This Article Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Stinski, M F Articles by Roehr, T J Search for Related Content PubMed PubMed Citation Articles by Stinski, M F Articles by Roehr, T J

 Previous Article  |  Next Article 

J Virol. 1985 August; 55(2): 431-441

Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

ABSTRACT

Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene.

This article has been cited by other articles:

• Kalejta, R. F. (2008). Tegument Proteins of Human Cytomegalovirus. Microbiol. Mol. Biol. Rev. 72: 249-265 [Abstract] [Full Text]  
• Shen, P., Niu, G., Yao, M., Wang, H., Fei, J. (2007). Studying on the 19-bp Palindrome Repeats in Human Cytomegalovirus Immediate Early Enhancer/Promoter Reveals their Diversity in Function for the Promoter Activity. J Biochem 142: 25-31 [Abstract] [Full Text]  
• Lu, F., Day, L., Lieberman, P. M. (2005). Kaposi's Sarcoma-Associated Herpesvirus Virion-Induced Transcription Activation of the ORF50 Immediate-Early Promoter. J. Virol. 79: 13180-13185 [Abstract] [Full Text]  
• Ostedgaard, L. S., Rokhlina, T., Karp, P. H., Lashmit, P., Afione, S., Schmidt, M., Zabner, J., Stinski, M. F., Chiorini, J. A., Welsh, M. J. (2005). A shortened adeno-associated virus expression cassette for CFTR gene transfer to cystic fibrosis airway epithelia. Proc. Natl. Acad. Sci. USA 102: 2952-2957 [Abstract] [Full Text]  
• Schierling, K., Stamminger, T., Mertens, T., Winkler, M. (2004). Human Cytomegalovirus Tegument Proteins ppUL82 (pp71) and ppUL35 Interact and Cooperatively Activate the Major Immediate-Early Enhancer. J. Virol. 78: 9512-9523 [Abstract] [Full Text]  
• Blancou, P., Chenciner, N., Fang, R. H. T., Monceaux, V., Cumont, M.-C., Guetard, D., Hurtrel, B., Wain-Hobson, S. (2004). Simian Immunodeficiency Virus Promoter Exchange Results in a Highly Attenuated Strain That Protects against Uncloned Challenge Virus. J. Virol. 78: 1080-1092 [Abstract] [Full Text]  
• Keller, M. J., Wheeler, D. G., Cooper, E., Meier, J. L. (2003). Role of the Human Cytomegalovirus Major Immediate-Early Promoter's 19-Base-Pair-Repeat Cyclic AMP-Response Element in Acutely Infected Cells. J. Virol. 77: 6666-6675 [Abstract] [Full Text]  
• Hofmann, H., Sindre, H., Stamminger, T. (2002). Functional Interaction between the pp71 Protein of Human Cytomegalovirus and the PML-Interacting Protein Human Daxx. J. Virol. 76: 5769-5783 [Abstract] [Full Text]  
• Meier, J. L., Keller, M. J., McCoy, J. J. (2002). Requirement of Multiple cis-Acting Elements in the Human Cytomegalovirus Major Immediate-Early Distal Enhancer for Viral Gene Expression and Replication. J. Virol. 76: 313-326 [Abstract] [Full Text]  
• Hummel, M., Zhang, Z., Yan, S., DePlaen, I., Golia, P., Varghese, T., Thomas, G., Abecassis, M. I. (2001). Allogeneic Transplantation Induces Expression of Cytomegalovirus Immediate-Early Genes In Vivo: a Model for Reactivation from Latency. J. Virol. 75: 4814-4822 [Abstract] [Full Text]  
• Sanchez, T. A., Habib, I., Leland Booth, J., Evetts, S. M., Metcalf, J. P. (2000). Zinc Finger and Carboxyl Regions of Adenovirus E1A 13S CR3 Are Important for Transactivation of the Cytomegalovirus Major Immediate Early Promoter by Adenovirus. Am. J. Respir. Cell Mol. Bio. 23: 670-677 [Abstract] [Full Text]  
• Meier, J. L., Pruessner, J. A. (2000). The Human Cytomegalovirus Major Immediate-Early Distal Enhancer Region Is Required for Efficient Viral Replication and Immediate-Early Gene Expression. J. Virol. 74: 1602-1613 [Abstract] [Full Text]  
• Homer, E. G., Rinaldi, A., Nicholl, M. J., Preston, C. M. (1999). Activation of Herpesvirus Gene Expression by the Human Cytomegalovirus Protein pp71. J. Virol. 73: 8512-8518 [Abstract] [Full Text]  
• Goins, W. F., Lee, K. A., Cavalcoli, J. D., O'Malley, M. E., DeKosky, S. T., Fink, D. J., Glorioso, J. C. (1999). Herpes Simplex Virus Type 1 Vector-Mediated Expression of Nerve Growth Factor Protects Dorsal Root Ganglion Neurons from Peroxide Toxicity. J. Virol. 73: 519-532 [Abstract] [Full Text]  
• Angulo, A., Messerle, M., Koszinowski, U. H., Ghazal, P. (1998). Enhancer Requirement for Murine Cytomegalovirus Growth and Genetic Complementation by the Human Cytomegalovirus Enhancer. J. Virol. 72: 8502-8509 [Abstract] [Full Text]  
• Christenson, S. D., Lake, K. D., Ooboshi, H., Faraci, F. M., Davidson, B. L., Heistad, D. D., Finklestein, S. P. (1998). Adenovirus-Mediated Gene Transfer In Vivo to Cerebral Blood Vessels and Perivascular Tissue in Mice • Editorial Comment. Stroke 29: 1411-1416 [Abstract] [Full Text]  
• Samaniego, L. A., Neiderhiser, L., DeLuca, N. A. (1998). Persistence and Expression of the Herpes Simplex Virus Genome in the Absence of Immediate-Early Proteins. J. Virol. 72: 3307-3320 [Abstract] [Full Text]  
• Nauseef, W. M., Cogley, M., McCormick, S. (1996). Effect of the R569W Missense Mutation on the Biosynthesis of Myeloperoxidase. J. Biol. Chem. 271: 9546-9549 [Abstract] [Full Text]  
• Liu, Y., Liggitt, D., Zhong, W., Tu, G., Gaensler, K., Debs, R. (1995). Cationic Liposome-mediated Intravenous Gene Delivery. J. Biol. Chem. 270: 24864-24870 [Abstract] [Full Text]  
• Iwasaki, K, Temin, H M (1990). The efficiency of RNA 3'-end formation is determined by the distance between the cap site and the poly(A) site in spleen necrosis virus.. Genes Dev. 4: 2299-2307 [Abstract]