virus Gene Expression Patterns following Expression of a Tetracycline-Inducible Rta Transactivator. J. Virol. 77: 4205-4220 [Abstract] [Full Text]  
  • Gwack, Y., Baek, H. J., Nakamura, H., Lee, S. H., Meisterernst, M., Roeder, R. G., Jung, J. U. (2003). Principal Role of TRAP/Mediator and SWI/SNF Complexes in Kaposi's Sarcoma-Associated Herpesvirus RTA-Mediated Lytic Reactivation. Mol. Cell. Biol. 23: 2055-2067 [Abstract] [Full Text]  
  • Izumiya, Y., Lin, S.-F., Ellison, T., Chen, L.-Y., Izumiya, C., Luciw, P., Kung, H.-J. (2002). Kaposi's Sarcoma-Associated Herpesvirus K-bZIP Is a Coregulator of K-Rta: Physical Association and Promoter-Dependent Transcriptional Repression. J. Virol. 77: 1441-1451 [Abstract] [Full Text]  
  • Ueda, K., Ishikawa, K., Nishimura, K., Sakakibara, S., Do, E., Yamanishi, K. (2002). Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Replication and Transcription Factor Activates the K9 (vIRF) Gene through Two Distinct cis Elements by a Non-DNA-Binding Mechanism. J. Virol. 76: 12044-12054 [Abstract] [Full Text]  
  • Deng, H., Song, M. J., Chu, J. T., Sun, R. (2002). Transcriptional Regulation of the Interleukin-6 Gene of Human Herpesvirus 8 (Kaposi's Sarcoma-Associated Herpesvirus). J. Virol. 76: 8252-8264 [Abstract] [Full Text]